N-Aryl Isoleucine Derivatives as Angiotensin II AT
2
Receptor Ligands
Malte Behrends,
[a]Charlotta Wallinder,
[a]Anna Wieckowska,
[a]Marie-Odile Guimond,
[b]Anders Hallberg,
[a]Nicole Gallo-Payet,
[b]and Mats Larhed*
[a]Introduction
The octapeptide angiotensin II (Ang II) is the major effector peptide of the renin-angiotensin system (RAS). It acts via two receptors, the AT1and the AT2receptor (AT1R and AT2R). The
ef-fects mediated by AT1R are well known and include regulation
of blood pressure and fluid/electrolyte balance.[1]When AT 2R is
expressed together with AT1R, its activation results in several
effects that oppose those mediated by the latter. Thus, stimu-lation induces vasodilatation, antiproliferation and apoptosis. Conversely, when expressed alone in undifferentiated cells, AT2R stimulation is involved in cell differentiation.[1–2] In fact,
AT2R is abundant in fetal tissues but its expression drops
rapid-ly after birth, an observation in agreement with its role in cell differentiation. In the healthy adult, aside from a few specific tissues, the expression is at barely detectable levels.[2b, 3]
How-ever, a re-expression of the receptor occurs in some pathologi-cal states, such as heart and renal failure, myocardial infarction, hypertension, brain disorders or obesity disorders.[4] There is
piling evidence that AT2R is involved in tissue repair. Therefore,
AT2R has attracted special interest in connection with cardiac
remodeling, and has now been addressed as a new target for drug intervention.[5]
We have conducted two projects in parallel with the common objective to identify selective drug-like agonists to AT2R. The first project commenced with the endogenous
pep-tide ligand Ang II (A) and subsequent stepwise modifications, including minimizations/truncations, rigidifications and incor-poration of turn mimetics resulted in series of AT2R-selective
analogues, for example C (Figure 1).[6]This approach has led us
to a new unique lead structure (E) that we anticipated could serve as a starting point for a new class of selective AT2R
ago-nists (Figure 1).[6f] A parallel project focused on transforming
the nonpeptidic but nonselective AT1R agonist L-162,313,
dis-closed by Merck, into a nonpeptidic AT2R-selective agonists.[7]
We demonstrated that L-162,313 acts as an agonist also at the AT2R, and stepwise structural modifications of L-162,313 led to
the identification of the first selective drug-like nonpeptide AT2R agonist C21/M024 (D) that has been extensively studied
in various in vitro and in vivo models (Figure 1).[8]When
com-paring the two lead structures D and E, the structural similari-ties seem obvious, despite the different origins of the mole-cules. Hence, we hypothesize that both of the leads, D and E, mimic the C terminus of Ang II (A) and the truncated ana-logues B (Ang IV) and C (Figure 1).[6f] As indicated in Figure 1,
the imidazole group would thus correspond to the histidine side chain, the sulfonyl carbamate would provide an acidic proton corresponding to the C-terminal carboxylic acid, and either the isobutyl or the n-butyl chain in C21/M024 would be able to mimic the hydrophobic Phe/Ile side chain of the C ter-minus of the peptide analogues.
Both lead structures comprise an imidazole group, which is frequently associated with undesired interactions with cyto-chrome P450 (CYP) enzymes. This issue was addressed, and CYP inhibition could successfully be minimized be replacement A novel series of ligands for the recombinant human AT2
re-ceptor has been synthesized utilizing a fast and efficient palla-dium-catalyzed procedure for aminocarbonylation as the key reaction. Molybdenum hexacarbonyl [Mo(CO)6] was employed as the carbon monoxide source, and controlled microwave heating was applied. The prepared N-aryl isoleucine deriva-tives, encompassing a variety of amide groups attached to the
aromatic system, exhibit binding affinities at best with Ki values in the low micromolar range versus the recombinant human AT2 receptor. Some of the new nonpeptidic isoleucine
derivatives may serve as starting points for further structural optimization. The presented data emphasize the importance of using human receptors in drug discovery programs.
[a] Dr. M. Behrends, Dr. C. Wallinder, Dr. A. Wieckowska, Prof. A. Hallberg, Prof. M. Larhed
Department of Medicinal Chemistry, Organic Pharmaceutical Chemistry BMC, Uppsala University
P.O. Box 574, SE-751 23 Uppsala (Sweden) E-mail: mats.larhed@orgfarm.uu.se [b] Dr. M.-O. Guimond, Prof. N. Gallo-Payet
Service of Endocrinology and Department of Physiology and Biophysics Faculty of Medicine, University of Sherbrooke
Sherbrooke, QC J1H 5N4 (Canada)
Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/open.201300040.
