INOM EXAMENSARBETE BIOTEKNIK, AVANCERAD NIVÅ, 30 HP , STOCKHOLM SVERIGE 2020
Metabolic engineering of
for direct
Escherichia coli
production of
4-hydroxybutyrate from glucose
SUSSAN ALIPOUR
KTH
Acknowledgment
The work performed for this Master thesis was done at the faculty of Engineering at Lund’s
University, within the department of Biotechnology. The project was carried out between
January 2020 to June 2020. My examiner was Professor Qi Zhou at the division of
glycoscience. I would like to thank my external supervisor at Lund, Professor Rajni
Hatti-Kaul for giving me the opportunity to work at Lund’s University and proposing this Master
Thesis. As well as my main supervisor Martin Gustafsson at KTH for checking up on my
progress throughout the project. I would also like to thank my co supervisor Oliver Englund
Örn and Adel Abouhmad for helping me with the lab work throughout the project.
Abstract
Growing concerns of the negative effects on the environment and dependency of fossil fuels
are major driving forces for finding novel sustainable production pathways for plastic.
Metabolic engineering has emerged as a powerful tool to enable microorganisms to produce
non-native metabolites. The aim of this project was recombinant production of
4-hydroxybutyrate (4-HB) by expressing two enzymes in the model organism Escherichia coli.
α-ketoglutarate decarboxylase (SucA) from Mycobacterium smegmatis followed by
4-hydroxybutyrate dehydrogenase (4-HBd) from Clostridium kluyveri was expressed in
Escherichia coli. Results showed that the genes were successfully transformed and expressed
in E. coli and after protein purification a concentration of 0.9 g/L SucA and 9.8 g/L 4-HBd
was achieved. Furthermore, some protein activity was detected by a coupled reaction with
SucA and 4-HBd. When the enzymes got coupled together a change in NADH concentration
could be detected spectrophotometrically. The enzymes were also tested for substrate
specificity by using substrates with various carbon chain lengths and a decrease in NADH
concentration was seen. However, a decrease in the negative control for the experiments was
also seen indicating a breakdown of NADH over time rather than consumption. Therefore, no
conclusion could be drawn about the promiscuity of the enzymes. Lastly a single plasmids
system was tested where both the genes were ligated on the same plasmid (pCDF duet) and
expressed successfully in E. coli Bl21DE3.
Keywords: Escherichia coli, 4- hydroxybutyrate, 4-HB dehydrogenase, 2-oxoglutarate
decarboxylase, metabolic engineering, TCA cycle, Succinyl semialdehyde
Sammanfattning
Ökad oro för miljön samt behovet av fossila resurser för produktion av plaster har gjort det
nödvändigt att skapa nya och mer hållbara produktions vägar. Genetisk modifikation av olika
organismer har utvecklats som ett starkt redskap för att få mikroorganismer att framställa
metaboliter som de normalt inte producerar. Målet med detta projekt var rekombinant
produktion av gamma hydroxibutansyra (4-HB) genom att uttrycka två enzym i modell
organismen Escherichia coli. Dessa enzym bestod av α-ketoglutarat dekarboxylas (SucA) från
Mycobacterium smegmatis samt 4-hydroxybutyrate dehydrogenas (4-HBd) från Clostridium
kluyveri. Resultaten visade att proteinerna lyckades utryckas i E. coli med en koncentration av
0,9 g/L SucA och 9,8 g/L 4-HBd som uppnåddes efter rening. Utöver detta detekterades även
viss enzymaktivitet genom att kopplad enzymreaktion mellan 4-HBd och SucA och mäta
konsumtionen av NADH spektrofotometriskt över tid. Enzymen testades även för
substratspecificitet genom att köra reaktionen med substrat med olika längd på kolkedjan. Då
kunde en minskning i NADH koncentrationen ses men det gjordes det även för de negativa
kontrollerna vilket indikerar nedbrytning av NADH och inte konsumtion av NADH. Inga
slutsatser angående enzymens substratspecificitet kunde därför dras. Det sista som gjordes var
att sätta in båda generna i ett en plasmidsystem där båda generna sattes in på samma plasmid
(pCDF duet) och uttrycktes framgångsrikt i E. coli Bl21DE3.
Abbreviations
3-HB
3-hydroxybutyrate
4-HB
4-hydroxybutyrate
4-HBd
4-hydroxybutyrate dehydrogenase
Acetyl-CoA
Acetyl coenzyme A
BCA
Bicinchoninic acid
C. kluyveri
Clostridium kluyveri
DTT
Dithiothreitol
E. coli
Escherchia coli
GHB
Gamma hydroxybutyric acid
IPTG
Isopropyl-β-D-thiogalactopyranosid
LB
Lysogeny broth
M. smegmatis
Mycobacterium smegmatis
NADH
Nicotinamide adenine dinucleotide
OD
Optical Density
PCR
Polymerase chain reaction
SDS-PAGE
Sodium lauryl sulphate polyacrylamide gel
electrophoresis
SSA
Succinic semialdehyde
SSAd
Succinic semialdehyde dehydrogenase
SucA
α-ketoglutarate decarboxylase
TCA
Tricarboxylic acid
ThDP
Thiamine diphosphate
Tris
Tris(hydroxymethyl aminomethane
α-KG
α -ketoglutarate
Table of content
ACKNOWLEDGMENT ... 2 ABBREVIATIONS ... 5 1. INTRODUCTION ... 7 2. AIM ... 8 Limitations ... 8 3. THEORY ... 9Keto acids building blocks for plastic ... 9
Metabolic pathways ... 10
Metabolic Engineering ... 10
α-ketoglutarate decarboxylase (EC 4.1.1.71) ... 11
4-hydroxybutyrate dehydrogenase (EC.1.1.1.61) ... 12
4. METHODS ... 13
Plasmid construction ... 13
Protein Production ... 14
Protein Purification ... 15
SDS-page ... 15
Enzyme Activity and characterization ... 15
5. RESULTS ... 16
Protein Expression in pET28a(+) ... 16
Protein Purification ... 17
Protein Quantification ... 21
Enzyme Activity ... 21
Insertion of genes in pCDF duet ... 24
6. DISCUSSION ... 27 7. FUTURE PERSPECTIVES ... 28 REFERENCES ... 28 APPENDIX ... 30
1. Introduction
Today plastic is one of the most ubiquitous materials around and plays a vital role in society. Plastic have gained this major popularity due to its many application and attributes. It can be flexible or rigid, durable or thermostable as well as being very cheap to make. Plastics are mainly used in packaging to protect the food we eat and are used in the health sector to save lives. However, the problem with conventional plastic is that it is made from fossil resources, a source of feedstock that is depleting and non-renewable. According to the UN environment the plastic industry account for 20 percent of the world’s total oil consumption. Also, only 9 percent of the total amount of plastic ever produced have been recycled. If the same consumption rate of plastic continues there are estimated to be 12 billion tons of plastic in landfills and in the environment by the year 2050. (Giacovelli et al., 2018)
It is clear that plastic production has a huge negative impact on the environment and high greenhouse gas emission. In 1987 the World Commission on environment and development phrased the definition of sustainability as a “development that meets the needs of the present without compromising the ability of future generations to meet their own needs”. (Butlin, 1987) Therefore, it is highly desirable to find more sustainable pathway for the production of plastic. Here microorganism are powerful and sustainable tools for the manufacturing of various building blocks for bio based plastic production. E. coli is one of the most widely used model organisms for the production of recombinant proteins and chemicals, since it will allow large scale production. This is mainly due to well-known genetics and rapid growth rate making experiment with it convenient and cheap. (Baneyx, 1999)
Metabolic engineering of microorganisms is a strong approach to produce more sustainable building blocks and chemicals. It creates new systems that turn inexpensive substrate to high value products. To do so finding new metabolic pathways by applying metabolic engineering is required. Metabolic engineering can not only be used to produce new pathways but also be used to increase the yield and productivity of a strain which is the main goal of industrial processes. (Yim Et al., 2011) In this project E. coli is engineers to produce the product 4-HB by sourcing enzymes from other organisms. 4-HB can after production be further polymerised into polymers for bioplastic production. One classic example of metabolic engineering for production of industrial compounds is the production of 1,3-propanediol in E. coli developed by Genecore and Dupont. This was done by creating a 4-step pathway with genes for 1,3-propandiol production. This is the only biobased C3 polymer building block produced at industrial scale. (Yim Et al., 2011).
