MASTER’S THESIS IN
MOLECULAR MEDICAL BIOLOGY 45 hp
HT2012-VT2013
Muropeptidase (MurO) as surface protein anchor for anti HIV-1 2F5 epitope on Lactobacillus plantarum
Rizwana Hussain rizwana.hussain@ymail.com
Örebro University 2013
SCHOOL OF SCIENCE AND TECHNOLOGY Master program in Molecular Medical Biology
1
Abstract
Human immunodeficiency virus type 1 (HIV-1) is a major public health concern because it cannot yet be prevented by vaccination. Mucosal surfaces are the primary sites for the HIV-1 transmission. Vaccine capable of protecting HIV-1 depends on the induction of long term mucosal immune responses. In the infected individuals, anti HIV-1 epitope can generate neutralizing antibodies and have protective effects. Vaccine which can induce local mucosal immunity may prevent HIV-1 replication within local tissues prior to systemic dissemination. The 2F5 human monoclonal antibody (MAb) has HIV-1 neutralizing activity. A conserved linear sequence ELDKWA which is present within the envelope glycoprotein of HIV virus is an epitope of 2F5 MAb. Expression of anti HIV-1 ELDKWA epitope on the cell surface of L.
plantarum via anchor protein can be a strategy to develop HIV-1 vaccines. Lactobacillus plantarum are probiotics and have cell surface displaying ability. The aim of this study was to
express anti HIV-1 2F5 epitope ELDKWA on the L. plantarum NC8 cell surface using muropeptidase (MurO) of L. plantarum CCUG 9289. The expression of recombinant protein MurO.2F5 in L. plantarum NC8 was determined by Western blot following cloning techniques. BLASTP analysis showed that MurO has two putative lysine motif (LysM) domains that can bind to peptidoglycan. Our results suggest that MurO of L. plantarum can be used as an anchor protein for anti HIV-1 ELDKWA epitope expression in L. plantarum. This implies that using L. plantarum together with anchor protein MurO could effectively be used as a vaccine delivery system against HIV-1 infection.
2
Introduction
Over the last 50 years HIV-1 has infected or killed more than 70 million people world-wide (www.unaids.org/en/media/unaids/contentassets). Till date there is no effective vaccine available against HIV-1 infection. Gastrointestinal and vaginal mucosa is the primary site for the HIV-1 transmission, especially by transcytosis. Transcytosis is followed by interaction of HIV-1 envelope glycoproteins with the galactosyl ceramide (GalCer) of the epithelial cell (Alfsen and Bomsel, 2002). A recent study showed that the HIV-1 vaccine efficacy to generate antibody responses was related to the certain regions of viral envelope proteins rather than T-cell responses (Haynes et al., 2012). Mucosal vaccines and mucosal immunity, which can reduce infection via HIV-specific mucosal immunogenic responses, should be a significant part of the strategy for development of preventive and therapeutic HIV-1 vaccines (Belyakov and Berzofsky, 2004). Induction of mucosal antibodies may prevent HIV-1 infection (Wang et al., 2011). The development of a highly effective HIV-1 vaccine depends on the ability of immunogens that elicit broadly neutralizing antibodies to the HIV-1 strains. About 10%-25% of HIV-infected individuals generate considerable neutralizing antibody responses (Kwong et al., 2011). After initial contact with the epithelial cells, HIV-1 virus replicates poorly and takes 6-25 days for the systemic propagation (Pope and Haase, 2003). HIV-1 replicates rapidly when it appears in blood which is then followed by the establishment of latent pool of CD4+ T cells (Chun et al., 1998). Vaccines that induce local mucosal immunity may control HIV-1 replication prior to systemic dissemination (Belyakov and Berzofsky, 2004). In infected individuals HIV-1 envelope specific neutralizing antibodies are generated late after initial infection and have weak protective effects (Pilgrim et al., 1997). Therefore, the prevention of mucosal transmission of HIV-1 is a crucial goal of HIV vaccine development.
To prevent HIV-1 infection, antibodies must bind the viral surface envelope glycoprotein, a homotrimer composed of the gp120 surface unit and the gp41 transmembrane glycoprotein (Kwong et al., 2011). Transmembrane glycoprotein gp41 is the target of three broadly neutralizing anti HIV-1 antibodies, 2F5, Z13e, and 4E10 (Zwick et al., 2001). The 2F5 human monoclonal antibody (MAb) has broad HIV-1 neutralizing activity (Conley et al., 1994) and binds a conserved linear epitope with six tandem repeats within the envelope glycoprotein gp41 having a core recognition tandem repeat sequence ELDKWA (Muster et al., 1993). The 2F5 MAb exhibits about100-fold enhanced binding to ELDKWA epitope (Ofek et al., 2004). Intranasal immunization of mice with the epitope-vaccine based immunogens containing
3 higher ELDKWA epitope density have shown to produce higher level of mucosal ELDKWA epitope specific IgAs (Wang et al., 2011). The ELDKWA epitope recognized by antibodies neutralize HIV-1 entry in epithelial and CD4+ mononucleated cells (Alfsen and Bomsel, 2002). Hence, the development of a mucosal-targeted immunogen composed of ELDKWA epitope, is an attractive epitope vaccine strategy to be investigated (Wang et al., 2011).
