BIOPHYSICAL AND FUNCTIONAL STUDIES OF pRNA: A SELF-ASSOCIATING RNA
by
YUMENG HAO
B.S., CHINA AGRICULTURAL UNIVERSITY, BEIJING, 2008
A thesis submitted to the Faculty of the Graduate School of the University of Colorado in partial fulfillment
of the requirements for the degree of Doctor of Philosophy
Molecular Biology Program 2015
ii This thesis for the Doctor of Philosophy degree by
Yumeng Hao
has been approved for the Molecular Biology Program
by
David J. Barton, Chair Jeffrey S. Kieft, Advisor
Thomas Blumenthal Elan Eisenmesser Jerome Schaack Rui Zhao Date 4/6/2015
iii Hao, Yumeng (Ph.D., Molecular Biology)
Biophysical and Functional Studies of pRNA: A Self-associating RNA Thesis directed by Professor Jeffrey S. Kieft
ABSTRACT
The packaging RNA (pRNA) found in the phi29 family of bacteriophage is an essential component of a powerful molecular motor used to package the phage's DNA genome into the capsid. The pRNA forms a higher-order multimer by intermolecular "kissing" interactions between identical molecules and is the only known naturally-occurring self-associating RNA. pRNAs could be building blocks for nanotechnology and they are good models to explore the principles of RNA self-association. To uncover rules that could guide rational engineering of pRNA self-association, I examined the multimerization behavior of pRNAs from different phi29 family members, pRNA mutants, and chimeric pRNAs using a combination of biochemical and biophysical methods. I discovered that phylogenetically related pRNAs from phi29 family phages have diverse self-association properties. I found that the three-way junction (3wj) within each pRNA, despite not making direct intermolecular contacts, plays important roles in stabilizing the intermolecular interactions and dictating the size of the multimer formed (dimer, trimer, etc.). Specifically, the 3wj in the pRNA from phage M2 appears to favor a different tertiary conformation compared to the 3wj in the pRNA from phi29, and M2’s junction facilitates formation of a higher order multimer that is more thermostable than phi29’s. This previously undescribed behavior may provide us new scaffolds to engineer fine-tuned behaviors into
iv pRNAs and also shed light on the mechanisms of RNA self-association. Ongoing efforts include developing a system to explore pRNA’s role in phage and solving a high-resolution pRNA structure.
The form and content of this abstract are approved. I recommend its publication.
v To my mom, for always believing in me and encouraging
me to pursuit my dreams.
To my undergraduate mentor, Professor Jialin Yu, for the guidance and inspirations along my scientific career
谨将此论⽂文献给 我亲爱的⺟母亲
vi ACKNOWLEDGEMENTS
From the bottom of my heart, I am truly thankful for my brilliant teachers, mentors, friends and my loving family, who have given their guidance, support, love and encouragements during my graduate school years.
First and foremost, I want to thank my mentor, Jeff. Thank for letting me join the lab, giving me a project that I am truly passionate about, guiding me during graduate school and always believing in me. You push me when
necessary and allow me to grow in my own way. You train and shape me into a mature graduate student and prepare me for my future scientific career. I could not have imagined having a better advisor and mentor for my Ph.D study. Second, I want to thank all the former and current Kieft lab members. J, Aimee, Terra, Tim and James, all of you taught me how to do RNA biochemistry, how to purify protein, how to give a talk and how to ask the right questions. Thanks for being supportive all the time. Thank David for all you have done on a day-to-day basis that allows the whole lab to function smoothly. Thank you for explaining tons of English words and grammar for me, educating me in baseball and football, sharing the same interests in the Simpsons and donuts (Mmm, donuts...) and for your friendship and support. Thank Megan and Marisa, for being someone I can always turn to when I have questions. You give me so much good advices and suggestions about my project and I am so grateful to have the chance to work along with you in the lab. Both of you are like the sisters I never have. The great time we spent together in the lab and outside the lab will always make me smile. Thank Erich, Ben and Dan for mentoring me through my
vii postdoc application and dissertation writing and for believing that I am ready. Thank Zane, Erik, Brian, for great questions during lab meeting, for suggestions at my practice talk and the multiple discussions about my projects. I also want to thank Andrea, although we did not share much time in lab together, we did have a lot of fun going to various musicals, museums and art galleries, thanks for being my friend. Thank Jeff and everyone in the Kieft lab, all of you give me a great experience in the lab and make me feel at home! I am grateful for the years I spend with this family, for every laugh we share, for every chance we have to grow, I will take the best of them with me and lead by their examples wherever I go.
I also want to thank my committee members, Profs. David Barton, Tom Blumenthal, Elan Eisenmesser, Jerome Schaack and Rui Zhao, thanks for all your inputs and suggestions for my project and your supports during my graduate school. Thank Profs. James DeGregori, Bob Sclafani, Mair Churchill, Chad
Pearson, Aaron Johnson, Michael McMurray and Tânia Reis, for letting me use lab instruments, for the help and discussions about my projects, for the advice and suggestions for my scientific career, but most of all, for treating me more like a colleague rather than a student.
To all my friends, I realize it is impossible to list you all here, and every one of you means a lot to me. Sometimes it is hard to go to graduate school in a different country that speaks a different language, but I am so grateful to have so many friends helping me and supporting me along the way. All of you let me realize that home is not a place but rather a feeling; time is not measured by
viii years but by moments and memories. I graciously appreciate all of you by my side.
To my family: each of you has been important for me and I value your support beyond words. Mom, you are my hero! Thanks for letting me get
interested in biology at a young age. The first two words I learned in biology were bacteria and virus, back when I was three that you explained to me why I have to wash hands before eating meals. This early-established interest turns into a passion in life. Thank you not planning a career for me and encouraging me to pursuit my dream. The freedom you gave me makes me into a well-rounded person who not only works hard but also knows how to cherish and enjoy life. Thank grandpa Wenhong and grandma Lifang for raising me and nurturing me to be a good person. They teach me to be kind and respectful to others, to be brave and independent, to live each day to the fullest and savor life. I cannot achieve this much without the support from my family and I am sincerely grateful for everything they have done.
I also want to express my gratitude to my undergraduate mentor, Prof. Jialin Yu at China Agricultural University, for the guidance and inspirations along my scientific career. You lead me to science, empower me to see a possible future and plant a dream in my heart. I couldn’t be where I am today without you.
Thank the Molecular Biology Program and Biochemistry department. Thank Professor David Lilley from University of Dundee for the help and discussion of my FRET data analyses. The AUC and FRET experiments are preformed using instruments in the Biophysics core. Funding for this research
ix was supported by an American Heart Association pre-doctoral fellowship
(13PRE14500042).