Polyhydroxyalkaonates (PHA) produced from bacteria are biodegradable thermoplastic with different types of properties. A number of bacteria synthesis these homo- and co-polymers with varying carbon chain lengths for intracellular energy storage. The PHA producing bacteria can be divided into those that produce short chain PHA’s and those that produce medium chains. Studies have shown several bacterial species that produce homo- and copolymers with 4-HB as a monomeric unit. (Eggink et al., 1997)
Poly(4-hydroxybutyrate) is the homopolymer consisting of only 4-HB monomer units. It has been described as strong thermoplastic material with great mechanical properties, biocompatibility and biodegradability. It has high tensile strength and can be stretched to about 10x it is original length before it breaks. It is due to these properties’ poly(4-hydroxybutyrate) have been approved to be used in medical implants. (Zhou et al., 2012). Copolymer of 4-HB and 3-Hydroxybutyrate (3-HB) have been shown to have promising properties. The degradation of the co-polymer in vivo is quite high and can be controlled by varying the amount of 4-HB. Therefor this co-polymer has gained major interest in the medical and pharmaceutical field, for example in wound healing and drug delivery. (Vigneswari et al., 2009)
The reason for finding new sustainable production pathways is due to the diversity of making plastic with varying properties and characteristics from the monomer 4-HB. E. coli has a well know studied metabolic pathways but does not have any known 4-HB generating pathway natively (Zhang et al.,
2009). In order to try to get the organism to produce the desired product, 4-HB, different enzymes from other organisms have been sourced. A previous study showed that the enzyme 4-hydroxybutyrate dehydrogenase (4-HBd) was found in the organism C. kluyveri and α-ketoacid decarboxylase was sourced from M. smegmatis. (Yim Et al., 2011) The pathway starts with the tricarboxylic acid (TCA) cycle intermediate α-ketoglutarate (α-KG) also referred to as 2-oxogluterate, which is decarboxylated by SucA into succinyl semialdehyde. This step is irreversible due to the loss of carbon dioxide and therefore the rate determining step. Next the succinyl semialdehyde is reduced into the final product 4-HB by 4-4-HBd. The proposed pathway in this project is designed to be generic and make different chain length polymers, an important step to make plastic production free of fossil resources and adaptable for the industry.
Key Words
Escherichia coli, 4- hydroxybutyrate, 4-HB dehydrogenase, 2-oxoglutarate decarboxylase, metabolic
engineering, TCA cycle, Succinyl semialdehyde
2. Aim
The aim of this project is to express a novel pathway in E. coli for the production of the non-native building blocks, 4-HB, that can be used for bioplastic production. The main outcome is therefore a strain of E. coli that can operate such a pathway. The proposed production pathway (figure 1).
Fig. 1 A Schematic representation of the proposed pathway for the project. The reaction starts with α-ketoglutarate as a substrate which is decarboxylated by α-keto acid decarboxylase to succinyl semialdehyde. The semialdehyde is further reduced to 4-hydroxybutyrate by 4-hydroxybutyrate dehydrogenase.
It is also desirable for the enzymes to possess substrate promiscuity in order to make the pathway as versatile as possible. Therefor the reaction will be tested for substrates with various carbon chain lengths like oxaloacetate (C4) and α-keto adipic acid (C6) for SucA as wells as different aldehydes for 4-HBd.
Limitations
One major limitation with this project is that the end product is labelled as a psychoactive drug. In 1956 Gamma-aminobutyric acid, was discovered as an inhibitor of the central nervous system neurotransmitters. This set off a search for a replacement that could cross the blood brain barrier and be used for therapeutics. It was during this search, in 1964, scientist discovered
gamma-hydroxybutyric acid (GHB), , another name for 4-HB, in vivo and was later also able to synthesize it in the lab. GHB can be found naturally as mentioned in the brain but also in the heart, liver, kidney, muscles and in the brown fat. The main pathway of GHB is first converted to succinic semialdehyde that is then converted to succinate which can enter the TCA cycle and be further metabolised. GHB is a central neural system depressant which means that it suppresses neurotransmission levels and changes brain function and why it is also labelled as a psychoactive drug. (Mason and Kerns, 2002) This is relevant since getting permission for buying standards for analysis of the product will not be possible during the time frame of the project and other methods of analysis was sourced.
3. Theory
Keto acids building blocks for plastic
To produce the various building blocks for biobased plastic production keto acids are often used as a starting point. One of the most active metabolic pathways are the biosynthesis of amino acids, and here 2-keto acids are a key intermediate. Keto acids are described as carbon compound that have one carboxylic group adjacent to a ketone group and due to their diverse chemical nature have been exploited in the production of industrial products. (Jambunathan and Zhang, 2020) Therefore many pathways have been designed for production of chemicals based on 2-keto acids.
The keto acid precursors of polar amino acids yield molecules with bifunctional groups like diols, dicarboxylic acids and diamines. These are for example used for the production of Nylon or biodegradable polyesters, for example both 1,4-butanediol and adipic acid which have an annual market of 5 billion pounds. (Jambunathan and Zhang, 2020)
Fig. 2 Schematic representation of the Ehrlich amino acid degradation pathway, picture is based on Tashiro, Rodriguez and Atsumi, 2014. The pathway starts with an amino acid being transformed to its corresponding 2-keto acid by transaminase (TA) at the same time as 2-oxogluterate is turned to glutamate. Next the keto acid is decarboxylated to an aldehyde by 2-keto acid decarboxylase(KDC) and one CO2 is lost. The aldehyde can then be turned either to an alcohol by alcohol dehydrogenase (ADH) or by aldehyde reductase (ALR). The alcohol can next be turned to an ester by alcohol O-acyltransferase (ATF). The other rout is getting a carboxylic acid from the aldehyde by aldehyde dehydrogenase (ALDH). The carboxylic acid is then turned to acyl-CoA by acyl-CoA ligase(ACL) and then to an ester by ATF.