It has been shown that monoclonal antibodies isolated from HIV-1 infected individuals can neutralize the primary HIV-1 isolates in vitro (Burton et al., 1994; Muster et al., 1993) and have protected monkeys from simian-HIV (SHIV) challenge (Baba et al., 2000). It is an important strategy to induce humoral and cellular immune responses to terminate HIV-1 infection before it appears in blood (Johnston and Fauci, 2007). So the immunogen which can neutralize HIV-1 virus by evoking immune responses can be useful to fight HIV-1 in mucosal tissues. One such strategy to neutralize HIV-1 virus is to develop live vaccine delivery system by expressing ELDKWA using anchoring proteins or peptides on the cell surface of bacteria (Yang et al., 2008). Gram-positive bacteria are more appropriate candidates for the development of live vaccine delivery systems as compare to the Gram-negative bacteria due to the rigid structure of their cell walls (Samuelson et al., 2002). Lactobacillus plantarum is Gram-positive, lactic acid bacteria which inhabit a variety of environmental niches, including the human gastrointestinal (GI) tract (Bron et al., 2004). Many Lactobacilli species are ‘generally recognized as safe’ (GRAS) and are thought to provide the host with many beneficial health effects therefore they can be manipulated to be carriers of live oral vaccines (Hynonen et al., 2002). L. plantarum, a probiotic LAB, is a potential candidate as a mucosal delivery vector for therapeutic proteins and vaccines in humans (Bermudez-Humaran et al., 2011). For an efficient cell surface display system, the anchor protein should have a high binding capacity to the bacterial cell surface.
Anchor proteins, including various outer membrane proteins, membrane-spanning protein PgsA, lipoproteins, autotransporters, subunits of surface appendages, and S-layer proteins have been described to display the protein and peptide of interest on the bacterial surface (Hu et al., 2010; Yang et al., 2008). The anchoring efficiency of extracellular proteins to the cell wall largely depend upon their functional elements that how efficiently they anchor heterogonous protein to the cell surface. More recently, γ-D-glutamate-meso-diaminopimelate muropeptidases (MurO) has been reported as a novel anchor protein for constructing a surface display system for L. plantarum (Xu et al., 2011). In Gram-positive bacteria the anchor proteins incorporate into the cell wall peptidoglycan using lysine motifs (LysM) (Desvaux et
4 al., 2006). Gene murO of L. plantarum encodes MurO anchor protein, which has two putative LysM regions located in the N-terminus that allow MurO to bind the bacterial cell wall. The establishment of surface display system for heterogonous proteins on L. plantarum using recombinant DNA technology encourages the use of MurO anchor protein of probiotic L.
plantarum for the development of novel therapeutic protein mucosal delivery vectors
(Bermudez-Humaran et al., 2013). The aim of this study was to investigate whether MurO protein from L. plantarum CCUG 9289 can be used for surface presentation of anti HIV-1 2F5 epitope ELDKWA on L. plantarum NC8 with context to provide a platform for the development of a vaccine delivery system using epitope-vaccine based antigen against HIV-1 by evoking mucosal antibodies. In this study we demonstrated the expression of HIV-1 neutralizing antibody 2F5 epitope ELDKWA on the cell surface of probiotic L. plantarum via anchor protein MurO. This would mean that using L. plantarum together with anchor protein MurO could effectively be used as a vaccine delivery system against HIV-1 infection. Our work contribute that it is possible to investigate the development of a safe vaccine that can probably be effective in inducing mucosal immunity against HIV-1 replication at the mucosal surface.
5
Materials and Methods
Bacterial strains, plasmids and culture conditions
Lactobacillus plantarum strain CCUG 9289 (Culture Collection, University of Gothenburg,
Sweden) were grown anaerobically in Man-Rogosa-Sharpe (MRS) medium (DifcoTM BD and Company, MD, USA), incubated in CO2 incubator with 5% CO2, at 30˚C for 20 hours. Lauria-Bertani (LB) medium (AppliChem GmbH, Darmstadt, Germany) with agar (aMReSCOR Solon, Ohio, USA) supplemented with kanamycin (30 μg mlˉ1) was used for selective growth of recombinant pET28a plasmid (Novagen, Darmstadt, Germany) in
Escherichia coli JM109 (Promega, Madison, WI, USA). Lactobacillus plantarum
pSIP409.gus constructs (pSIP409 plasmid was a kind gift from Lars Axelsson, Tromso, Norway) transformed into E. coli JM109 and Lactobacillus plantarum NC8 (University of Gothenburg, Sweden) were selectively grown on LB agar and MRS agar plates supplemented with erythromycin, 200 μg mlˉ1 and 10 μg mlˉ1, respectively.
Isolation of genomic DNA
Genomic DNA of L. plantarum CCUG 9289 was extracted from their overnight bacterial culture which was grown anaerobically in 7.5 ml MRS broth at 37˚C. The isolation was carried out according to manufacturer’s instructions using GeneJETTM Genomic DNA Purification Kit (Thermo Fisher Scientific, MA, USA). Briefly, each bacterial culture was pelleted and resuspended into 180 μl of Gram-positive bacteria lysis buffer (20 mM Tris-HCl, pH 8.0, 2 mM EDTA, 1.2% Triton X-100) with added lysozyme (20 mg mlˉ1) (Sigma-Aldrich, St. Louis, MO, USA) immediately before use and incubated at 37˚C for 30 min. To achieve the complete lysis of cells 200 μl lysis solution and 20 μl of Proteinase K (Thermo Fisher Scientific, MA, USA) were added to the cell lysate and was further incubated at 56˚C for 30 min with occasional vortexting. RNase A solution (20 μl) was added to each sample and incubated for 10 min at room temperature and then 400 μl 50% ethanol was added. The prepared lysate was transferred to a purification column and the subsequent washing and elution steps were performed according to manufacturer’s instructions to elute genomic DNA.