x CONTENTS CHAPTER I INTRODUCTION... 1 Bacteriophage overview... 1 History... 1
Structure and classification... 4
Bacteriophage life cycle... 6
dsDNA phage assembly... 8
phi29-like phage virology... 10
Genome... 11
Replication... 14
Transcription... 16
The phi29 packaging motor... 19
The phi29 pRNA... 22
The pRNA from the phages in the phi29 family... 24
The phi29 connector protein... 25
The phi29 ATPase... 27
Mechanism of the phi29 phage packaging... 27
The phi29 packaging RNA in nanotechnology... 29
II. MATERIALS AND METHODS... 33
RNA preparation... 33
5' end radiolabeling of DNA primers... 34
xi
Nondenaturing gel electrophoresis... 35
Selective 2' hydroxyl acylation analyzed by primer extension (SHAPE)... 35
Dimenthyl sulfate (DMS) probing... 36
Sedimentation velocity analytical ultracentrifugation (SV-AUC)... 38
Sedimentation equilibrium analytical ultracentrifugation (SE-AUC)... 38
Hydroxyl radical probing of RNA structure... 40
Three-way junction (3wj) constructs formation... 41
Förster resonance energy transfer (FRET)... 42
SHAPE analyses for RNA structural changes induced by crystallization... 44
phi29 genome extraction... 46
phi29 genome amplification... 48
Constructing a plasmid containing the phi29 genome... 49
Yeast plasmid extraction... 51
Yeast DNA extraction... 52
Wizard Genomic DNA purification kit... 53
Yeast DNA guanidine prep... 54
Bacillus subtilis competent cell preparation... 55
Bacillus subtilis transformation... 57
The phi29 phage plaque assay... 57
III. BIOPHYSICAL ANALYSES OF THE SELF-ASSOCIATING pRNA IN THE PHI29 FAMILY PHAGES... 59
xii
Results... 63
The multimerization properties of the phi29 pRNA constructs are affected by the kissing interaction... 63
Diverse phi29 family pRNAs form multimers of different stoichiometry and thermostability... 75
Initial pRNA engineering reveals the role of “scaffold” in the pRNA multimerization... 91
Exploring the role of the three-way junction containing “scaffold”... 93
Discussion... 97
Future direction... 103
IV. DIFFERENT THREE-WAY JUNCTION (3WJ) INDICATE DIVERSE SELF-ASSOCIATION PROPERTIES WITHIN THE PHI29 FAMILY pRNAs... 105
Introduction... 105
Results... 108
Exchanging two pRNA 3wjs alters self-association behavior... 108
pRNA three-way junction do not assume a stable compact fold... 108
The phi29 and M2 pRNA 3wjs favor different helical arrangement in solution... 113
Higher-order self-association depends on cooperation between favorable junctions... 117
Discussion... 119
Future directions... 124
V. THE ROLE OF pRNA IN THE PHI29 PHAGE INFECTION... 127
Introduction... 127
xiii
Constructing a vector containing the phi29 genome... 129
Setting up the system to generate chimeric phages... 136
Discussion... 145
Future directions... 148
VI. PROGRESS TOWARDS HIGH RESOLUTION STRUCTURE OF A BACTERIOPHAGE SELF-ASSOCIATING RNA... 150
Introduction... 150
Results... 153
The M2 pRNA has different modification patterns under three environments... 153
Engineering the potential crystal packing regions results various crystal morphologies and crystallization conditions... 158
Discussion... 162
Future direction... 163
VII. CONCLUSIONS... 164
Importance of understanding pRNA... 164
Connection between the multimerization and function of pRNA... 165
REFERENCES... 168
APPENDIX... 185
A. DIFFERENT pRNA CONSTRUCTS... 185
B. pRNA CONSTRUCT PRIMERS... 186
C. RNA PROBING PRIMERS... 194
xiv TABLES TABLE 1.1 Bacteriophage classification... 5
1.2 Tailed bacteriophage genus... 6
1.3 phi29-like phages classification... 10
1.4 The phi29 early and late genes... 11
1.5 Promoters in the phi29 genome... 16
2.1 Equations used to analyze the FRET data... 43
2.2 PCR setup for phi29 genome amplification... 48
2.3 PCR reaction for phi29 genome amplification... 49
2.4 Reactions for yeast DNA recombination... 50
2.5 Reactions for phage plaque assay... 58
3.1 Differences between SV-AUC and SE-AUC... 68
3.2 Sedimentation velocity analytical ultracentrifugation measurements for phi29 pRNAs... 70
3.3 Calculated values for phi29 pRNAs based on sedimentation velocity analytical ultracentrifugation measurements... 71
3.4 Sedimentation velocity analytical ultracentrifugation measurements for phi29 family pRNAs... 80
3.5 Calculated values for phi29 family pRNAs based on sedimentation velocity analytical ultracentrifugation measurements... 80
3.6 Sedimentation equilibrium AUC measurements... 90
3.7 SV-AUC measurements for chimeric constructs... 92
5.1 Multimerization of different pRNAs in the phi29 phage family... 128
xv 6.1 Examples of M2 pRNA crystallization conditions and
crystal morphologies... 160
xvi FIGURES
FIGURE
1.1 A generalized assembly pathway scheme for the dsDNA tailed
bacteriophage... 9
1.2 Genetic and transcriptional maps of phi29, B103 and GA1 phages... 12
1.3 The phi29 phage structure and protein composition... 13
1.4 The phi29 phage packaging motor structure... 21
3.1 Multimerization characterizations of phi29 pRNAs... 66
3.2 Dimethyl sulfate (DMS) probing of phi29 pRNAs... 73
3.3 phi29 family constructs SHAPE analyses... 76
3.4 Multimerization characterizations of pRNAs from the phi29 family... 78
3.5 DMS probing of phi29 family pRNAs... 82
3.6 Sedimentation equilibrium analytical ultracentrifugation of three pRNAs... 88
3.7 Characterizing multimerization properties of the chimeric constructs... 94
3.8 DMS probing of chimeric constructs... 95
3.9 Native gel electrophoresis of chimeric mutants testing the M2 scaffold... 98
4.1 Native gel analyses or the three-way junction constructs... 109
4.2 Fe(II) EDTA hydroxyl radical footprinting... 111
4.3 Native gel electrophoresis for the phi29 and M2 three-way junctions... 114
4.4 Förster resonance energy transfer (FRET) to test 3wjs conformations... 116
xvii
4.5 Native gel electrophoresis for M2_phi29 and M2 titration... 118
4.6 Three-way junction (3wj) topological classification... 122
4.7 The phi29 three-way junction crystal structures... 123
5.1 The phi29 genome extraction, amplification and manipulation... 132
5.2 The verification of the vector containing the phi29 genome... 134
5.3 The phage plaque assay setup... 137
5.4 The phi29 wild type phage plaque assay and negative stain EM... 139
5.5 Setting up the system to generate chimeric phages and evaluate their infectivities... 142
6.1 The M2 pRNA crystal formation... 155
6.2 SHAPE analyses of M2 pRNA in three different conditions... 156
6.3 The secondary structures for new M2 pRNA constructs... 159
1 CHAPTER I
INTRODUCTION
Bacteriophage overview
Bacteriophages, or phages for short, are viruses that infect bacteria. Like all other viruses, the bacteriophages require a cellular host and are specific to one or a limited number of hosts. The bacteriophage genome is made of either DNA or RNA and the genome is encapsulated with a shell made of proteins.
History
In the mid-1890s, before the official discovery of bacteriophage, several bacteriologists had reported observing unidentified substances that seemed to be responsible for limiting bacteria activity and growth (1-3). However, none of them followed up to explore the phenomenon they reported. Then in 1915, a British bacteriologist Frederick Twort reported the same phenomenon and advanced a hypothesis that the unidentified substance might be a virus that grew on and destroyed the bacteria (3, 4). Twort’s phage research was interrupted with World War I and his paper remained relatively unnoticed. Two years later, Félix
d'Hérelle, a French-Canadian microbiologist, published his own observations that a filterable agent was capable of transmissible lysis of growing cultures of
bacteria (3, 5). In his paper, d'Hérelle stated that “the agent was an
ultramicroscopic organism, a filterable being, parasite of bacteria, endowed with functions of assimilation and reproduction” and he gave this agent a name,
2 “bacteriophage”, from the word bacteria and the Greek word “phagein” which means to eat or devour (5, 6).
After this discovery, the study of phage rapidly became so popular that most of the leading bacteriologists after World War I were doing phage research. The first area that scientists studied in some detail was the initial step in
bacteriophage infection, the adsorption of the bacteriophage to bacterial cells (7, 8). With the application of the electron microscope (9), the individual phages were visualized when interacting with the bacterial cells. The research showed that specific phage had characteristic morphologies and led to further studies of phage assembly and classification (2, 10).