The Ehrlich pathway shown above (figure 2) is applied to produce various chemicals. Amino acids are deaminated to the corresponding 2-keto acid and decarboxylated to an aldehyde. The aldehyde could either be reduced to an alcohol or oxidized to yield a carboxylic acid. These can further be condensed to yield an ester. (Tashiro, Rodriguez and Atsumi, 2014)
Similar to other types of polymers,
biopolymers, polymers produced form renewable resources also consist of a long chain of molecules made up of repeating building blocks. A majority of these polymer are linear, however crosslinked and branched polymers occur. There is also heteropolymers, chains consisting of different types of
monomers. (Ashter, 2016)
Another type of building block is dicarboxylic acids which are chemicals that have found wide used in sectors like food, pharma and materials. Dicarboxylic acids of various lengths can be polymerized to make plastic and synthetic fibres with varying chemical properties. Linear aliphatic dicarboxylic acids have been used to produce polymers like polyesters, polyethene’s and polyamides. (Yu et al., 2018) Biobased production of succinic acids and long dicarboxylic acid have been industrialized and commercialized. However, biological production of other dicarboxylic from carbon source like glucose it still in early stages. Over the years several metabolic pathways have been found naturally in species. For example, it was shown that Pseudomonas spp. could convert L-lysine into glutarate (C5) and further degraded to enter the tricarboxylic acid cycle. Several species of yeast can convert alkanes or fatty acids into the corresponding long chain dicarboxylic acids (C >12) (Yu et al., 2018)
Metabolic pathways
Metabolic pathways are generally defined as a series of chemical reaction that are responsible for the breakdown and build-up of biomolecules for various cellular processes (Papin et al.,2003). The main purpose of the metabolic pathways is threefold, energy generation mainly in the form of ATP to fuel cellular activity, production of reducing equivalent in the form of NAD(P)H for biosynthetic reaction and formation of important metabolic precursors. The starting point of catabolism, the process where biomolecules are broken down into smaller components, is the glycolysis where the end product is pyruvate which can then be further processed in various different pathways. All the precursor molecules needed for biosynthesis are generated in the glycolysis, TCA cycle and the pentose
phosphate pathway, but anaplerotic pathways are needed to replenish the use of precursor metabolites. (Stephanopoulos, Aristidou and Nielsen, 2008)
To complete the oxidation of pyruvate after glycolysis, pyruvate is decarboxylated to form Acetyl-CoA where NAD+ serves as an electron acceptor and this is where it enters the TCA cycle. The TCA
cycle plays an essential role in providing precursors for lipid and amino acid synthesis along with reducing equivalents for energy generation. Different bacteria operate different variants of the TCA cycles. (Stephanopoulos, Aristidou and Nielsen, 2008) An overview of the TCA cycle is shown in figure 3 where the starting point of the proposed reaction is shown in red.
Fig. 3 Tricarboxylic acid cycle from E.coli. The enzymes catalysing the reactions are displayed in Italics. The cycle starts with Acetyl-CoA, after one run two of the carbon atoms are oxidized to CO2. The energy produced for the oxidation is used to form ATP, NADH and reduction of one electron carrier. Picture based on Cannon, 2014
Metabolic Engineering
Generally metabolic engineering is defined as the targeted alteration of metabolic pathways for improvement of cellular properties through modification of biochemicals reactions and creation of new ones. (Yang et al., 1998) Metabolic engineering has emerged as a powerful tool and approach to
produce industrial chemicals and molecules by introducing genetic changes with recombinant DNA technology. It has the potential of starting with inexpensive starting materials and turning it to high value products. The use of metabolic engineering has development quickly due to advances in other fields. Extensive effort has been made with DNA sequencing revealing new metabolic reactions and variants of enzymes form all types of organism. New tools enable precise control and enable the engineer to track RNA, protein and metabolites in cells to identify bottlenecks. (Keasling, 2010) The biggest challenge with using microorganism is that a majority of the molecules used for the industry are not metabolic intermediates by nature. This is why new production pathway needs to be introduced in the organisms. It is also a challenge to search and find for the right enzymes to create new metabolic pathways and in turn produce new building blocks. (Chan, Verma, Lane and Gan, 2013)
In practise it is quite simple to produce a recombinant protein. The first step is to take the gene of interest, amplify and purify to then clone it into an expression vector. In the present study Duet vectors was used (Appendix, figure 18 and 19). The plasmids have been designed in a way where each
plasmid contain two expression sites which are controlled by T7 lac promotor. The promotor is followed by a ribosomal binding site, two multiple cloning sites and finished with a T7 terminator. The plasmids also provide a His tag and S tag sequence for easy purification of the protein in later stages. After cloning, the vectors are transformed into a suitable strain. Many specialty strains are available and used for specific purposes. The E. coli DH5 α is designed to maximize the
transformation efficiency by the introduction of different mutations. These mutations make it possible for the strain to be transformed with high efficiently even with unmethylated DNA due to the lack of non-specific endonuclease 1 and endonuclease EcoKI. They also maintain plasmid stability by the low levels of homologous recombination. This strain was used as a propagating host in the project. (Anton et al., 2016) (Chan et al., 2013). For the strain E. coli BL21DE3, again several mutations have been made in order to optimize the strain for protein expression. The strain is for example deficient in several types of proteases that degrade foreign or extracellular proteins. After the vectors have been transformed into the strain of choice there is only the matter of inducing the protein which is then ready for purification and characterization. (Rosano and Ceccarelli, 2014)
α-ketoglutarate decarboxylase (EC 4.1.1.71)
One key enzyme of the TCA cycle is 2-oxogluterate dehydrogenase, which converts α-KG to succinyl-CoA and CO2 at the same time reducing NAD+ to NADH. However, it has been shown that several
organisms lack this enzyme complex, indicating an alternate TCA cycle and production of biomolecules. Studies have proven however that the organisms that lack this enzyme complex compensate by replacing it with SucA and succinate semialdehyde dehydrogenase (SSAd). (Tian et al., 2005). SucA is an enzyme that belong to the carboxy-lyase family which are responsible for breaking carbon-carbon bonds.
SucA catalyses the thiamine diphosphate (ThDP) and MgCl2-dependent decarboxylation of α-KG to
succinic semialdehyde (figure 1). Generally, enzymes in the carboxy lyase family convert α-ketoacids to the corresponding aldehyde. This is more difficult than for decarboxylation of β-keto acids, due to decarboxylation of β-keto acids forming an enolate intermediate which is stable. (Figure 4A). For α-keto acids however, the intermediate formed is an acyl anion which has too high energy to form in biological systems. (Figure 4B). Therefore, organisms have created a reaction rout with lower energy by using ThDP. ThDP is the coenzyme form of vitamin B1 and is used to bind the cofactor to the
protein. The thiazolium heterocycle of ThDP is the reactive part of the molecule due the C2-H bond.
The carbanion then acts as a nucleophile towards the carbonyl carbon on the α-keto acid and the decarboxylation is completed (Figure 4C)(Hanson, 1987).