PCR amplification and DNA isolation
The first 498 nucleotides of muropeptidase coding gene murO from L. plantarum CCUG 9289 containing lysine motifs (LysM1 and LysM2) were amplified and incorporated with
6 NcoI and NdeI restriction sites using MurO primer set (Table 1). The amplification was performed using Thermo Scientific Phusion Hot Start II High Fidelity DNA Polymerase kit (Thermo Scientific, Affibody AB, Sweden). Thermo cycling conditions used are as follows; initial denaturation was performed at 98˚C for 30 seconds included 1 cycle, in second step denaturation, annealing and extension were performed at 98˚C for 10 seconds, 60˚C for 30 seconds and 72˚C for 30 seconds respectively each with 35 cycles, the final extension was carried out at 72˚C for 10 min which included 1 cycle. The macromolecules were separated using gel electrophoresis and the extraction of murO was performed by agarose gel using NucleoSpinR Gel and PCR Clean-up Kit (Macherey-Nagel, Duren, Germany).
Cloning of MurO and 2F5 into pET28a and pSIP409 cloning vectors
The murO gene having NcoI and NdeI restriction sites was ligated into pET28a cloning vector containing oprI and 2F5 inserts in it (Kazokoglu and Scherbak, 2011, personal communication). In order to exchange oprI with murO, both murO and cloning vector were digested with FastDigestR NcoI and NdeI restriction enzymes, separately. The pET28a vector was dephosphorylated with FastAP thermosensitive alkaline phosphatase. Ligation of murO with pET28a.∆oprI.2F5 was carried out in 3:1 insert to vector molar ratio by using ~2 U of Thermo Scientific T4 DNA ligase. The insert MurO.2F5 was then cloned from Gram-negative pET28a into Gram-positive pSIP409.gus cloning vector. Both pET28a with insert and pSIP409 containing gus reporter gene were digested with restriction enzymes FastDigestR NcoI and HindIII. The cloning vector pSIP409 was dephosphorylated using FastAP thermosensitive alkaline phosphatase. The digested pET28.MurO.2F5 reaction was run on agarose gel and the MurO.2F5 insert from digested pET28a vector backbone was extracted using NucleoSpinᴿ Gel and PCR Clean-up Kit (Macherey-Nagel, Duren, Germany). Ligation of digested pSIP409∆gus backbone with gel purified MurO.2F5 insert was carried out in 2:1 insert to vector molar ratio by using ~2 U of Thermo Scientific T4 DNA ligase according to Thermo Scientific sticky-end ligation protocol with slight modifications. The 10X T4 DNA ligase buffer was replaced with 10X FastDigestR buffer with addition of 5% (w/v) polyethylene glycol (PEG) 4000 solution and adenosine triphosphate (ATP) to a final concentration of 0.5 mM. After the heat inactivation of T4 DNA ligase, the ligation reaction was additionally digested with FastDigestR KpnI to prevent the risk of recircularization of pSIP409 plasmid vector. All the enzymes, buffers, and compounds used in cloning were obtained from Thermo Fisher Scientific, Gothenburg, Sweden.
7
Bacterial transformation and screening
The ligated products were transformed into freshly prepared electro competent Gram-positive
L. plantarum NC8 and Gram-negative E.coli JM109 host cells. Electroporation settings were
adjusted to 1.5 kilo volts (kV), 25 µF, 400 Ω for transformation into NC8 cells whereas 1.8 kV, 25 µF, 200 Ω for transformation into JM109 cells using Gene Pulser II Unit (Bio-Rad, CA, USA). The NC8 transformation mixture was incubated at 30˚C under static condition for 2 hours and JM109 transformation mixture was incubated at 37˚C with constant shaking at 200 rotations per minute (rpm) for 1 hour. Selection of host cells harboring the recombinant DNA was performed using LB agar plates for JM109 cells. The plates were supplied with kanamycin and erythromycin with concentrations of 30 μg mlˉ1 and 200 μg mlˉ1 for pET28a and pSIP409∆gus constructs, respectively and incubated overnight at 37˚C. MRS agar plates containing erythromycin 10 μg mlˉ1
were used for selection of NC8 host cells and incubated at 30˚C for 36 hours. Screening of cells for the desired insert was performed by PCR. Plasmids were purified according to manufacturer’s protocol using NucleoSpinR Plasmid (NoLid) Miniprep kit (Macherey-Nagel, Duren, Germany). For fresh preparation of electro competent cells, JM109 and NC8 cells were grown on LB and MRS plates at 37˚C and 30˚C respectively. The NC8 cells were grown anaerobically.
Sequence analysis of the construct
The recombinant plasmids were sequenced by Eurofins MWG, Germany. Nucleotide and amino acid sequences were aligned using NCBI BLAST Tools (http://www.ncbi.nlm.nih.gov/).