The “modern” age of bacteriophage research started with the work of Max Delbrück in the late 1930s. He established the lytic mechanism of phage and studied the genetic changes after phage infected bacteria (8, 11-13). However, there was still controversy over whether protein or DNA carried the genetic information in virus, until 1952 when Al Hershey and Martha Chase performed a series of experiments using bacteriophages (14, 15). They proved DNA was the molecule that carried genetic information in virus (15). During the pioneering years of molecular biology, scientists using phage as a model were able to ask complicated biological questions, such as: What is a gene? How do mutations occur and affect genes? How do genes replicate and express?
Around 1970 biological research was transformed by the “recombinant DNA revolution”. Many basic molecular biology techniques that made this revolution possible were developed from the phage research (14, 16, 17).
3 Moreover, most of the fundamental molecular biology findings were discovered using phage as a model system (13-21). Although the advancements of
molecular biology decreased the number of researchers working primarily on phage, at the same time the biological research that used some form of phage in their research increased substantially because many tools of modern molecular biology were phage or phage-derived.
In recent years, there are more and more new techniques derived from phage that provide new insights and findings (2). With all the information gathered from previous research, biologists can ask more practical questions, such as how to use phage to treat antibiotic-resistant bacteria and combat bacterial infection (22, 23), how to engineer phage parts to be used in
nanotechnology and gene therapy (24-29), how the phage population in human digestive system affects microbiome composition (30, 31), and whether we can use phage or phage gene products as potential therapeutic agents (2, 31, 32). Additionally, phage-derived techniques still innovate the molecular biology field, such as phage display for high-throughput screening of protein interactions (33, 34), bacteriophage-derived parts for synthetic biology (35, 36), phage-assisted continuous evolution (PACE) to accelerate evolution (37), and clustered regularly interspaced short palindromic repeats (CRISPR) for genome engineering (38-40).
As one of the primary tools and model systems that established the
foundation of molecular biology, bacteriophage research is now in a renaissance in which the focus of the study switches from phage itself to the mechanisms they reveal. Despite the long history of phage research, there are still many
4 mechanisms that are not understood, which define the future direction of phage research.
Structure and classification
Bacteriophages have been found in diverse habitats and are the most abundant biological entities in the biosphere (41). Bacteriophages have been estimated to be present at 1030 copies in the ocean and 1031 in the entire
biosphere (42). They are diverse in size, shape, morphology and life cycle in the host. There are multiple classification systems for phage, the most standard one is built and derived from a scheme proposed by Bradley in 1967 (43). Up to now, the International Committee on Taxonomy of Viruses (ICTV) classifies phage into one order, 14 families and 37 genera according to morphology and nucleic acids (10, 44).
Based on the nucleic acid type, bacteriophages can be divided into
dsDNA (vast majority), ssDNA, dsRNA or ssRNA phages, shown in Table 1.1 (10, 44). Based on the morphology, the bacteriophages can be classified into tailed (96%), cubic, filamentous or pleomorphic (10, 44).
Although divided into 14 families and having different sizes and shapes, most of the bacteriophages have the same basic features: a head or capsid and a tail. The head structure, regardless of its size and shape, is composed of proteins to protect the phage genome. Although some phages do not have a tail, most of the phages have a tail attached to the head. The tail is made of proteins and shaped like a hollow tube. This tube is the channel for the phage
5 genome to pass through during infection. Some of the more complicated phages such as T4 have a tail with a base plate as well as fibers that helps the phage attach to the bacterial cell.
Since the tailed bacteriophages make up the majority (~96%) (10), the classification of tailed bacteriophages is discussed more here (Table 1.2). The tailed phages all belong to the Caudovirales order and are classified into three different families, Myoviridae, Siphoviridae and Podoviridae. The Myoviridae
Table 1.1 Bacteriophage classification
Order Family Morphology Genome Examples
Caudovirales
Myoviridae Tail, contractile
dsDNA
T4, P2, P4 Siphoviridae Long tail,
non contractile λ, T5
Podoviridae Short tail phi29, T7
Tectiviridae Inner lipid vesicle, pseudotail PRD1 Corticoviridae Complex capsid, lipid PM2
Lipothrixviridae Envelop, lipids Plasmaviridae Envelop, lipids,
no capsid Rudiviridae Resembles TMV Fuselloviridae Spindle-shaped, no capsid Guttaviridae Droplets-shaped Inoviridae Filaments or rods ssDNA fd Microviridae 12 knoblike capsomers ΦX174
Leviviridae Like poliovirus ssRNA MS2 Cytoviridae Segmented,
6 family phages have long contractile tails, the Siphoviridae family phages have long contractile tails, and the Podoviridae family phages have short non-contractile tails (44). Contractile and non-non-contractile tails refer to whether the tail contracts or not during phage infection. The phages with contractile tails during infection use a syringe-like motion to contract the tails and inject their genome into the cell, while phages with noncontractile tails enzymatically degrade a portion of the cell membrane to let the genome enter into the cell (45-48).
Table 1.2 Tailed bacteriophage genus
Family Genus Species Members Principal hosts
Myoviridae T4 like 7 47 (+100) Enterobacteria P1 like 3 12 Enterobacteria P2 like 2 16 Enterobacteria Mu like 1 2 Enterobacteria SP01 like 1 13 Bacillus ΦH like 1 2 Halobacterium Siphoviridae λ like 1 7 Enterobacteria T1 like 1 11 (+50) Enterobacteria T5 like 1 5 (+20) Enterobacteria L5 like 1 4 (+15) Mycobacterium c2 like 1 5 (+200) Lactococcus ΨM1 like 1 3 Methanobacterium Podoviridae T7 like 3 26 Enterobacteria P22 like 1 11 Enterobacteria Φ29 like 4 12 Bacillus
Bacteriophage life cycle
Bacteriophages have two types of life cycles: the lytic cycle or the
lysogenic cycle. There are phages that can carry out both (10). The lytic phages kill the host bacterium, while the lysogenic phages establish a persistent
7 The lytic cycle includes seven steps: adsorption, penetration, early protein synthesis, viral DNA replication, late protein synthesis, phage assembly and lysis (18). The phage adsorbs near the bacteria host in a passive way and once it is close to the surface, it starts to attach its own tail proteins to the surface receptor on the bacteria to initiate the penetration process (8, 50). The penetration
process refers to the process of the phage injecting its own genome into the bacteria host (49). This process often contains multiple steps in which a certain phage tail protein interacts with the surface protein to digest the bacteria host cell wall (49). The phage genome then enters the bacteria host to initiate early
protein synthesis, followed by viral DNA replication and late protein synthesis. Once all the essential components are made, the mature phages are assembled within, and released from, the host bacterium. The released mature phages then can infect another bacterium (18, 49).
Different from lytic phages, the lysogenic phages (in most cases) can integrate their DNA into the host chromosome and replicate with the host
chromosome (18, 51, 52). The integrated phage in this case is termed prophage (18, 52). The prophage can confer new features to the bacteria and this is called phage conversion. The lysogenic phages can be terminated when the host
bacterium is under stress, such as exposure to UV or ionizing radiation, exposure to mutagenic chemicals, etc. (16, 18, 52). The lysogenic phage DNA is excised from the host bacterial chromosome and transcribed and translated to make coat proteins. Then the mature phages are released from the host. The released phages are capable of infecting new hosts (17, 53).