Fig. 4. A comparison between decarboxylation of a-keto acids and b-keto acids. (A) shows the intermediate of the reaction formed from b-keto acids (B) shows the intermediate of the reaction formed from a-keto acids. (C) shows the reaction and the role of ThDP decarboxylation of a-keto acids. (Walsh, 2020)
The active site of the enzyme undergoes structural rearrangement during the enzymatic reaction. First Acetyl-CoA binds to an allosteric site approximately 40 Å away from the enzyme's active site which leads to conformational changes, this then facilitate the ThDP reaction intermediate. (Wagner et al., 2011)
In Mycobacterium spp, SucA is a homodimer containing several distinct domains which are folded into a twofold open-faced sandwich motif. The acyltransferase domain is connected a small domain responsible for protein dimerization followed by 3 α/β-domains which are characteristic for ThDP-dependent enzymes. Studies have shown that SucA is a multifunctional enzyme capable in catalysing various different reactions, although this multifunctionality is not restricted to Mycobacterium spp since studies showed E. coli SucA variant exhibiting the same diversity. (Wagner et al., 2011)
4-hydroxybutyrate dehydrogenase (EC.1.1.1.61)
The enzyme 4-HBd belongs to the family of oxidoreductases meaning that it catalyses the transfer of one electron pair to another molecule. The enzymes act on CH-OH group of substrate molecule. The specific reaction for 4-HBd is the interconversion between SSA and 4-HB. The reaction occurs one way when 4-HB is oxidised along with the reduction of NAD+ with the release of a proton in the
solution. The other way of the reaction, which is the interest of this project, the reduction of SSA at the same time as NADH is being oxidised, taking up a proton from the solution. When the organism Cupriavidus necator is grown under phosphorus limiting condition it will co-polymerise 4-HB together with 2- and 3-hydroxybutyrate to store the polymer as energy and easily accessible carbon. 4-HBd is also responsible for the oxidation of free 4-HB to SSA for conversion to succinic acid. The succinic acid can then be entered into the TCA cycle yielding energy and building blocks. (Taxon, Halbers and Parsons, 2020)
The mechanism below (figure 5) show the enzyme is converted into an isomerized form and need to be converted back before it can bind to another substrate. (Taxon, Halbers and Parsons, 2020)
Fig. 5 Cleland notation of the reverse reaction catalysed by the enzyme 4-HBd. Here the product is converted back to SSA. Picture based on Taxon, Halbers and Parsons, 2020
One study compared the expression levels of the protein if it was grown on ethanol with succinate or acetate respectively. Here the SDS showed a band at 41 kDa for both the condition but a stronger band for when the organism C. Kluyveri was grown on succinate and ethanol. This can indicate that
succinate is needed to activate the expression but co-migrates together with another protein which is present under both conditions. This study also showed that the activity increased with the presence of a divalent metal ion however some metal ions could inhibit enzyme activity. (Wolff and Kenealy, 1995)
4. Methods
The plasmids used in the project (Appendix, figure 18 and 19) were acquired from TWIST Bioscience including SucA and 4-HBd separately on pET28a(+). All Medium compositions and buffers
mentioned in this section are found in Appendix, table 4-10
Plasmid construction
The vectors containing the genes for 4-HBd and SucA were transformed into E.coli Dh5α by adding 50μl of competent cells in a tube together with 2-4μl of vector. The samples were placed on ice for 30 min and heat shocked at 42°C for 30 s followed by 2 min on ice. Then, 950 μl of Lysogeny Broth (Appendix, table 4) was added to the samples and they were placed into the incubator for 1h at 37°C, 200 rpm before plating on agar plates containing the appropriate antibiotic (final concentration 50
μg/ml). The plates were left in the incubator overnight at 37°C. For each transformation a negative control sample without the plasmid was made.
PCR was done in order to verify the transformation of the genes. A master mix was prepared with the chemicals in table 1 supplied from Thermo scientific. Next, 20 μl of the master mix was added to a PCR tube and inoculated with a small amount of bacterial colony from the agar plates. The PCR-tubes was placed in the thermocycler machine (T100 Thermo Cycler from BIO RAD) with the settings showed in table 2.
Table 1. Components of a Colony PCR-master mix
Table 2. Colony PCR settings
The plasmids were purified using the gene JET plasmid miniprep kit (Thermo Fisher) according to the manufacturer’s description. The concentration of the plasmids was then measured with spectrometer nanodrop 1000 (Thermo Scientific). All gels for the gel electrophoresis was made to 1%-agarose gel using Tris-acetate-EDTA (TAE) buffer (Appendix, table 10). Before the mixture was poured in the form to set it was pre stained with GelRed stain (Biotium). For each run 0,5 μl Gene ruler 1 kbp DNA ladder (ThermoFisher scientific) was added to the first and last well together with 1 μl of sample per well.
Protein Production
Protein expression of the enzymes was done by inoculating colonies from the agar plates with
transformed E. coli BL21DE3 in 50 ml of LB medium (Appendix, table 4) for SucA and 4-HBd along with the appropriate antibiotic depending on the plasmid (final concentration of 50 μg/ml). The pre-inoculum was incubated 37°C at 200 rpm overnight. The samples were then used to inoculate a larger
batch containing antibiotic and fresh LB medium. Both batches were grown at 37°C, 200 rpm until the OD600 reached approximately 2. The cultures were then induced with
isopropyl-β-D-thiogalactopyranosid (IPTG) to a final concentration of 1 mM to promote gene expression. The flasks were placed back in the incubator at the same setting until OD600 reached approximately 5. The cells
were then harvested by centrifugation with centrifuge rotor 11180 (sigma) for 10 min x 2 at room temperature and 4500 rpm and washed with distilled water between rounds. Next, the cells were diluted with the binding buffer used for purification (Appendix Table 7) and sonicated with
ultrasonicator UP400S (Hielscher) with an amplitude of 60% and 0,5s intervals, this was done for 30 s on and off for a total of 10 min. After sonication the sample were centrifuged (Legend Micro 17, Thermo Scientific) again for 10 min at 17000 rpm and filtered with 0.2 μl pore size. The supernatant was named the soluble fraction while the pellet was labelled as the insoluble fraction.
Protein Purification
Proteins was purified using the ÄKTA Pure Protein Purification system (GE Healthcare) and
UNICORN Pure Protein Purification software (GE Healthcare). The soluble fraction was applied on a His Trap HP affinity column with a column volume (CV) of 5 ml, made for purification of His-tagged proteins. The column was first stripped and recharged with 0,1 M NiSO4 solution according to GE
Healthcare’s recommendation. The purification was made following the available protocols. The system was equilibrated with 5 CV MilliQ-water followed by 10 CV of binding buffer (Appendix, table 7) containing 10-20 mM Imidazole before the sample was added to the column. After that the column was washed with 5 CV wash buffer (Appendix, table 8). Next 5 CV of elution buffer
(Appendix table 9) was added in a stepwise fashion from 0% to 100% binding buffer (Appendix, table 7). Lastly the system was washed with 20 CV of MilliQ-water and finally stored in 20% EtOH. The final purification step was to perform a dialysis to remove Imidazole from the solution. The samples were placed in the dialysis tubing with a molecular weight cut off of 3500 Da for 4-HBd and 12-14 kDa for SucA and placed in 5 l of 20mM Tris-HCl (pH 8.0), 0,5 M NaCl and 1mM Ditiotreitol (DTT). This setup was left overnight.
SDS-page
SDS-page was used as an analytical tool to determine what proteins was present in the solutions. Both the soluble fraction before and after purification and the insoluble fraction was analysed to verify the presence of the target protein by looking for the right molecular weight of the protein. The samples were first diluted to the right concentration (2g/L) and mixed together with SDS-solution. Next, the samples were boiled at 99°C for 10 min and cooled on ice for 2 min. After that the samples was added to the mini-PROTEAN TGX precast gel (BIO RAD). The gel was run for 15 min at 100 V followed by 45 min at 150 V, this was done in order to get a cleaner and clearer separation. After the run the gels were stained in Coomassie Brilliant Blue staining dye (BIO RAD) for 20 min and de-stained with water.
Enzyme Activity and characterization
After the enzymes had been purified a Bicinchoninic Acid (BCA) protein assay was performed in other to quantify the enzymes in the samples. For this assay proteins interact with the Cu2+ ions in the
working reagent solution and reduced to Cu+ ions. This reaction is dependent on temperature why the
plate is incubated at 37°C for 30 min after everything is mixed. Then, two molecules of bicinchoninic acid chelate with each Cu+ atom. The amount of reduces atoms are proportional to the amount of
protein in the solution.
Albumin Bovine Serum standard was diluted according to the manufacturer's description
(Gbioscience). The working solution was prepared with 50-parts BCA solution and 1-part Copper solution. 25 μl of protein sample and standards was pipetted into appropriately labelled wells on a 96 well plate followed by 200 μl of working reagent solution. The plate was then sealed and mixed
gently. Next, the plate was incubated at 37°C for 30 min and left to cool before being read by a spectrophotometer at 562 nm.