Over-expression of Muro.2F5 in NC8 and protein analysis
L. plantarum NC8 cells harboring Muro.2F5 were grown in MRS broth containing
erythromycin (10 μg mlˉ1) to an optical density (OD600) of 0.6. To induce over-expression of Muro.2F5 in L. plantarum NC8, 2X Sakacin inducing polypeptide (SIP) (GenScript, NJ, USA) was used. At 3 hours post induction, 2 ml sample was removed for protein expression analysis by Western blot. Sample was centrifuged at 11000 xg for 2 minutes and pellet was washed with phosphate buffered saline (PBS) (Medicago AB, Uppsala, Sweden) prior to lysis. The cells were resuspended in 100 µl 1X CelLyticTM B Cell Lysis Reagent (Sigma-Aldrich, St. Louis, MO, USA) in the presence of 100 U/ml Mutanolysin (Sigma-Aldrich, St. Louis, MO, USA) and 1X Protease Inhibitor Mix (Jena Bioscience, Jena, Germany). After
8 incubation at 37˚C for 30 minutes, an additional 1μl 100X protease inhibitor mix was added which was followed by another 30 minutes of incubation at 37˚C. The suspension of disrupted cells was centrifuged at 17000 xg for 7 minutes and supernatant was collected. Cell pellets and supernatant were mixed separately with 2X sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer with 100 mM dithiothreitol (DTT) (Saveen and Werner AB, Sweden) and boiled for 5 minutes. The samples were loaded on 10% polyacrylamide Mini-PROTEANR TGXTM precast gel (Bio-Rad, CA, USA) along with Precision Plus ProteinTM Dual Xtra Standards (Bio-Rad, CA, USA) as molecular weight marker. Blotting to nitrocellulose membrane (Sigma-Aldrich, Dassel, Germany) was performed by Mini Trans-BlotR Electrophoretic Transfer Cell (Bio-Rad, CA, USA). To prevent non-specific binding, membranes were blocked with 5% milk in Tris-buffered saline (TBS) (20 mM Tris base, 150 mM NaCl, pH 7.6) at 4˚C over night. The membrane was washed with Tris-buffered saline, 0.05%Tween-20 (TBST) (20 mM Tris base, 150 mM NaCl, pH 7.6, containing 0.05% [v/v] Tween-20). Primary antibody incubation was performed for human HIV-1 gp41, C2F5 (NIBSC, Hertfordshire, UK) with working dilution 1:1500 for 1 hour at room temperature. Membranes were incubated with secondary anti-human IgG-Peroxidase antibody (Sigma-Aldrich, St. Louis, MO, USA) with dilution 1:2500 for 1 hour at room temperature. Detection was carried out by Tetramethylbenzidine (TMB) liquid substrate system (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s instructions.
Ethical consideration
9
Results
PCR based cloning of MurO.2F5 and screening of host cells
The genomic DNA of L. plantarum CCUG 9289 was purified and the first 498 nucleotides of muropeptidase coding gene murO that contained two lysine motifs (LysM1 and LysM2) were amplified and incorporated with NcoI and NdeI restriction sites using MurO primer set (fig. 1). The PCR reaction was run on agarose gel and a ~498 bp PCR product corresponding to the desired part of murO was extracted out of the gel. The gel purified part of murO was cloned into Gram-negative pET28a cloning vector that already contained 2F5 epitope sequence as insert. The recombinant DNA insert MurO.2F5 was then gel purified from the digested pET28a vector backbone and ligated successfully into Gram-positive pSIP409 plasmid vector backbone. The ligated products were transformed into freshly prepared Gram-positive L.
plantarum NC8 and Gram-negative E. coli JM109 host cells. The selective propagation of
recombinant plasmids in their host cells was verified by PCR using MurO and pSIP primer sets (Table 1). The presence of murO in pET28a vector was confirmed by gel electrophoresis as by achieving ~498 bp PCR products (fig. 2). The presence of murO and 2F5 recombinant DNA as insert in pSIP409 vector after transformation into E. coli JM109 and L. plantarum NC8 host cells was verified by achieving ~498 bp and ~1250 bp PCR products (fig. 3A and 3B).
Sequencing confirms the presence of MurO.2F5 in the plasmid vectors
The plasmid pET28a and pSIP409 were sequenced by Eurofins MWG, Germany for the presence of MurO and 2F5 as inserts. The sequencing results were analyzed for homology using BLAST program (http://www.ncbi.nlm.nih.gov/BLAST). The presence of first 498 nucleotides of murO and 150 nucleotides of 2F5 sequences was confirmed within the pET28a (fig. 4A) whereas first 263 nucleotides of murO and 150 nucleotide sequence of 2F5 was confirmed in pSIP409∆gus plasmid vectors (fig. 4B) using BLASTN program. The homology search for the murO encoding extracellular protein, γ-D-glutamate-meso-diaminopimelate muropeptidase was done by BLASTP program against the GenBank. The most significantly aligned sequence was found to be comprised of 496 amino acid residues having two putative lysine motif (LysM) domains at N-terminus. Each globular domain was comprised of approximately 40 amino acids which lie between amino acids 33 and 144. The GenBank
10 accession number used for comparison is YP_003925095.1 with protein id ADN99001.1 of muropeptidase of L. plantarum subsp. plantarum ST-III.
Expression and detection of cell wall binding protein anchors
The MurO.2F5 chimeric protein was expressed and detected by Western blot. Western blot result detected a single band of ~22.3 kDa which corresponded to the expected size of the recombinant protein MurO.2F5 (fig. 5). The specificity of MurO.2F5 protein was confirmed by introducing a negative control (pSIP409.gus plasmid without insert) in the Western blot experiment as no bands were detected on nitrocellulose membrane.
11
Discussion
The aim of this study was to investigate MurO anchor protein from L. plantarum CCUG 9289 for its ability to express anti HIV-1 2F5 epitope ELDKWA on L. plantarum NC8 surface. In this study we successfully cloned MurO.2F5 recombinant protein into Gram-negative pET28a and Gram-positive pSIP409 plasmid vectors. After transformation of MurO.2F5 into E. coli JM109 and L. plantarum NC8 host cells, the presence of inserts in their relative cloning vectors were confirmed by PCR and sequencing. The expression of MurO.2F5 was detected by Western blot in L. plantarum NC8.