8 dsDNA phage assembly
Since dsDNA phages are the vast majority in a phage population, the pathway they use to package their genomic DNA within the phage head will be mainly discussed in this section. The dsDNA phage assembly is a complex and well-organized process. Early studies of dsDNA phage assembly showed that such assembly processes almost invariably followed well-defined pathways (54-60). Using specific pathways allows quality control over each step and the process does not proceed until the previous step is completed. In this case, the dead-end product isn’t assembled into mature phages. In 1968, Wood, Edgar and colleagues first discovered the T4 phage used a specific assembly pathway (54-56). Although there are considerable variations in the details of assembly pathways of different dsDNA phages, the generic assembly pathways are shown in Figure 1.1. The dsDNA phages build procapsids, which generally contain a protein shell, a portal protein, and an internal scaffold protein (54). Then the scaffold protein is removed and the DNA genome enters the procapsid through the portal protein. The capsid is completed by adding several proteins (54). In the short tailed phages, the tail is built on the head by sequential binding of tail
proteins (54). In the long tailed phages, the tail is built separately from the distal end towards the proximal head end and once it finishes, the tail spontaneously attaches to a finished head (54-60).
9 Fi gur e 1 .1 A g en e ra li ze d a s se m b ly p a th w a y s ch e m e f o r th e d s D N A t ai le d b a c te ri o p h a g e D iff e re n t co m p o n e nt s a re co lo re d in b lu e w hi le d iff e re n t in te rm e di a te st ru ct u re s a re co lo re d in b la ck.
10 phi29-like phage virology
phi29-like phages are the smallest dsDNA phage that infects Bacillus subtilis and are one of the smallest dsDNA phages found in nature so far. The family belongs to the Caudovirales order, Podoviridae family and phi29-like phage genus (61). As the classification indicates, the phi29-like phages have linear dsDNA genomes and are tailed phages with short, non-contractile tails. The phi29-like family contains several strains that can be classified into three subclasses (Table 1.3). Class I includes phi29, phi15, phi21, BS32, PZA and PZE. Class II includes M2, B103 and Nf. Class III, which is the most distant from the other two has only one member, GA1 (61, 62).
The phi29 phage was first isolated by Reilly (63), B103 was first isolated from a nonspecific Bacillus culture (64) and phage GA1 was first isolated from rotting lawn mowings (65). The phi29 can infect Bacillus subtilis strains 168, 110NA, and Marburg, Bacillus amyloliquefacien H and several strains of Bacillus licheniformis and Bacillus pumilus (62). The full B103 host range has not been studied; however, it is known to infect Bacillus subtilis 9/3 (66). On the other hand, the GA1 was shown to infect Bacillus species strain G1R and was unable to infect the standard Bacillus subtilis strain 168 (65).
Table 1.3 phi29-like phages classification
Class Members Location
Class I phi29, phi15, phi21, BS32, PZA, PZE
United States
Class II M2, B103, Nf Japan
Class III GA1 Europe
11 Genome
The phi29-like phages have a dsDNA genome about 20 kb long, which makes them the smallest dsDNA phages reported (61, 62). The phi29, M2 and GA1 genomes are illustrated in Figure 1.2. The genome contains early genes and late genes (Table 1.4). In general, the early genes are involved in DNA replication, mRNA transcription and some genes in DNA packaging. The late genes are mainly structural proteins that form the mature virus. The phi29 phage structure and protein composition is illustrated in Figure 1.3.
Table 1.4 The phi29 early and late genes
Gene names Function
Early genes
gp1 Involved in dsDNA replication gp2 DNA polymerase
gp3 Terminal protein gp4 Transcription regulator gp5 ssDNA binding
gp6 dsDNA binding
gp16.7 Involved in dsDNA replication gp17 Involved in dsDNA replication
Late genes gp7 Scaffold gp8 Head protein gp8.5 Head fiber gp9 Tail protein gp10 Connector (portal) gp11 Lower collar gp12 Preneck appendage gp13 Morphogenesis gp14 Holin gp15 Peptidoglycan hydrolase gp16 ATPase, DNA encapsidation
12 Fi gur e 1 .2 G en et ic an d t ran scr ip ti o n al m ap s o f p h i2 9, B 103 an d G A 1 p h ag es G e n es a re la b e le d w ith n u m be rs a nd le tt e rs. P ro m ot e rs ar e la be le d in t he r e ct a n g le s an d t h e tr a n scr ip tio n d ir ect io n s a re la b e le d w ith a rr o w s. T h is fig u re is m o di fie d f ro m M ije r, p h i2 9 f am ily o f p ha g e s, 2 0 0 1 .
13 Figure 1.3 The phi29 phage structure and protein composition
The mature phi29 phage structure is illustrated in the left; different proteins are labeled with name and gene product names in the right.
14 Replication
The phi29-like phages use an unusual DNA replication mechanism, which is called protein-primed DNA initiation (67, 68). There are a few types of phages found so far that use this mechanism, such as the Streptococcus pneumonia phage CP-1, E. coli phage PRD1 and Bacillus subtilis phage phi29. This protein-primed DNA replication mechanism is also found in adenovirus, some plasmids such as S1 and Kalilo, and Streptomyces bacteria (67-69).
The phi29-like phages contain a protein that is covalently linked to the 5' end of the viral linear dsDNA genome, which is called the terminal protein (68). The reason these phages contain a terminal protein is that rather than using a 3' OH group provided by RNA or DNA primers, these phages use a 3' OH group of a serine, threonine or tyrosine residue of the terminal protein to initiate replication (68, 70). For phi29 phage specifically, the 3' OH group of Ser232 in the terminal protein (gp3) is used (71).
The phi29 phage DNA replication process is as follows: The terminal protein gp3 and phi29 DNA polymerase (gp2) first forms a heterodimer and then the phi29 dsDNA binding protein (gp6) helps unwind the ends of the dsDNA genome (72). The gp2 catalyzes the formation of a covalent bond between the first inserted nucleotide (dAMP) and the gp3 after the genome unwinding process (73). Then the gp2 synthesizes a short elongation product and disassociates from gp3. This starts the replication elongation stage (73, 74). The replication elongation starts at both DNA ends, coupled with strand displacement. This process generates the type I replication intermediates with full-length dsDNA and
15 different lengths of ssDNA branches, which are bound with phi29 ssDNA binding protein (gp5) (75). When the two converging DNA polymerases merge, a type I replication intermediate becomes physically separate and forms two type II replication intermediates (76). The elongation process continues with the phi29 DNA polymerase to replicate the parental strand. The replication is terminated when the DNA polymerase reaches the end of the phi29 genome (76, 77).
Due to the special features of the protein-primed initiation and the
requirement of a short product synthesis to proceed with replication elongation, the phi29-like phages have evolved to all have similar sequences at the end of the genome (74, 78, 79). In the left end of the genome, all phi29-like phages contain a short, inverted terminal repeat with slightly different sequences. phi29, PZA, phi15 and B103 all have six nucleotides (5' AAAGTA) (74, 78, 79). Nf and M2 have eight nucleotides (5' AAAGTAAG) (80, 81), and GA1 has seven
nucleotides (5’ AAATAGA) (74). The conservation of having adenosines as the first nucleotide is for linking the gp3 to the 5’ end of the genome.
Research suggests that when the phage infects the cells at a low multiplicity, gp17 is required for efficient DNA replication (82). However, this effect is not required when the infection is at a high multiplicity. This indicates that gp17 stimulates DNA replication when there are limiting amounts of template DNA and replication proteins, and gp17 is important at early infection times (83). For gp16.7 and gp1, their function is not fully understood, however, they may be part of the DNA replication complex that attached to the bacteria membrane (84).
16 Transcription
phi29 transcripts are divided into two groups, the early transcripts and the late transcripts (61). Generally speaking, early transcripts are located at the ends of the genome and transcribed from right to left and the late transcripts are
clustered in the middle of the genome and transcribed from left to right (85, 86). So far, the phi29 transcription mechanism is most studied compared to the B103 and GA1 transcription. Since all the phi29-like phages have similar genome organization and similar compositions and positions for promoters, they may share a similar transcription mechanism (Fig. 1.2) (61, 83). The phi29 phage transcription will be discussed in this section.