To determine the enzymatic activity a coupled enzyme assay with both the enzymes was made. In a tube 0,2 mM of ThDP, 0,1 mM of MgCl2 and 0,2 μM SucA was mixed into a cuvette. The cuvette was
set to equilibrate at 37°C. The reaction was started with 10 mM α-KG and the reaction ran for 30 min at 37°C. The reaction was then coupled together with 1,1 μM 4-HBd and 0, 15 mM NADH. The reduction of NADH was analysed at 340 nm overtime for 60 s making a measurement every 1s. At the beginning of each day the NADH was quantified by measuring a sample of known concentration at 340 nm and comparing it with a standard curve made from fresh NADH sample.
5. Results
The first part of this project was to express the proteins SucA and 4-HBd separately. The genes were bought already synthesised and the vector (pET28a(+)) were transformed into E.coli Dh5α in order to propagate the cells. When this was done the plasmids were purified and transformed into E. coli expression strain BL21DE3. Next the cells were cultivated, and the genes were expressed. After expression the proteins were purified and quantified. When the concentration of the proteins had been determined the enzymes were tested for activity and promiscuity spectrophotometrically. The last step was that the genes were cut and ligated in the same plasmid (pCDFduet) in order to express the genes simultaneously in vivo.
Protein Expression in pET28a(+)
The initial idea with the project was to amplify the genes SucA and 4-HBd from the DNA of M. smegmatis and C. kluyveri separately. Several attempts were made where the annealing temperature and extension time were varied. For SucA some attempts were shown successful when analysing the PCR product with gel electrophoresis. However, when attempts were made to scale up the experiment with the same setting the concentration of the purified DNA was to low and transformation was not successful. For 4-HBd none of the attempts to amplify the gene was successful. The primers used in the first test were designed prior to the project start (Appendix table 11, SucA_F1, SucA_R1,
SucAD_F1, 4-HBd_F1, 4-HBd_R1). Two more sets of primers were designed throughout the project in the hopes to amplify the genes, but they too were unsuccessful (Appendix table 11, HBd_F2, 4-HBd_R2, SucA_F3, SucA_R3, SucAD_F3, 4-HBd_F3, 4-HBd_R3). Therefore, after several failed attempts the genes were acquired from TWIST already synthesised and ligated on pET28a(+) When buying the enzymes SucA and 4-HBd from TWIST they arrived already separately ligated into the vector pET28a(+). There for the vector could be directly transformed into E. coli BL21DE3 for protein expression.
For determination of the optimal expression conditions E. coli BL21DE3 cells containing a vector with each gene separately, were grown in LB-medium at different temperatures. After the cells were induced one set grew at 30°C for 6 h and the other set was grown at 14°C for 32 h according to information found in literature (Wagner et al.,2011). The proteins were analysed using SDS-Page. The expressed proteins together with a negative control, are shown below. The negative control was the wild type E. coli BL21DE3. The expected molecular weight of SucA was 90,7 kDa and 4-Hbd had a molecular weight of 41,8 kDa. The gel (figure 6) showed strong bands for expression of 4-HB at both temperatures but more so at 30°C. Whilst for SucA band were detectable at both temperatures but not as high expression as for the other enzyme.
Fix. 6 SDS-page with expressed proteins at different temperatures as well as negative control before induction. From left Protein ladder (Precision plus protein all Blue Standards (BIO RAD)), NC 4-HBd, NC SucA, 4-HBd (30°C), SucA (30°C), 4-HBd (14°C), SucA (14°C).
Protein Purification
Since both of the proteins were cloned with His-tags, purification was done with immobilized metal affinity chromatography where the proteins are purified according to their affinity to the Ni2+ ions on
the column. Unbound proteins were washed off before the proteins could be eluted in fractions. The cells were grown at 30°C and then purified.
For 4-HBd the purification curve is shown in figure 7. The imidazole concentration in the binding buffer here was 10 mM. The concentration of the imidazole was tested before running the purification. This was done by varying the concentration of imidazole from 10 mM to 50 mM and analyse the purity and size of the peaks from the chromatogram. This was done to use an as low as possible concentration of imidazole for the purified protein with his-tag to bind. But still making sure that unwanted protein would not bind by competing with the Ni2+.
Fig. 7 Chromatogram from the purification of 4-HBd. The protein peak is shown with the red arrow.
For SucA the purification curve is shown in figure 8. The imidazole concentration in the binding buffer was changed to 20 mM. This was done in order to get a more specific binding of the protein since imidazole bind strongly to the column and other proteins cannot bind as tightly. When using only 10mM several small peaks could be seen in the chromatogram indicating a poor purification (appendix figure 22).
Fig. 8 Chromatogram from the purification of SucA. The protein peak is shown with the red arrow.
After the purification an SDS-page was done in order to verify the purification. In figure 9 the first attempt of the purification is shown where an insufficient purification of SucA is seen due to the presence of other protein. In figure 10 the SDS-page show a single line for at the size of SucA indicating a successful purification. The fractions chosen was the fractions containing most of the protein according to the chromatogram. For the purification of 4-HBd this was fraction T4-T17 (figure 7). For SucA the fractions was T5-T12 (figure 8)
Fig. 9 SDS from the purification of SucA and 4-Hbd. The fractions labelled was are form the initial wash of the column and the fractions labelled Flowthrough are from the unbound proteins flowing through the column. From the purification of SucA several foreign proteins can be seen. However, two clear distinct lines can be seen from the purification of 4-HBd. The wash and follow-through from the purification was teste for to ensure no proteins were found in those fractions.
Fig. 10 SDS from the purification of SucA. Different fractions are the different sample from the ÄKTA indicating the presence of protein. The fractions labelled were form the initial wash of the column and the fractions labelled Flowthrough a from the unbound proteins flowing through the column
Table 3 This table shows the final concentration of the purification together with the yield of purified protein/cultivation volume and specific yield per cell.
250 kDa 150 kDa 100 kDa 75 kDa 50 kDa 37 kDa 25 kDa 20 kDa Frac tion 4 Frac tion 3 Frac tion 2 Frac tion 1 Frac tion 0 Inso lubl e Solu ble Wash Flow thro ug h Prot ein ladd er 250 kDa 150 kDa 100 kDa 75 kDa 50 kDa 37 kDa 25 kDa 20 kDa SucA 4-Hb d 1 4-Hb d 2 SucA Was h SucA FT 4-HB d 1 FT 4-HB d 1 Was h 4-HB d 2 Was h 4-HB d 2 FT Prot ein ladd er Prot ein ladd er
Protein Concentration purified protein(mg/mL)
Purified protein/cultivation volume (g/L)
Specific yield /cell (mg protein/OD*L)
SucA 0,9 0,036 9,2
4-HBd 9,8 0,196 37,3
Protein Quantification
To determine the protein concentration after purification a Bicinchoninic Acid assay was done. The assay measures the amount of Cu+ ions reduced and bound to bicinchoninic acids, which result in a
purple colour that can be measured spectrophotometrically. After the 96 well plate was read by the spectrophotometer at 340 nm the absorbance was summarized into a standard curve where the concentration of the proteins could be determined.
Fig. 11 Standard curve for the BCA where the absorbance is plotted against the concertation of the standard solutions.
Form the standard curve the concertation of 4-HBd was determined to be 9,8 mg/ml and the concentration of SucA was calculated to 0,9 mg/ml. This was done by taking the average of the absorbance of the triplicate (appendix table 12), subtract the average of the negative controls and insert the absorbance as the y-value in the equation from the standard curve, Finally the concentration was multiplied with the dilution factor to get the final concertation.