We used L. plantarum NC8 for MurO.2F5 recombinant protein display which is a highly versatile LAB, plasmid-free and a model strain in many laboratories worldwide (Axelsson et al., 2012). Several protein display systems have been described for the Gram-negative bacteria, notably E. coli (Hofnung, 1991), but LAB bacteria being “safe” and probiotic are more suitable than other life vaccine carriers such as Salmonella and E. coli (Pouwels et al., 1998). The non pathogenic Staphylococci, Staphylococcus xylosus and carnosus and oral commensal Streptococcus gordonii were among the first Gram-positive bacteria for which anchored heterologous cell surface proteins were described (Pozzi et al., 1992). Other LAB like Lactococcus lactis also have capacity to target and attach heterologous proteins to the membrane and cell wall components but the ability of Lactobacilli to colonize certain regions of the mucosa and to induce local immune response makes Lactobacilli more suitable than
Lactococci for vaccine delivery systems (Pouwels et al., 1998). Lactobacilli have been used
for the development of live vaccine delivery systems by surface presentation of foreign antigens to evoke mucosal antibodies against HIV-1 (Hynonen et al., 2002). Despite of the fact that LAB are the potential candidates for the development of live vaccine delivery systems, their significant use for human health are still needed to be determined (Bermudez-Humaran et al., 2013).
A number of different protein surface anchoring systems have been used in LAB such as membrane-spanning protein PsgA (Narita et al., 2006; Hu et al., 2010) and S-layer protein (Samuelson et al., 2002; Nomellini et al., 2007; Yang et al., 2008). Extracellular proteins anchor to the cell wall via covalent or non-covalent cell wall binding domains in Gram-positive bacteria (Scott and Barnett, 2006). The majority of these display systems on the cell wall of LAB were developed through LPXTG motif by covalent binding (Narita et al., 2006; Hu et al., 2010; Desvaux et al., 2006). The LPXTG motif is sortase dependent (Gaspar et al.,
12 2005) and is important for covalent anchoring of the proteins to the cell wall peptidoglycan (Samuelson et al., 2002; Desvaux et al., 2006). Noncovalent binding of anchor proteins to the cell wall components require specific domains such as tyrosine glycine domains (YG) (Scott and Barnett, 2006), choline-binding domains (Desvaux et al., 2006) S-layer homology domains (Nomellini et al., 2007) or proteins with repetitive lysine motifs (LysM) (Scott and Barnett, 2006; Xu et al., 2011). In this study we have used MurO anchor protein. The MurO protein has two LysM regions located in the N-terminus which allow MurO to bind the bacterial cell wall (Xu et al., 2011). We amplified and cloned two lysine motifs (LysM1 and LysM2) containing murO gene. In LAB the LysM domain has peptidoglycan binding ability (Buist et al., 2008). The anchor proteins having bacterial cell surface binding sites are desirable for the development of a cell surface display system (Bosma et al., 2006). The BLASTP results of our sequenced constructs revealed the presence of MurO with two LysM domains at the N-terminus which suggest cell wall binding ability of Muro protein. Hence LysM domains can display functional proteins or enzymes on the surfaces of Gram-positive bacteria (Audouy et al., 2007).
In this study we successfully generated and expressed MurO.2F5 chimeric protein which suggests that MurO with LysM have the potential to display 2F5 epitope ELDKWA on the cell surfaces of L. plantarum. To confirm the cell surface presentation of recombinant protein, fluorescence microscopy can be performed. We found the expression of anti HIV-1 epitope 2F5 in the L. plantarum NC8 which implies that MurO can successfully display anti HIV-1 epitope 2F5 in probiotic L. plantarum. This suggests that the surface display system of anti HIV-1 epitope 2F5 based on MurO can be useful in the delivery of vaccines against HIV. Previously reported placebo-controlled vaccine trials based on the envelope antigens on a randomized HIV-1 infected human population have been unsuccessful (Flynn et al., 2005; Lee et al., 2004). These previous studies emphasize the use of broad immunity against conserved targets of HIV, to prevent and control its infection despite the genetic diversity (Jain and Rosenthal, 2011). A study in rhesus macaques has shown the efficacy of HIV-specific antibodies in controlling infection by mechanisms such as antibody-dependent cellular cytotoxicity, antibody-dependent cell mediated virus inhibition, and transcytosis-inhibition (Xiao et al., 2010).
Studies have shown that ELDKWA specific antibodies not only neutralize HIV-1 isolates but also inhibit HIV-1 transcytosis through epithelia (Conley et al., 1994; Wang et al., 2011). ELDKWA epitope is also an interesting target to solve the problem of HIV-1 diversity
13 (Muster et al., 1993). Intranasal immunization of mice with the epitope-vaccine based immunogens containing higher ELDKWA epitope density have shown to produce higher level of mucosal ELDKWA-epitope specific immunoglobulin A (IgAs) (Wang et al., 2011). This shows that the induction of ELDKWA-epitope specific mucosal antibodies can be a good strategy towards the development of HIV mucosal vaccines. Beside ELDKWA another highly conserved gp41 epitope, QARVLAVERY is a potent inducer of IgA that neutralizes HIV-1 and inhibits viral transcytosis in immunized mice (Jain and Rosenthal, 2011). However, the biological implications of these findings for humans need to be determined, especially in light of the differences between human IgA subtypes IgA1 and IgA2, and murine IgA (Mestecky et al., 2009). We found expression of MurO.2F5 by Western blotting but the potential of MurO.2F5 for surface display in L. plantarum NC8 remained to be investigated possibly by tagging MurO with fluorescent protein and subsequent fluorescent imaging.