There are nine promoters found in the phi29 genome, with seven of them in charge of early transcription. One is constitutive transcribed and one
corresponds to late transcription (87). The early promoters have the consensus sequences that correspond to the ones used by the Bacillus subtilis RNA
polymerase with the σ43 subunit (TTGACA at the -35 region and TATAAT at the -10 region). The late promoter has the TATAAT consensus sequence at the -10
Table 1.5 Promoters in the phi29 genome
Name Expression Genes transcribed by the promoter A1 Constitutive pRNA
A1 IV Early weak in vivo
A2c Early genes 6-1
A2b Early genes 6-1
A3 Late genes 8-16
B1 Early weak in vivo
B2 Early weak in vivo
C1 Early genes 16.5, 16.6 C2 Early genes 17, 16.7
17 region but no consensus sequence at the -35 region (87, 88).
The phi29 genome starts early transcription with Bacillus subtilis RNA polymerase with the σ43 subunit binding to early promoter A2b, A2c, C1 and C2.
The early transcription includes the genes involved in DNA replication (gp2, gp3, gp5, gp6 and gp17) and transcription regulator gp4 (88-91).
a. Early promoters A2c, A2b and late promoter A3 in phi29 phage As shown in Figure 1.2, the early promoters A2c, A2b and the late promoter A3 are located in close proximity. Previous research shows that the switch between the early promoters A2c, A2b and the late promoter A3 are regulated by transcription regulator gp4 and dsDNA binding protein gp6 (88-93).
The phi29 gp4 is an early gene product, which is dimer in solution and binds to its cognate DNA binding sites as a tetramer by contacting only one side of the DNA helix. The gp4 represses early promoters A2c and A2b using different mechanisms. For the early promoter A2b, binding of the gp4 to the genome masks the -35 region of the A2b promoter, preventing the expression of this promoter. For the early promoter A2c, binding of the gp4 to the genome is stabilized by the existence of the RNA polymerase. In this case, the RNA polymerase can generate abortive initiation transcripts but is unable to escape from the A2c promoter. The gp4 represses the A2c promoter by forming an overstabilized complex of the RNA polymerase and A2c promoter. The gp4 binding repressed the A2b, A2c promoter and activates the A3 promoter. The A3 promoter lacks the consensus sequence in the -35 region, therefore, the RNA polymerase alone would not be able to bind the A3 promoter efficiently. However,
18 the binding of p4 protein upstream of the A3 promoter helps stabilize the binding of RNA polymerase to the A3 promoter.
There are some recent studies showing that other than gp4, the phi29 dsDNA binding protein gp6 promotes the binding of gp4 in repressing A2b and A2c (90, 93).
b. Early promoters C1, C2 in phi29 phage
Both C1 and C2 are located to the right end of the genome. The C2
promoter activity has been reported to decrease rapidly 10 minutes after infection. The decrease is mediated by dsDNA binding protein (gp6) binding to the end of the genome for DNA replication (61, 72). The C1 promoter is located within the early operon and may drive the expression of ORFs 16.6 and 16.5. Previous research suggested that gp6 represses the expression of the phi29 C1 promoter as well (72, 90, 93).
c. Promoter A1 in phi29 phage
For the phi29 phage, it has been reported that the genome packaging requires a 174 nucleotide-long RNA component, a phage-encoded packaging RNA (pRNA) (94). Promoter A1, which is located at the 5’ end of the genome, is responsible for the production of this phage pRNA (87, 95, 96). The production of pRNA has been detected at early infection times and shown to have a rapid increase around 15 minutes after infection, which coincides with the start of phi29 DNA replication. The increase in the production of the phage genome produced explains the increase of the pRNA and indicates the A1 promoter has a constant transcription rate (88).
19 The phi29 packaging motor
During viral assembly, the phi29 bacteriophage uses a packaging motor to package its genome into a preformed capsid in order to form a mature virion (97). The phi29 packaging motor has three components: a bacteriophage-encoded packaging RNA (pRNA), a connector protein (gp10) and an ATPase (gp16) (98, 99). The cryo-EM structure of the packaging motor showed that pRNA forms a homo-pentamer, the connector protein has a dodecamic symmetry and the ATPase is a pentamer (99). All three components form a ring structure to package the phi29 dsDNA genome into the capsid. There are three features about this packaging motor that I want to emphasize here. First, it is highly efficient. Previous research has shown that it can package the phi29 19.3kb genome in around five minutes in vitro (100). The initial packaging rate for the phi29 motor is 100 base pairs per second and gradually drops to zero when all the DNA packages and the capsid is full (100). Second, this is by far one of the most powerful motors reported in a biological system. This motor can work against tremendous loads and after all the genome is packaged, the pressure inside the capsid is roughly 57 piconewton (pN), which is roughly ten times the pressure inside a champagne bottle (100). The stall force for this motor is about eight times higher than kinesin or myosin II motors, and it is two times higher than that for RNA polymerase (101-103). Third, previous research has shown that it is possible for this packaging motor to package non-phage-specific dsDNA, which makes this motor an attractive candidate as a delivery system for gene therapy (104).
20 Although all the components are known for this packaging motor, the detailed mechanism by which it operates is not clear. The questions include but are not limited to: (a) How do different components interact and coordinate with each other? (b) What is the mechanical aspect of this motor, more specifically, how is the energy generated to power the whole motor? (c) This motor and some other phage packaging motors have mismatched symmetry between different components. The viral capsid, the pRNA and the ATPase all have five-fold symmetries, while the connector protein has a 12-fold symmetry. How does this mismatch symmetry contribute to its function?
The phi29 packaging motor is the most studied one in the phi29 phage family, other packaging motors in the phi29 family, such as M2, SF5, GA1 and B103, are poorly understood. With limited information, previous research has been able to show that all packaging motors from the phi29 family strains have similar component compositions, that they all contain a pRNA, a connector
protein and an ATPase (61). Compared to other phages, the phi29 family phages are unique because they are the only phages discovered so far that use a
packaging RNA in their packaging motors. This feature raises more questions such as: (a) What is the role of the packaging RNA in the motor? (b) Can we “mix and match” components from different phages? (c) How do the differences in motor composition affect the packaging process?
In this section of the introduction, I will focus on some previous research about each component and the packaging mechanism of the phi29 motor.
21 Figure 1.4 The phi29 phage packaging motor structure
A. The phi29 packaging motor with the phage procapsid. The red box area is highlighted and labeled with components for the motor. The partial model of the phi29 packaging motor is generated based on a cryo-EM reconstruction of the whole phi29 packaging motor (Morais et al. 2008), the crystal structure of phi29 packaging RNA (Ding et al. 2011), and the phi29 connector protein crystal structure (Simpson et al. 2001).
B. The phi29 packaging RNA. The full length is 174 nt and the region that is required for DNA packaging in vitro is highlighted in the box. The DNA
translocation domain is in grey box and the connector interaction domain is in white box. The pRNA ring structure is shown to the right.
C. The phi29 connector protein crystal structure. Left is the side view and right is the top view.
22 The phi29 pRNA
In 1987, an RNA component was found to be essential for the phi29 genomic DNA packaging process and it could be isolated from pre-mature virion (94). This RNA is the only RNA reported so far that forms a high-order multimer by intermolecular interaction between identical molecules in nature. In other words, it is the only naturally-occurring self-associating RNA. The full length of pRNA is 174 nt, however, only the first 120 nt is necessary for DNA packaging in vitro (105). The 120 nt pRNA contains two independent domains, the DNA
translocation domain and connector interaction domain (106, 107). The phi29 pRNA multimerizes via a kissing interaction, which contain four base pairs, AACC and UUGG (106, 108). Mutations in the kissing interaction harm the phage’s ability to infect the bacterial host (108). This result suggests that the pRNA is an essential component in the phi29 packaging motor, and plays an important role in phage function.