Enzyme Activity
To be able to measure the activity of the enzymes a coupled assay was done with SucA and 4-HBd. This was done since the same concept had been described in the literature. (Wagner et al., 2011). First a reaction mixture was made by mixing 1 mM MgCl2, 0,2 mM ThDP and 0,2 μl SucA. The mixture
was incubated at 37°C for 30 min to equilibrate. The reaction was started by adding 10 mM
α-
KG and was left to run at 37°C for 30 min. The first aspect that was tested for was to see if the enzymes were active at all. Next 7 reactions were run were 0,15 mM NADH was added together with various concentration of 4-HBd (0,5g/l to 10 g/l) and a decrease in NADH concentration was detected (figure 12). In the graph the slope for the five highest concentrations are shown. This is due to the two lowest concentrations giving unreliable values for the measurements and no accurate slope could be measured from the values. For the concentrations 2 g/l, 4 g/l and 6 g/l the slope of the reactions were linear. For the reactions 8 g/l and 10 g/l the slopes were not linear instead a plateau is reached. Three negative control samples were made where one did not contain any enzyme, one with only SucA present andy = 0,78x + 0,02 R² = 1,00 0 0,2 0,4 0,6 0,8 1 1,2 1,4 1,6 1,8 0 0,5 1 1,5 2 2,5 Ab s (5 62 nm ) Standard mg/ml
one with only 4-HBd. None of these three samples showed a decrease in absorbance meaning no activity was measured.
Lastly the substrate specificity was tested for by adding the same amount of oxaloacetate (C4) and α-keto adipic acid (C6) as a-KG in the original reaction. The substrate a-KG has five carbon atoms in its backbone with two carboxylic acids at the ends. The two other substrates have the same structure but varying carbon chain lengths.
From figure 13 a negative slope is seen indicating a decrease in NADH concentration. However, the same slope is seen in the two negative controls, where the reaction is run the same way but without 4-HBd. This is most likely due to the spontaneous decomposition of NADH. In order to determine the activity of the decarboxylase separately the consumption of α-KG was supposed to be measured using HPLC.
However, measuring standards as well as components in the reaction mixture it was seen from the chromatograms that the peaks for the substrate (α-KG) and the buffer (potassium phosphate 50 mM, pH 7) showed at the same retention time making them impossible to tell apart. Several attempts were made to fix this problem. Different mobile phases were tested with concentrations ranging form 0,25mM to 5mM H2SO4 as well as changing the column together with varying the flowrate from 0,200
ml/min to 0,600 ml/min without any success. Therefor the only test done on SucA was to couple with 4-HBd to verify that the enzyme was active.
Fig. 12 To measure the enzyme activity the consumption of NADH was measured overtime. Serie 3= 2 μg/ml 4-HBd, Serie 4= 4 μg/ml 4-HBd, Serie 5= 6 μg/ml 4-HBd, Serie 6= 8 μg/ml 4-HBd, Serie 7= 10 μg/ml 4-HBd. The slope of the series is shown in the corresponding equations. The full, small dotted spots are the slope and the bigger faded circles are the actual measured data points.
y = -0,0016x + 1,5255 y = -0,0015x + 1,5214 y = -0,0016x + 1,5509 y = -0,003x + 0,8384 y = -0,0004x + 0,7036 0 0,2 0,4 0,6 0,8 1 1,2 1,4 1,6 1,8 0 10 20 30 40 50 60 70 Ab so rb an ce (3 40 ) Time (s) Linjär (Serie3) Linjär (Serie4) Linjär (Serie5) Linjär (Serie6) Linjär (Serie7)
Fig. 13 To measure the enzyme activity of different chain length substrates was used. Serie 1=
oxaloacetate (C4) series 2=
α-
keto adipic acid (C6). Serie 3= Negative control for oxaloacetate (C4), Serie 4 = Negative control forα-
keto adipic acid (C6). The slope of the series is shown in thecorresponding equations. The full, small dotted spots are the slope and the bigger faded circles are the actual measured data points.
0 0,2 0,4 0,6 0,8 1 1,2 1,4 1,6 1,8 0 10 20 30 40 50 60 70 Ab so rb an ec (3 40 n m ) Time (s) Linjär (Serie1) Linjär (Serie2) Linjär (Serie3) Linjär (Serie4)
‘
Fig. 14 Showed the change in NADH concentration over time. Serie 3= 2 μg/ml 4-HBd, Serie 4= 4 μg/ml 4-HBd, Serie 5= 6 μg/ml 4-HBd, Serie 6= 8 μg/ml 4-HBd, Serie 7= 10 μg/ml 4-HBd. The equation A=ε*l*c was applied to calculate the concentration c whereε=6,33 mM-1*cm-1 and l= 1 cm.
Insertion of genes in pCDF duet
For expressing the genes onto the same vector, this was done in order to verify that SucA and 4-HBd could be expressed by a single plasmid system in vivo . The genes were cut and ligated again onto a new vector (pCDF duet). To verify the ligation a colony PCR was run, and the length of the product was shown with gel electrophoresis. First the gene coding for 4-HBd was ligated onto the vector and from the gel electrophoresis it is seen that several colonies have successfully been transformed with the plasmid containing 4-HBd (figure 15). After 4-HBd had been ligated, SucA was cut and ligated on to the same vector. This time however, only one colony was seen to been successfully transformed (Figure 16) . In the gels, the line at 1,1 kbp corresponds to 4-HBd and 2,7 kbp represent the SucA gene. Next the plasmid that contained both the genes was to send for sequencing. The result verified that it was in fact the genes that have been ligated.
0 0,05 0,1 0,15 0,2 0,25 0,3 0 10 20 30 40 50 60 70 Co nc en tr at io n N AD H (m M ) Time (s)
Concentration NADH
Linjär (Serie3) Linjär (Serie4) Linjär (Serie5) Linjär (Serie6) Linjär (Serie7)Fig. 15 Gel electrophoresis showing colony PCR of ligated 4-HBd into pCDFduet. Several bands were shown in the right size range and are indicated with red lines. At the start and end of each lane a DNA ladder was added.
Fig. 16 Gel electrophoresis showing colony PCR of ligated SucA into pCDFduet. One band was shown in the right size range and indicated with the red arrow. At the start and end of each lane a DNA ladder was added.
After sequencing the plasmid was transformed into E. coli Bl21DE3 for expression. The cells grew to OD600 of 2 before being induced with 0.1 mM IPTG. One set of cells were grown in LB while another
set was grown in M9 (appendix table 6). This was done to see if expression was better in any of the two medias. A negative control was done with the WT of the strain containing the plasmids without the genes (figure 17). It is shown that the genes were expressed in LB however no expression was seen in M9.
Fig. 17 SDS done after the genes have been induced and grown for 30°C for 7h. The first lane shows the protein ladder, the strain containing both the genes in LB, WT in LB, , the strain containing both the genes in M9, WT in M9 250 kDa 150 kDa 100 kDa 75 kDa 50 kDa 37 kDa 25 kDa 20 kDa Prot ein ladd er 2xge nes L B WT LB WT M9 2xge nes M9
6. Discussion
From the result it is shown that the genes were expressed successfully on two separate plasmids (pET28a(+)) as well as when the genes were ligated on the same plasmid. It was clear from the SDS-page and the BCA assay that 4-HBd was expressed in higher concentration than SucA. From the SDS there where thick bands in the size of 4-HBd indicating a higher concentration of protein but a fainter band were shown for SucA when comparing the expression at different temperatures. A slightly higher concentration of 4-HB was shown when the cells were expressed and grown at 30°C. For SucA although both the bands being faint the band corresponding to expression and growth at 14°C was a bit thicker. No other temperatures were found in the literature and due to lack of time no other settings for expression were tested. Further optimisation however could improve expression levels of the enzymes. From the purification chromatograms from the ÄKTA it can be seen that the peak for SucA is much smaller than the peak for 4-HBd. The reason for this is that the cultivation of SucA that was purified was in much smaller volume than the cultivation for 4-HBd. The cultivation for 4-HBd was done at a total volume of 1 l while the cultivation for SucA was done at 500 ml. This was due to equipment constraint not having enough big enough shake flasks for cultivation. It has also been shown from the expression experiment that lower levels of SucA was achieved (figure 6) this is also a reason for the small peak. Further, it was shown that an imidazole concentration of 10 mM in the binding buffer was sufficient to get an acceptable purification of 4-HBd but the SDS from the purification showed several other bands other than the band SucA indicating other proteins present (figure 9). This could perhaps be caused by SucA being a dimer and the folding causes the His-tag to be shielded giving a weaker bond to the column. This problem was however solved when the imidazole concentration was increased to 20 mM in the binding buffer and a very clear single peak was shown in the chromatogram. The higher the concentration of imidazole causes more imidazole to bind to the column. This forces other proteins to interact stronger to bind which makes the his tag more likely to bind before other proteins giving a batter purification.