In summary, the MurO of probiotic L. plantarum CCUG 9289 having LysM domains can be used as a protein anchor for surface presentation of anti HIV-1 2F5 epitope ELDKWA on L.
plantarum NC8 cell surface which emphasizes the need of investigating MurO for the
development of epitope-based mucosal vaccine delivery system against HIV-1 infection and to investigate the potential of such vaccines in model animals like mice to advance towards addressing the HIV-1 problem. Consequently this study refers to an ideal future implication for development of HIV mucosal vaccines that could induce ELDKWA-epitope specific mucosal antibodies with transcytosis-blocking ability.
14
Acknowledgements
This thesis work was performed at the School of Science and Technology, Örebro University, Sweden under the supervision of Dr. Nikolai Scherbak.
15 References
Alfsen, A. and Bomsel, M. (2002). HIV-1 gp41 envelope residues 650−685 exposed on
native virus act as a lectin to bind epithelial cell galactosyl ceramide. J. Biol. Chem. 277, 25649-25659.
Audouy, S. A. L., Van Selm, S., Van Roosmalen, M. L., Post, E., Kanninga, R., Neef, J., Estevao, S. and Nieuwenhuis, E. E. S. (2007). Development of lactococcal
GEM-based pneumococcal vaccines. Vaccine. 25, 2497–2506.
Axelsson, L., Rud, I., Naterstad, K., Blom, H., Renckens, B., Boekhorst, J., Kleerebezem, M., van Hijum, S. and Siezen, R. J. (2012). Genome sequence of the
naturally plasmid-free Lactobacillus plantarum strain NC8 (CCUG 61730). J. Bacteriol.
194, 2391-2392.
Baba, T. W., Liska, V., Hofmann-Lehmann, R., Vlasak, J., Xu, W., Ayehunie, S., Cavacini, L. A., Posner, M. R., Katinger, H. and Stiegler, G. (2000). Human
neutralizing monoclonal antibodies of the IgG1 subtype protect against mucosal simian-human immunodeficiency virus infection. Nat. Med. 6, 200-206.
Belyakov, I. M. and Berzofsky, J. A. (2004). Immunoiology of mucosal HIV infection
and the basis for development of a new generation of mucosal AIDS vaccines. Immunity.
20, 247-253.
Bermudez-Humaran, L. G., Kharrat, P., Chatel, J. M. and Langella, P. (2011).
Lactococci and lactobacilli as mucosal delivery vectors for therapeutic proteins and DNA vaccines. Microb. Cell. Fact. 10 Suppl 1, S4.
Bermudez-Humaran, L. G., Aubry, C., Motta, J. P., Deraison, C., Steidler, L., Vergnolle, N., Chatel, J. M. and Langella, P. (2013). Engineering lactococci and lactobacilli for human health. Curr. Opin. Microbiol.16, 278-283.
Bosma, T., Kanninga, R., Neef, J., Audouy, S. A., van Roosmalen, M. L., Steen, A., Buist, G., Kok, J., Kuipers, O. P. and Robillard, G. (2006). Novel surface display
system for proteins on non-genetically modified gram-positive bacteria. Appl. Environ.
16
Bron, P. A., Grangette, C., Mercenier, A., de Vos, W. M. and Kleerebezem, M.
(2004). Identification of Lactobacillus plantarum genes that are induced in the gastrointestinal tract of mice. J. Bacteriol. 186, 5721–5729.
Buist, G., Steen, A., Kok, J. and Kuipers, O. P. (2008). LysM, a widely distributed
protein motif for binding to (peptido)glycans. Mol. Microbiol. 68, 838-847.
Burton, D. R., Pyati, J., Koduri, R., Sharp, S. J., Thornton, G. B., Parren, P. W., Sawyer, L. S., Hendry, R. M., Dunlop, N. and Nara, P. L. (1994). Efficient
neutralization of primary isolates of HIV-1 by a recombinant human monoclonal antibody. Science. 266, 1024-1027.
Chun, T. W., Engel, D., Berrey, M. M., Shea, T., Corey, L. and Fauci, A. S. (1998).
Early establishment of a pool of latently infected, resting CD4(+) T cells during primary HIV-1 infection. Proc. Natl. Acad. Sci. USA. 95, 8869–8873.
Conley, A. J., Kessler, J. A., Boots, L. J., Tung, J. S., Arnold, B. A., Keller, P. M., Shaw, A. R. and Emini, E. A. (1994). Neutralization of divergent human
immunodeficiency virus type 1 variants and primary isolates by IAM-41-2F5, an anti-gp41 human monoclonal antibody. Proc. Natl. Acad. Sci. U S A. 91, 3348-3352.
Desvaux, M., Dumas, E., Chafsey, I. and Ebraud, M. H. (2006). Protein cell surface
display in Gram-positive bacteria: from single protein to macromolecular protein structure. FEMS Microbiol. Lett. 256, 1–15.
Flynn, N. M., Forthal, D. N., Harro, C. D., Judson, F. N., Mayer, K. H. and Para, M. F. (2005). Placebo-controlled phase 3 trial of a recombinant glycoprotein 120 vaccine to
prevent HIV-1 infection. J. Infect. Dis. 191, 654 – 665.
Gaspar, A. H., Marraffini, L. A., Glass, E. M., DeBord, K. L., Ton-That, H. and Schneewind, O. (2005). Bacillus anthracis sortase A (SrtA) anchors LPXTG
motif-containing surface proteins to the cell wall envelope. J Bacteriol. 187, 4646–4655.