The phi29 pRNA has been studied intensively and some of the results are summarized here (94, 105-120). First, its secondary structure has been
determined by various RNA probing methods, such as RNase V1 and T1 (121), and DMS probing (115) (Fig. 1.4 B). Second, there are two domains within the pRNA and both domains interact with different components within the motor. The connector interaction domain (white box region, Fig. 1.4 B) is the minimum region for the pRNA to bind the phi29 connector protein (107), while the 120 nt pRNA is the region for efficient connector binding (107). The DNA translocation domain (grey box region, Fig. 1.4 B) interacts with the ATPase. The whole 120 nt pRNA
23 contains domains for both the connector protein and the ATPase interaction and has been shown to be the minimum sequence for DNA packaging in vitro (105, 107). Third, the kissing interaction is important for the pRNA multimerization and the base pairing is essential to generate infectious phages (106, 112). Different pRNA mutants were made with various kissing interactions and added to a reconstituted system to generate phages and test their infectivities. With pRNAs containing mismatched kissing interactions, the phages failed to infect its host (112). With pRNAs containing mutated but base-paired kissing interactions, the phage infected bacteria, but with lower infectivities compared to the wild type phage (112). These results suggest the multimerization of the pRNA is necessary to generate infectious phages.
As an important component in the packaging motor, the symmetry of pRNA is still under discussion and a bit controversial. The Guo group’s native gel and single molecule FRET data suggested the pRNA hexamer was the form that participated in the packaging motor (110, 111, 113, 116, 118). However, their data about pRNA symmetry analyses was on isolated pRNA, therefore, the result was hard to directly relate to the real pRNA organization and its interaction with other components in the packaging motor. The cryoEM structure of the phi29 packaging motor from the Rossman group showed that the pRNA in the phi29 packaging motor formed a pentamer (99). The phi29 packaging motor was extracted from the Bacillus host and contained the packaging RNA (pRNA), the connector protein, the ATPase and the capsid (98, 99). In my opinion, this reflected a biological-relevant condition and reported a more accurate state than
24 the reconstituted system. The disagreement on the pRNA symmetry was
interesting in a way that the differences may indicate how pRNA was recruited to the packaging motor and further suggested different mechanisms in DNA
packaging. All in all, we still don’t have enough information to distinguish between the two models.
The pRNA is essential in the motor and interacts with various components within the packaging motor, such as connector protein (99, 107), ATPase (107, 117) and even viral capsid (122, 123). Moreover, it may undergo conformational changes through multimer formation and later on during genome packaging. Previous research had mapped regions within the pRNA that interact with various components (117, 124), however, we still don’t have a detailed mechanism about how the pRNA is involved in phage DNA packaging.
The pRNAs from the phages in the phi29 family
The pRNAs are only found in the phi29 family phages. As mentioned before, the phi29 family phages are separated into three different classes (125). Previous research showed that all phage strains from this phi29 family contained a pRNA in their packaging motors, and there are multiple studies that examined the pRNA’s secondary structures (125). Although there are no significant
sequence similarities between the phi29 family pRNAs, they tend to have similar overall proposed secondary structures. However, there were two proposed versions of the secondary structure and the probing gels did not provide enough resolution to distinguish between the two versions (126).
25 There were some initial efforts in exploring the multimerization behaviors of different phi29 pRNAs that occurred while I was completing my own studies (126). In that study, different phi29 family pRNAs showed various multimerization behaviors. However, the mechanism behind the diverse multimerization
behaviors was not fully explored. Therefore, more systematic analyses for different phi29 family pRNAs are still necessary and will help us answer
interesting questions including: (a) What are the multimerization behaviors of the phi29 family pRNAs? (b) What is the pRNA’s role in the packaging motor from phi29 family strains? (c) Do different strains in the phi29 phage family use a similar packaging mechanism? The multimerization behaviors of phi29 family pRNAs will be explored in Chapter III.
The phi29 connector protein
The connector protein in the packaging motor is an essential component for motor function. The phi29 connector, a cone-shaped dodecamer of gene product 10 (gp10), occupies the pentagonal vertex at the base of the prohead and is the portal for DNA entry during packaging and DNA ejection during infection. This oligomeric protein plays an important role in the first steps of procapsid assembly and is the central piece of the DNA packaging machinery.
The phi29 connector protein was first purified in 1984 and there were some follow-up studies for improving its purification and some initial efforts in crystallization (127-129). Several physical and structural studies have examined the phi29 connector protein, including atomic force microscopy (130),
immune-26 electron microscopy (131), and cryoEM of two-dimensional arrays (132). These studies revealed that phi29 connector formed a ring structure with 12-fold
symmetry, however, those methods don’t have high enough resolution to reveal more structural details of the phi29 connector protein.
In 2001, the phi29 connector protein structure was solved by X-ray
crystallography (99) (Fig. 1.4 C). The phi29 connector protein dodecamer forms a shallow cone about 75 Angstroms long and the width of the cone span from 138 Angstroms (wide end) to 66 Angstroms (narrow end). The wide end is mainly the C-terminus of the connector and is kept inside the procapsid. The narrow end is mostly the N-terminus of the connector and partially protrudes from the procapsid and interacts with pRNA. The central pore of the connector protein is
approximately 36 Angstroms in diameter at the narrow end and expands at the wide end to allow dsDNA threading through.
Although pRNA and the connector protein have been shown to bind to each other (107), how pRNA is recruited to interact with connector protein is not clear. Specifically speaking, does pRNA interact with the connector via a
monomeric or multimeric manner? In other words, is the multimerization required for the pRNA to bind to the connector protein?
One point I want to emphasize here is that although the packaging motor has three different components, the pRNA and the ATPase are believed to leave after the genome is packaged, which left the connector protein the only
component to attach the tail proteins (133). To date, it is not known what role of the connector protein is playing after the DNA packaging is complete.
27 The phi29 ATPase
The phi29 ATPase has five subunits, and it has been shown to package DNA in a coordinated manner (134). Initial studies indicated that DNA was translocated by 2 base pairs per ATP hydrolyzed (135). Recently, the
development of the optical tweezer technique enabled the ability to observe the packaging motor in action in a single molecule manner (100, 134, 136, 137). At a single molecule level, the Bustamante group was able to show that although the DNA is packaged in 10 bp increments, the packaging occurred in four 2.5 bp steps. In this case, the DNA was translocated by 2.5 base pairs per ATP
hydrolyzed (138). This mechanism revealed that within the five ATPase subunits, only four subunits were involved in DNA translocation, while the other subunit was more likely playing a regulatory role (137-139). In summary, the ATPase provides the energy and the driving force for DNA packaging and it works in a coordinated way.
The phi29 phage packaging mechanism
Several models have been proposed to define the basic mechanism of DNA translocation. Most models assume that the packaging motor uses ATP as fuel to generate the motion of certain part(s) of the motor that is coupled to DNA movement (134, 140, 141). All models agree that the DNA motion must be
translational (linear) (142), involving no significant rotation of DNA. If DNA rotates, it would introduce supertwists and eventually stall the motor, as well as present serious problems for DNA delivery into the host cell (143).
28 The main differences between different models are with respect to which part of the motor moves DNA and the precise mechanism that causes motion. All models fall into two basic types: (a) a rotary motor (136, 144, 145) and (b) a linear motor (142).
The rotary motor consists of a stator and a rotor, or in other words, a portal. For the phi29 packaging motor specifically the portal would be the
connector protein. In this model, the portal is proposed to rotate, and the rotary motion of the portal is coupled to linear motion of DNA. So, the connector is the DNA pump and the ATPase is the ATP energy provider. Although the rotary motors have been well documented in biological systems, such as F1F0-ATP
synthase, coupling between rotary and linear motions is unique and has not been experimentally demonstrated (144).