The activity of the enzymes was measured by putting the two reaction together. Since there was no easy way to measure to production of CO2 from the reaction with SucA, the enzyme was therefore
coupled together. Since the first reaction is not reversible it was left to go for a 30 to ensure that enough SSA was produced. When 4-HBd and NADH was added a decrease in NADH concentration was seen indicating that both enzymes must be active. Since there were no other component added at the start that could react with 4-HBd other than the aldehyde produced by the first enzyme. When testing for different concentrations of 4-HBd all showed a decrease in NADH concentration. For the lover concentrations (2 g/L, 4 g/l and 6g/l) a linear decrease was seen overtime. For the two highest concentrations (8 g/L, 10g/L) the slope faded out into a plateau. This is most likely due to the reaction happening so fast at those high concentrations that it had already happened before the machines started to measure. The two lowest concentrations (0,5 g/L and 1 g/L) was not added to the graph due to inconsistent values. This is most likely due to the sample not being mixed enough before starting the measurements. When testing the promiscuity of the enzyme the substrates with varying carbon chain length was tested for and again a decrease in slope could be seen. For this experiment however the same decrease in concentration of NADH was seen even without 4-HBd present in the solution. So, the change in concentration is most likely due to the spontaneous decomposition of NADH and not from consumption of NADH in the reactions. From this experiment no conclusion can be drawn for the promiscuity of any of the enzymes. If the substrate specificity of 4-HBd were going to be tested different aldehyde should be used as substrate and the decrease in NADH concentration should be measured. To determine the substrate specificity of SucA a protocol to analyse substrate consumption with the HPLC must be created. This was however not done due to lack of time.
The original plan for the project was to prepare the plasmid including amplifying the genes in the lab. But it was shown that the pre-designed primers did not bind properly, and the genes for SucA and 4-HBd could not be amplified from the genome of the respective organism. The reasons for this seem to
be a high GC content in the sequence leading to unspecific binding of the primers. Although several sets of primers were designed (Appendix, Table 10) the genes were in the end bought already ligated in a vector (pET28a(+)) from TWIST bioscience.
However, in the end the genes, 4-HBd and SucA was successfully ligated on the same plasmids (pCDF duet, Appendix figure 19). The plasmids were then transformed into
E. coli Bl21
DE3 where
both the enzymes were express, which can be seen in the SDS-page (figure 17)
. When grown in LB expression of both the enzymes were detected. The reason for not seeing the same expression levels in M9 could be due to the fact that M9 is a minimal medium. This makes the lag phase longer meaning that the organism needs more time to adapt. Ideally the organism should be induced in the lag phase. In the future perhaps the cells in M9 could be grown for a longer time in order to reach lag phase before induction. Further test also needs to be done to increase expression levels and to optimise purification.7. Future perspectives
In summary a plasmid pCDFduet containing the genes encoding SucA and 4-HBd from M. smegmatis and C. kluyveri was constructed and soluble protein expression in E. coli was achieved. The enzymes were purified using immobilized metal affinity chromatography followed by characterization. Then enzymes were coupled together in vivo. In the end an E. coli strain containing both genes were produced however further work needs to be done to test purification steps and optimise growth conditions as well as work on the expression levels of the proteins. Moreover, extended enzyme characterization needs to be done to determine kinetic parameters of the enzyme as well as the optimum enzyme concentration. Last but not least, in order to complete the project, the final product, 4-HB need to be verified and growth conditions need to be optimised for maximum production of product in the cells. Another aspect of the project was to make this pathway as generic as possible. Therefor in the future more lab work needs to be done to check for the promiscuity of the enzyme. This can be done by testing the enzymes for various substrates to measure the activity of the enzyme in reaction.
A last important side note is that although this pathway will make the production of plastic greener the end product still has the same properties as conventional plastic and a lot of the environmental impact lies in the recycling and reuse of the material. Therefore, effort should be made to improve the whole life cycle of plastic.
References
Anton, B. P., & Raleigh, E. A. (2016). Complete genome sequence of NEB 5-alpha, a derivative of Escherichia coli K-12 DH5α. Genome Announc., 4(6), e01245-16.
Ashter, S. A. (2016). Introduction to bioplastics engineering. William Andrew.
Baneyx, F. (1999). Recombinant protein expression in Escherichia coli. Current opinion in biotechnology, 10(5), 411-421
Butlin, J. (1989). Our common future. By World commission on environment and development.(London, Oxford University Press, 1987, pp. 383.). Journal of International Development, 1(2), 284-287.
Cannon, W. R. (2014). Concepts, challenges, and successes in modeling thermodynamics of metabolism. Frontiers in bioengineering and biotechnology, 2, 53.
Chan, W. T., Verma, C. S., Lane, D. P., & Gan, S. K. E. (2013). A comparison and optimization of methods and factors affecting the transformation of Escherichia coli. Bioscience reports, 33(6), e00086.
Eggink, G., Steinbüchel, A., Poirier, Y., & Witholt, B. (1997). 1996 International symposium on bacterial polyhydroxyalkanoates. NRC Research Press.
Giacovelli, C., Zamparo, A. and Wehril, A. UNEP (2018). Single-use plastics, a roadmap for sustainability. pp. 6-10 2
Hanson, R., 1987. Decarboxylation of a keto acids. Journal of Chemical Education, 64(7), p.591 Jambunathan, P., & Zhang, K. (2014). Novel pathways and products from 2-keto acids. Current opinion in biotechnology, 29, 1-7.
Keasling, J. D. (2010). Manufacturing molecules through metabolic engineering. Science, 330(6009), 1355-1358
Mason, P. E., & Kerns, W. P. (2002). Gamma hydroxybutyric acid (GHB) intoxication. Academic Emergency Medicine, 9(7), 730-739.
Papin, J. A., Price, N. D., Wiback, S. J., Fell, D. A., & Palsson, B. O. (2003). Metabolic pathways in the post-genome era. Trends in biochemical sciences, 28(5), 250-258.
Rosano, G. L., & Ceccarelli, E. A. (2014). Recombinant protein expression in Escherichia coli: advances and challenges. Frontiers in microbiology, 5, 172.
Stephanopoulos, G. (2012). Synthetic biology and metabolic engineering. ACS synthetic biology, 1(11), 514-525.