Haynes, B. F. (2012). Immune-correlates analysis of an HIV-1 vaccine efficacy trial. NEJM. 366, 1275-1286.
17
Hofnung, M. (1991). Expression of foreign polypeptides at the Escherichia coli cell
surface. Methods Cell Biol. 34, 77-105.
Hu, S., Kong, J., Kong, W., Guo, T. and Ji, M. (2010). Characterization of a noval
LysM domain from Lactobacillus fermentum bacteriophage endolysin and its use as an anchor to display heterologous proteins on the surfaces of lactic acid bacteria. Appl.
Environ. Micobiol. 76, 2410-2418.
Hynonen, U., Westerlund-Wikstrom, B., Palva, A. and Korhonen, T. K. (2002).
Identification by flagellum display of an epithelial cell- and fibronectin-binding function in the SlpA surface protein of Lactobacillus brevis. J. Bacteriol. 184, 3360–3367.
Jain, S. and Rosenthal, K. L. (2011). The gp41 epitope, QARVLAVERY, is highly
conserved and a potent inducer of IgA that neutralizes HIV-1 and inhibits viral transcytosis. Mucosal Immunol. 4, 539-53.
Johnston, M. I. and Fauci, A. S. (2007). An HIV vaccine-evolving concepts. N. Engl. J. Med. 356, 2073–2081.
Kwong, P. D., Mascola, J. R. and Nabel, G. J. (2011). Rational design of vaccines to
elicit broadly neutralizing antibodies to HIV-1. Cold Spring Harb. Perspect. Med. 1, a007278. http://dx.doi.org/10.1101/cshperspect.a007278.
Lee, D., Graham, B. S., Chiu, Y. L., Gilbert, P. B., McElrath, M. J., Belshe, R. B., Buchbinder, S. P., Sheppard, H. W., Koblin, B. A., Mayer, K. H., Keefer, M. C., Mulligan, M. J. and Celum, C. L. (2004). Breakthrough infections during phase 1
and 2 prime-boost HIV-1 vaccine trials with canarypox vectors (ALVAC) and booster dose of recombinant gp120 or gp160. J. Infect. Dis. 190, 903 – 907.
Mestecky, J., Moldoveanu, Z., Smith, P. D., Hel, Z. and Alexander, R. C. (2009).
Mucosal immunology of the genital and gastrointestinal tracts and HIV-1 infection. J.
18
Muster, T., Steindl, F., Purtscher, M., Trkola, A., Klima, A., Himmler, G., Ruker, F. and Katinger, H. (1993). A conserved neutralizing epitope on gp41 of human
immunodeficiency virus type 1. J. Virol. 67, 6642-6647.
Narita, J., Okano, K., Kitao, T., Ishida, S., Sewaki, T., Sung, M. H., Fukuda, H. and Kondo, A. (2006). Display of a-amylase on the surface of Lactobacillus casei cells by use
of the PgsA anchor protein, and production of lactic acid from starch. Appl. Environ.
Microbiol. 72, 269–275.
Nomellini, J. F., Duncan, G., Dorocicz, I. R. and Smit, J. (2007). S-layer-mediated
display of the immunoglobulin G-binding domain of streptococcal protein G on the surface of Caulobacter crescentus: development of an immunoactive reagent. Appl.
Environ. Microbiol. 73, 3245–3253.
Ofek, G., Tang, M., Sambor, A., Katinger, H., Mascola, J. R., Wyatt, R. and Kwong, P. D. (2004). Structure and mechanistic analysis of the anti-human immunodeficiency
virus type 1 antibody 2F5 in complex with its gp41epitope. J. Virol. 78, 10724–10737.
Pilgrim, A. K., Pantaleo, G., Cohen, O. J., Fink, L. M., Zhou, J. Y., Zhou, J. T., Bolognesi, D. P., Fauci, A. S. and Montefiori, D. C. (1997). Neutralizing antibody
responses to human immunodeficiency virus type 1 in primary infection and long-term-nonprogressive infection. J. Infect. Dis. 176, 924–932.
Pope, M. and Haase, A. T. (2003). Transmission, acute HIV-1 infection and the quest for
strategies to prevent infection. Nat. Med. 9, 847–852.
Pouwels, P. H., Leer, R. J., Shaw, M., Heijne den Bak-Glashouwer, M. J., Tielen, F. D., Smit, E., Martinez, B., Jore, J. and Conway, P. L. (1998). Lactic acid bacteria as
antigen delivery vehicles for oral immunization purposes. Int. J. Food Microbiol. 41, 155-167.
Pozzi, G., Contorni, M., Oggioni, M. R., Manganelli, R., Tommasino, M., Cavalieri, F. and Fischetti, V. A. (1992). Delivery and expression of a heterologous antigen on the
19
Samuelson, P., Gunneriusson, E., Nygren, P. A. and Stahl, S. (2002). Display of
proteins on bacteria. J Bacteriol. 96, 129-154.
Scott, J. R. and Barnett, T. C. (2006). Surface proteins of gram positive bacteria and
how they get there. Annu. Rev. Microbiol. 60, 397–423.
Wang, J., Xu, L., Tong, P. and Chen, Y. H. (2011). Mucosal antibodies induced by
tandem repeat of 2F5 epitope block transcytosis of HIV-1. Vaccine. 29, 8542-8548.