The linear motor, on the other hand, does not need a rotatory component (142). In this case, the DNA is packaged into the capsid by the linear motion, not rotation, of components within the motor. The packaging process does not require portal rotation, resulting the phi29 ATPase in the motor more likely acts as both the ATP energy provider and the DNA pump. The phi29 connector protein is possible a one-way valve to prevent the packaged DNA from leaking out.
For the phi29 packaging motor, recent studies showed more evidence for the linear model. The phi29 connector protein motion during the DNA packaging was investigated at a single molecule level and no obvious rotation was observed with the phi29 connector (136). This indicates that the phi29 packaging motor
29 was more likely a linear motor in which the DNA translocation is achieved
through and coupled with the motion of the ATPase.
Studying different components within the phi29 packaging motor provide insights on possible mechanisms used by this motor. The putative roles of the phi29 connector protein and the ATPase are mentioned above. However, the role of pRNA within the phi29 packaging motor is still unknown.
The questions I am interested in include: (a) Why does the phi29 packaging motor use an RNA component? (b) How does the pRNA get
recognized by other components in this motor? (c) The pRNA forms pentamer ring in the packaging motor via a kissing interaction. Is the ring formation necessary for pRNA to interact with other components? Some initial efforts towards creating a system that will allow me to answer these questions will be discussed in Chapter V.
The phi29 packaging RNA in nanotechnology
RNA nanotechnology is an emerging field that utilizes RNA for designing novel nanomaterial, nanodevices and delivery vectors for therapy. RNA has several unique attributes that make it a powerful biomaterial compared to DNA (24, 146). RNA can fold into complex structural motifs mediated by canonical and noncanonical base pairings and those structural motifs can be further stabilized by tertiary interactions and complex three-dimension architectures. These include pseudoknots, single-strand loops, bulges, base triples, junctions and hairpins (147-151). Moreover, RNA has some advantages as a delivery agent for in vivo
30 applications. A designed RNA molecule would have defined size, structure and stoichiometry that maintain nanoscale sizes (148-152). Compared to protein, RNA won’t induce antibody responses, which makes them less challenging and more suitable for repeated treatments (147, 149, 153). On the other hand, RNA has limitations as nanotechnology materials due to its chemical and
thermodynamic instabilities and short in vivo half-life (149). In summary, RNA nanotechnology has a promising future in therapeutic usage. However, it needs selection of better candidates and further engineering.
One major goal for RNA nanotechnology is to build a diverse set of RNA nanostructures having unique structural attributes and the ability to self-assemble in a highly programmable and controlled manner (154). In this case,
self-assembling RNA has great features that can be used as ground-up building blocks in RNA nanotechnology. There is research focused on screening and engineering self-assembling RNA to be used in nanotechnology (154-158). The general strategy used by these researches is to first identify suitable “parts” for nanostructure design from known crystal structures, then isolate those regions out and test their abilities to form synthetic nanoarchitectures. There are a few examples of designed RNA nanostructures using this strategy, such as the self-assembling RNA square designed from HCV IRES IIa (156), H-shaped RNA designed from hairpin ribozyme and P4-P6 domains of group I intron (159), and triangle-shaped RNA-protein complexes designed from the kink-turn (K-turn) motifs binding the ribosomal protein L7Ae (160). These synthetic
31 self-assembling RNAs. However, our knowledge on what governs RNA
multimerization in general is limited, which confines further engineering of self-assembling RNA nanostructures.
The pRNAs in phi29 family phages are the only naturally occurring self-associating RNAs reported so far. Therefore, studying how the pRNA
multimerizes can help us understand RNA multimerization mechanisms in general. Also, the pRNA can be used as a potential nanotechnology building block. The two domains contained in the phi29 pRNA, the connector interaction domain and the DNA translocation domain, were shown to be independently folded (107). Since the connector interaction domain contained the kissing interaction for self-association, the Guo group has engineered the DNA
translocation domain in phi29 pRNA for various applications. Both therapeutic siRNA and receptor-binding RNA aptamers were engineered into the DNA translocation domain in individual phi29 pRNA (25, 26, 157, 161). In this case, the pRNA served as a scaffold for carrying therapeutic siRNA and receptor-binding RNA aptamers and can still multimerize via the connector interaction domain. Moreover, there are five or six individual pRNAs in the ring; thus, a pRNA ring can provide five or six possible engineering regions. One goal was to engineer those five or six regions harboring different molecules (such as
aptamers, siRNA, biotin, antibodies, etc.) for cell recognition, therapy and
detection (26, 146, 157, 161-165). Although there were efforts made towards this direction, the promise of using pRNA as a polyvalent delivery vector has not been fulfilled yet.
32 From the building block aspect, the phi29 pRNA three-way junction was shown to have a defined shape using FRET and other methods; therefore, the three-way junction has been proposed for constructing multifunctional
nanoparticles for delivery (29, 120, 166).
Overall, as the only naturally-occurring self-associating RNA, the pRNA is an appealing candidate to be used as a nanotechnology building block and further engineered for therapeutic usage. However, the efforts of utilizing pRNA in nanotechnology were all focused on using and engineering the pRNA from the phi29 strain and other pRNAs from the phi29 family phages were under-studied. In my opinion, the other phi29 family pRNAs may provide us new information, ideas and structural features that can aid us in further engineering and utilizing the pRNAs in nanotechnology. We need more biochemical and biophysical analyses to fully understand the behaviors, especially the multimerization properties of those phi29 family pRNAs. The efforts on characterizing the phi29 family pRNAs will be further discussed in Chapter III.
33 CHAPTER II
MATERIALS AND METHODS
RNA preparation
RNAs for native gels, analytical ultracentrifugation and RNA probing were made with DNA templates generated by PCR using Pfu polymerase (Kieft lab made) and overlapping primers (Appendix B) (167). RNAs were generated by in vitro transcription using the PCR products and T7 RNA polymerase (Kieft lab made). The reactions were incubated at 37 °C for 4 hours then precipitated by adding 3 volumes of ice cold 100% ethanol. The resulting pellet was
resuspended in 9 M urea loading buffer (9 M urea, 5 mM EDTA, 0.5 mg/mL bromophenol blue, 0.5 mg/mL xylene cyanol) and purified on 10%
polyacrylamide (29:1 acrylamide:bisacrylamide) 7 M urea denaturing gels in 1X TBE buffer (167). Bands were identified using UV shadowing and then excised and eluted in RNase-free water overnight at 4°C. The gel pieces were filtered out of solution using a 0.22 µm filter (Millipore, USA). The eluted solution was then concentrated using Amicon Ultra filters 10K MWCO (Millipore, USA). pRNA concentrations were measured by UV absorbance at 260 nm (Nanodrop 2000c, Thermo Scientific, USA).
34 5' end radiolabeling of DNA primers
DNA primers were 5'-radiolabeled in a reaction containing 40 µM purified primer, 2 µL of 10X polynucleotide kinase (PNK) buffer (70 mM Tris-HCl at pH 7.6, 10 mM MgCl2, 5 mM DTT, New England Biolabs (NEB), USA), 2 µL of T4
PNK (10,000 U/mL, New England Biolabs, USA), 1 µL of γ -32P-ATP (6000 Ci/mmol, Perkin Elmer, USA) in a final volume of 20 µL. Reactions were incubated at 35 °C for 1 hour and then added to 10 µL 9M urea loading buffer and loaded on a 10% polyacrylamide (29:1 acrylamide:bisacrylamide) 7 M urea denaturing gel (16.5 cm X 3.25 cm X 3.1 mm) and electrophoresed at 25 W for 15 minutes. Gels were visualized by autoradiography, then the primer bands were excised and eluted passively in elution buffer (0.5 M sodium acetate, 0.1% SDS, pH 5.3) overnight. This was followed by ethanol precipitation and the dried pellet was resuspended in RNase-free water prior to use.