Tashiro, Y., Rodriguez, G. M., & Atsumi, S. (2015). 2-Keto acids based biosynthesis pathways for renewable fuels and chemicals. Journal of industrial microbiology & biotechnology, 42(3), 361-373. Taxon, E., Halbers, L. and Parsons, S., 2020. Kinetics aspects of Gamma-hydroxybutyrate
dehydrogenase. Biochimica et Biophysica Acta (BBA) - Proteins and Proteomics, 1868(5), p.140376. Tian, J., Bryk, R., Shi, S., Erdjument‐Bromage, H., Tempst, P., & Nathan, C. (2005). Mycobacterium tuberculosis appears to lack α‐ketoglutarate dehydrogenase and encodes pyruvate dehydrogenase in widely separated genes. Molecular microbiology, 57(3), 859-868.
Vigneswari, S., Vijaya, S., Majid, M. I. A., Sudesh, K., Sipaut, C. S., Azizan, M. N. M., & Amirul, A. A. (2009). Enhanced production of poly (3-hydroxybutyrate-co-4-hydroxybutyrate) copolymer with manipulated variables and its properties. Journal of industrial microbiology & biotechnology, 36(4), 547-556.
Wagner, T., Bellinzoni, M., Wehenkel, A., O'Hare, H. M., & Alzari, P. M. (2011). Functional plasticity and allosteric regulation of α-ketoglutarate decarboxylase in central mycobacterial metabolism. Chemistry & biology, 18(8), 1011-1020.
Walsh, C. T. (2020). Biologically generated carbon dioxide: nature's versatile chemical strategies for carboxy lyases. Natural product reports
Wolff, R. and Kenealy, W., 1995. Purification and Characterization of the Oxygen-Sensitive 4-Hydroxybutanoate Dehydrogenase from Clostridium kluyveri. Protein Expression and Purification, 6(2), pp.206-212.
Yang, Y. T., Bennett, G. N., & San, K. Y. (1998). Genetic and metabolic engineering. Electronic Journal of Biotechnology, 1(3), 20-21.
Yim, H., Haselbeck, R., Niu, W., Pujol-Baxley, C., Burgard, A., Boldt, J., ... & Estadilla, J. (2011). Metabolic engineering of Escherichia coli for direct production of 1, 4-butanediol. Nature chemical biology, 7(7), 445.
Yu, J. L., Qian, Z. G., & Zhong, J. J. (2018). Advances in bio‐based production of dicarboxylic acids longer than C4. Engineering in Life Sciences, 18(9), 668-681.
Zhang, L., Shi, Z. Y., Wu, Q., & Chen, G. Q. (2009). Microbial production of 4-hydroxybutyrate, poly-4-hydroxybutyrate, and poly (3-hydroxybutyrate-co-4-hydroxybutyrate) by recombinant microorganisms. Applied microbiology and biotechnology, 84(5), 909-916.
Zhou, X. Y., Yuan, X. X., Shi, Z. Y., Meng, D. C., Jiang, W. J., Wu, L. P., ... & Chen, G. Q. (2012). Hyperproduction of poly (4-hydroxybutyrate) from glucose by recombinant Escherichia
Appendix
Media compositionTable 4 LB Medium Recipe
Components Amount
Tryptone 10 g
NaCl 10 g
Yeast Extract 5 g
dH2O 1 L
Table 5 LB-Agar Medium Recipe
Components Amount Tryptone 10 g NaCl 10 g Yeast Extract 5 g Agar 15 g dH2O 1 L
Table 6 M9 Minimal Medium Recipe
Components Amount Na2HPO4* 7H2O. 12,8 g KH2PO4 3 g NaCl 0,5 g NH4Cl 1 g MgSO4
0,24g
CaCl20,01g
Glucose dH2O0,4g
1L
Table 7 Bindning Buffer
Components Amount
Tris-HCl
20mM
NaCl 0,5M
Imidazole 20mM
Table 8 Wash Buffer
Components Amount
Tris-HCl
20mM
NaCl 0,5M
Imidazole 50mM
Table 9 Elution Buffer
Components Amount
Tris-HCl
20mM
NaCl 0,5M
Imidazole 500mM
Table 10 Tris-acetate-EDTA buffer
Components Amount
Tris base
242 g
Acetic acid
57,1 ml
0,5 M EDTA (pH 8,0) 100 ml
dH2O
Name Sequence SucA_F1 5’-ATGAGCAGTTCACCTTCACCATTC-3’ SucA_R1 5’-TCAGCCGAACGCTGTGTCG-3’ SucAD_F1 5’-GAATTcGACTCGATCGAGGACAAGAACG-3’ 4-HBd_F1 5’-GAATTcATGAAGTTATTAAAATTGGCACCTG-3’ 4-HBd_R1 5’-TTAATATAACTTTTTATATGTG-3’ 4-HBd_F2 5’-GGAATTCATGAAGTTATTAAAATTGGCACCTGATG-3’ 4-HBd_R2 5’CGAGCTCGTTAATATAACTTTTTATATGTGTTTACTATG SucA_F3 5’-TGAGCATCCATATGAGCAGTTCACCTTCACCATTCG-3’ SucA_R3 5’-GCTAGGAATTCTAACACCACCACCACCACCACGCCGAACGC-3’ SucAD_F3 5’-TGAGCATCCATATGGACTCGATCGAGGACAAGAACG-3’ 4-HBd_F3 5’-TGAGCATCCATATGAAGTTATTAAAATTGGCACCTG-3’ 4-HBd_R3 5’-GCTAGGAATTCTAACACCACCACCACCACCACATATAAC-3’ DuetUP_1 5’-GGATCTCGACGCTCTCCCT-3’
DuetUP_2 5’-TTGTACACGGCCGCATAATC-3’
DuetDOWN_1 5’-GATTATGCGGCCGTGTACAA-3’
DuetDOWN_2 5’GCTAGTTATTGCTCAGCGG3’
Plasmids used in this project
Fig. 18 Plasmids used in the project. Inside the figures the gene and restriction enzyme is shown followed by the name of the plasmids. Next the position of the gene is indicated and lastly the total size of the plasmid. (1) The first plasmids is pET28a(+) with 4-HBd located at 1116,6462 bp between the restriction enzymes EcoRI and NotI. The total size of the plasmids is 6462 bp(2) This second plasmids is pET28a(+) with SucA located 2607,7800 bp between the restriction enzymes NdeI and XhoI. The total size of the plasmids is 7899 bp
Fig. 19 The plasmid (pCDFDuet-1) containing both the enzyme SucA and 4-HBd. In the picture restriction sites are shown in black and primers are shown in purple. The total size of the plasmid is 7454 bp
Fig.20 Chromatogram from the second of purification of 4-HBd. The protein peak is shown with the red arrow.
Fig. 21 Chromatogram from the second round of purification of SucA. The protein peak is shown with the red arrow.
Fig. 22 Chromatogram from the first round of purification of SucA. The protein peak is shown with the red arrow. There are also humps present in the beginning of the chromatogram indicating impurities. The humps are shown with the red arrows.
Table 12 Concentration from the BCA measurement. The average of the absorbance was calculated. Next the negative control was subtracted, and the value was put in the equation obtained from the standard curve (figure 9), where the y-value is absorbance and the x-value is the concentration. Lastly the concentration was multiplied with the dilution factor.
Name Abs1 Abs2 Abs3 Average
abs
Abs-NC
Concentration Concentration*Dilution Average concentration (mg/ml) SucA 0,8722 0,819 0,884 0,8584 0,6567 0,8224 0,8224 0,9674 SucA 10x 0,2968 0,2952 0,3202 0,3040 0,1024 0,1112 1,1123 4-HBd 10x 1,0188 0,8908 0,8908 0,9362 0,7345 0,9222 9,2229 9,8230 4-HB 50x 0,4041 0,4067 0,3885 0,3998 0,1981 0,2340 11,7013 4-HB100x 0,3080 0,2837 0,2602 0,2840 0,0823 0,0855 8,5450