Xiao, P., Zhao, J., Patterson, L. J., Brocca-Cofano, E., Venzon, D., Kozlowski, P. A., Hidajat, R., Demberg, T. and Robert-Guroff. M. (2010). Multiple vaccine-elicited
nonneutralizing antienvelope antibody activities contribute to protective efficacy by reducing both acute and chronic viremia following simian/human immunodefi ciency virus SHIV89.6P challenge in rhesus macaques. J. Virol. 84, 7161–7173.
Xu, W., Huang, M., Zhang, Y., Yi, X., Dong, W., Gao, X. and Jia, C. (2011). Novel
surface display system for heterogonous proteins on Lactobacillus plantarum. Lett. Appl.
Microbiol. 53, 641-648.
Yang, Z., Liu, Q., Wang, Q. and Zhang, Y. (2008). Noval bacterial surface display
systems based on outer membrane anchoring elements from the marine bacterium Vibrio anguillarum. Appl. Environ. Microbiol. 74, 4359-4365.
Zwick, M. B., Labrijn, A. F., Wang, M., Spenlehauer, C., Ollmann Saphire, E., Binley, J. M., Moore, J. P., Stiegler, G., Katinger, H., Burton, D. R. and Parren, P. W. H. I. (2001). Broadly neutralizing antibodies targeted to the membrane-proximal
external region of human immunodeficiency virus type1 glycoprotein gp41. J. Virol. 75, 10892–10905.
20
Table 1
Primer sequences used in this study.
The first 498 nucleotides of murO from L. plantarum CCUG 9289 were amplified and incorporated with NcoI and NdeI restriction sites using MurO primer sets. MurO and pSIP primer sets were used for verification of recombinant plasmids in their host cells.
Primers Nucleotide sequence (5'-3') Enzyme site
MurO-F MurO-R pSIP-F pSIP-R TAATCCATGGCAATGTCACAAGCACATACAA TATTCATATGCGCTGCACTAGTAGCTGACACG CGTCTAAGGAATTGTCAGATAGGC ATTAGTCTCGGACATTCTGC (NcoI) (NdeI)
21
Figure legends
Figure 1 Agarose gel electrophoresis analysis of PCR amplified murO gene from genomic DNA of L. plantarum CCUG 9289.
A required band of 498 bp which corresponds to the first 498 nucleotides of murO that contained two lysine motifs was identified and extracted. Measurement of the band size was performed by FastRulerᵀᴹ low range DNA ladder (L) loaded in a separate lane in the gel.
Figure 2 Agarose gel electrophoresis showed the presence of murO in pET28a plasmid vector.
The gel purified murO was cloned into Gram-negative pET28a cloning vector that already contained 2F5 epitope sequence as an insert. After recombinant plasmid pET28a.Muro.2F5 was transformed into E. coli JM109 host cells, PCR was performed using MurO primer sets to detect murO. In agarose gel electrophoresis using DNA ladder (L) identified ~498 bp PCR products in all six selectively grown bacterial colonies (1-6).
Figure 3 Agarose gel electrophoresis confirms the presence of murO and 2F5 in Gram-positive pSIP409 cloning vector.
The presence of murO and 2F5 recombinant DNA in pSIP409 vector after transformation into
E. coli JM109 (A) and L. plantarum NC8 (B) was verified by gel electrophoresis. PCR
product (murO.2F5) amplified by using pSIP primer sets were loaded in lane 1 and 2, while PCR products amplified by using MurO primer sets were loaded in lane 3 and 4 of agarose gel. Analysis showed ~1250 bp long (lane 1 and 2) and 498 bp long (lane 3 and 4) PCR products. O’ GeneRulerᵀᴹ 1kb was used as DNA ladder (L).
Figure 4 Amino acid residues of MurO.2F5 protein in the sequenced plasmid vectors.
Sequencing confirms the presence of MurO.2F5 in pET28.MurO.2F5 (A) and pSIP409.MurO.2F5 (B) plasmids. The location of restriction enzymes, MurO and 2F5 nucleotide sequences and the translated sequences of MurO and 2F5 in the pET28.MurO.2F5 sequenced plasmid. MurO protein comprising of 165 amino acid residues are encoded by 498 bp of murO gene and 2F5 epitope of 48 amino acid residues are encoded by its 150 bp nucleotide sequence (A). The presence of MurO protein of 87 amino acid residues encoded
22 by 263 bp of murO gene and 2F5 epitope of 48 amino acid residues encoded by its 150 bp long nucleotide sequence in sequenced pSIP409.MurO.2F5 plasmid (B).
Figure 5 Protein expression of MurO.2F5 in L. plantarum NC8.
Protein samples were loaded in lane 1-10 in the following order. 1. Empty; 2. pSIP409.MurO.2F5 cells, induced with sakacin inducing polypeptide; 3. pSIP409.MurO.2F5 supernatant, induced with sakacin inducing polypeptide; 4. pSIP409.MurO.2F5 cells, not induced; 5. pSIP409.MurO.2F5 supernatant, not induced; 6. pSIP409 plasmid cells without MurO.2F5, induced with sakacin inducing polypeptide; 7. pSIP409 plasmid supernatant without MurO.2F5, induced with sakacin inducing polypeptide; 8. pSIP409 plasmid cells without MurO.2F5, not induced; 9. pSIP409 plasmid supernatant without MurO.2F5, not induced; and 10. Molecular weight marker. Western blot analysis showed a protein band of ~22.3 kDa in lane 2 which corresponds to MurO.2F5 protein and no band in lane 6 which corresponds to pSIP409 plasmid without insert used as negative control. Both of these plasmids were transformed into L. plantarum NC8 and induced with sakacin inducing polypeptides.
23
24
25
Figure 3
A.
26
Figure 4.
A.
27