5' end radiolabeling of RNA
RNA was 5' dephosphorylated using rAPid Alkaline Phosphatase (Roche, USA). 1 µg of RNA was added to 1X PNK buffer (70 mM Tris-HCl, 10 mM MgCl2,
5 mM DTT, pH 7.6), 20 units PNK enzyme and 1 µL of γ -32P-ATP (6000 Ci/mmol,
Perkin Elmer, USA) in a 10 µL solution. The reaction was incubated at 37 °C for 1 hour, followed by desalting using a Micro Bio-Spin 30 Chromatography Column (Bio-Rad, USA). Sample was added to equal volume of RNA loading buffer and purified on a 10% denaturing polyacrylamide gel. Gels were visualized by autoradiography, and the RNA bands were excised and eluted passively in
35 elution buffer (0.5 M sodium acetate, 0.1% SDS, pH 5.3) overnight. The RNA was then precipitated by added 3 volume of ice-cold 100% ethanol. The resulting pellet was dried using a SpeedVac (Tomy MicroVac, USA) and resuspended in RNase-free water prior to use.
Nondenaturing gel electrophoresis
Nondenaturing gel electrophoresis experiments were performed as described (167). 3 µg RNA in a total volume of 10 µL was loaded. The pRNA sample was renatured by heating to 85 °C for 15 seconds in Mg-Buffer (66 mM Tris, 34 mM HEPES, 5 mM MgCl2, pH 7.4) or EDTA-Buffer (66 mM Tris, 34 mM
HEPES, 2 mM EDTA, pH 7.4) then snap cooled on ice. Samples were mixed with equal volume of 2X native gel loading buffer (132 mM Tris, 68 mM HEPES, 10% glycerol, 0.5 mg/mL bromophenol blue, 0.5 mg/mL xylene cyanol, pH 7.4 with either 10 mM MgCl2 for Mg2+ gels or 4 mM EDTA for EDTA gels) and were run
on an 8% polyacrylamide native gel (29:1 acrylamide:bisacrylamide with Mg-buffer for Mg2+ gels or EDTA-buffer for EDTA gels). Both gel and buffer were pre-incubated at desired temperatures and the gels were pre-run for 20 minutes at 5 W. Gels were run at 5 W for 10 hours and then stained with 1% ethidium bromide for visualization.
Selective 2’ hydroxyl acylation analyzed by primer extension (SHAPE) 6 pmol of RNA in 8 µL of RNase-free water was heated to 85 °C for 30 sec, then cooled on the bench. 2 µL of RNA folding buffer (333 mM HEPES at pH 8.0,
36 20 mM MgCl2, 333 mM NaCl) was added. 1 µL of DMSO was added to the
DMSO controls and 1 µL of 50mM, 100 mM or 150 mM N-methylisatoic
anhydride (NMIA) prepared in DMSO was added to the experimental reactions. Reactions were incubated at 37 °C for one hour and then desalted using Micro Bio-Spin 30 Tris Chromatography Columns (Bio-Rad, USA). Reverse
transcription (RT) was performed with SuperScript® III Reverse Transcriptase (Life technologies, USA) and with 1 µL of one of the following primers:
M2 primer (5'- GGGTAAGTGGGTTATCAAT- 3'), SF5 primer (5'-GGGCAAGAGTGTTTTACGCTC- 3'), GA1 primer (5'-GGTAGTATTGCTACCTCGCAAC- 3'), or B103 primer (5'-GGGTAAGTGGGCTATCAATCC- 3').
All primers were 5'-end labeled with 32P and diluted to 30,000 cpm/µL. Reverse transcription was performed as described (167, 168). Gels were aligned using the Semi-Automated Footprinting Analysis (SAFA) software (169) and different lanes were normalized to total radiation using ImageQuant software (Molecular Dynamics, USA) followed by background subtraction of the control lanes in Microsoft Excel.
Dimethyl sulfate (DMS) probing
10 pmol of RNA in 8 µL of RNase-free water with 2 µL of 5X DMS probing buffer (400 mM sodium cacodylic acid at pH 7.2, 500 mM KCl and 25 mM MgCl2
for Mg2+ probing or 10 mM EDTA for EDTA probing) was heated to 85 °C for 30 sec, then cooled on the bench. 2 µL of 95% ethanol was added to the controls
37 and 2 µL of 2.64 M DMS (Sigma-Aldrich, USA) in 95% ethanol was added to the reactions. Reactions were incubated at desired temperature for 10 min and then quenched with 5 µL DMS stop buffer (1.0 M Tris-HCl pH 7.5, 0.1 M EDTA and 1 M β-mercaptoethanol). Micro Bio-Spin 30 Tris Chromatography Columns (Bio-Rad) were used to clean up the reactions. Reverse transcription (RT) was done with SuperScript® III Reverse Transcriptase (Life technologies, USA) and 1 µL of one of the following primers:
phi29 wt primer (5'- GGGATGATTGACAACCAATCAAC -3'), COM and MUT1 primer (5'- GGGATGATTGACCCGTAATC -3'), MUT2 primer (5'-GGGATGATTGACAACCAATC- 3'),
M2 primer (5'- GGGTAAGAGGGTTATCAAT- 3'), SF5 primer (5'-GGGCAAGAGTGTTTTACGCTC- 3'), GA1 primer (5'-GGTAGTATTGCTACCTCGCAAC- 3'), B103 primer (5'-GGGTAAGTGGGCTATCAATCC- 3'),
SF5_phi29 primer (5'-GGGCAAGAGAACCACTCCCC- 3'), or SF5_M2 primer (5'-GGGCAAGAGTTATCAATCTC- 3').
All were 5'-end labeled with 32P and diluted to 30,000 cpm/µL. Reverse
transcription reactions and sequencing gels were run as described (168, 170). Gels were aligned using the Semi-Automated Footprinting Analysis (SAFA) software (169) and different lanes were normalized to total radiation using ImageQuant software (Molecular Dynamics, USA) followed by background subtraction of the control lanes in Microsoft Excel.
38 Sedimentation velocity analytical ultracentrifugation (SV-AUC)
RNA samples for SV-AUC experiments were diluted to obtain an
absorbance at 260 nm of ~ 0.7, then dialyzed into AUC buffer (10 mM sodium cacodylic acid, 5 mM MgCl2, pH 7.5) overnight using Slide-A-Lyzer MINI Dialysis
Devices, 3.5K MWCO (Thermo Scientific, USA). Experiments were carried out at 12 °C and 25 °C in an Optima XL-I Analytical Ultracentrifuge (Beckman, USA) using cells with two-sector centerpieces and quartz windows in an An-60Ti 4-Place Analytical Rotor (Beckman, USA). Samples were initially spun at 3,000 r.p.m. and the absorbance was recorded to verify sample loading concentration and no leakage, then spun at 40,000 r.p.m. for 12 hours to record scans at desired temperatures. Absorbance profiles were recorded at 260 nm at regular intervals. The sedimentation process was considered complete when ten consecutive scans did not show a change as a function of time. Results were analyzed with Svedberg (171, 172). The fit directly yielded the parameter S and D, which were further adjusted to standard conditions using the program
SEDNTERP v1.08. A partial specific volume of 0.55 cm3/g and the calculated molecular weight was used to obtain the parameters RS, f/f0, and a/b.
Sedimentation equilibrium analytical ultracentrifugation (SE-AUC) SE-AUC was performed in a Beckman-Coulter XL-A centrifuge using UV absorption optics, cells with six-sector centerpieces and quartz windows, and an An-60Ti 4-Place Analytical Rotor (Beckman, USA). Samples were prepared at three different initial loading concentrations from 1 µM to 10 µM in AUC buffer