2014 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA. This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.
of the imidazole in C21/M024 (D) with various amide groups, providing ligands with retained activity and function.[9]
With the ambition to assess the potential of lead E, as an entry to a new class of selective AT2R agonists, we aimed at
re-placing the imidazole with a substituent less prone to bind to CYP enzymes, for example various amide groups. We decided to evaluate this new class of ligands towards the human AT2R
using transfected HEK-293 cells (HEK293-hAT2R)[8e] rather than
AT2R in pig myometrial membranes, which had been used
pre-viously.
Herein we report a convenient synthesis and pharmacologi-cal evaluation of a series of benzamides derived from E, com-prising an isoleucine residue at the C terminus and with the generic structure depicted in Figure 2. We further conclude that the amides synthesized as well as E exhibit only a weak af-finity towards human AT2R, while C21/M024 (D) binds with
high affinity.
Results and Discussion
ChemistryThe synthesis of the new potential AT2R ligands was performed
by palladium-catalyzed aminocarbonylation reactions starting from the corresponding iodo compounds under microwave heating. To allow this reaction to be conducted in sealed vials under CO gas-free conditions, molybdenum hexacarbonyl (Mo(CO)6) was chosen as the carbon monoxide source.[10] This
rather recent method allows an efficient, fast and straightfor-ward benzamide synthesis in air, and it has previously been used for the synthesis of biologically active compounds.[11]
Al-though gaseous CO is advantageous for aminocarbonylations in large scale,[12] solid CO sources[13] such as Mo(CO)
6[14] are
safer and more convenient for lab-scale chemistry since no gas tubes and high pressure equipment are required.
The aryl iodides 1–4 were converted by a standard coupling with isoleucine-tert-butyl ester to afford 5–8 (Scheme 1). After purification, moderate to excellent yields of 38–98 % were ach-ieved. The aryl iodides coupled with the isoleucine-tert-butyl ester residue were subsequently MW irradiated for 15 min at 100 8C in the presence of palladium catalyst with Mo(CO)6and
a selection of primary and secondary amines bearing aliphatic, aromatic, cyclic as well as heterocyclic groups with diverse steric and lipophilic properties (9–36 and 65–67, Table 1). The yields of the aminocarbonylation step varied much depending on the steric hindrance of the nucleophilic amine and its elec-tronic properties and ranged from 14 % (19; Table 1, entry 11) to 85 % (17 and 22; entries 9 and 14). After hydrolysis with tri-fluoroacetic acid (TFA), target compounds 37–64 and 68–70 were afforded in mostly good to very good isolated yields, be-tween 52 % (63, Table 1, entry 27) and 96 % (47, entry 11). In a few cases the hydrolysis resulted in yields below 50 % (en-tries 1, 14, 26, 28).
Figure 1. Selective AT2R ligands with common and potentially important
structural motifs indicated, Kivalues are derived from radioligand binding
assay by displacement of radiolabeled Ang II from AT2R in pig uterus
mem-branes. E originates from the endogenous peptide Ang II (A) while the non-peptide C21/M024 (D) originates from the nonnon-peptide AT1/AT2receptor
ago-nist L-162,313.
Figure 2. Lead structure E and the generic structures of the synthesized ben-zamides.
In vitro pharmacology: Binding assays
All free acids shown in Table 1 (37–64 and 68– 70) were evaluated in a first radioligand binding assay relying on the dis-placement of [125
I]CGP-42112A (CGP-42112A ; Na-nicotinoyl-Tyr-(Na
-Cbz-Arg)-Lys-His-Pro-Ile), a se-lective but peptidic AT2
receptor agonist[15] from
human AT2R expressed in
HEK-293 cells (HEK293-hAT2R). Ang II was used
as the reference sub-stance.[16] The majority of
the new benzamides
shown in Table 1
(20 compounds) were also evaluated for
bind-ing toward human
AT1R.[17] None of the
eval-uated compounds
showed any affinity toward AT1R, and
there-fore the remaining com-pounds were evaluated only towards AT2R. In this
first assay, the com-pounds were initially screened for binding ac-tivity (% inhibition of [125I]CGP-42112 A binding)
at a concentration of 1mm and 10 mm. The
re-Scheme 1. Synthesis of novel benzamides as AT2R ligands. Reagents and conditions: a) IleOtBu, HATU, DIEA, DMF, RT, 16 h; b) HNR 1
R2
, Mo(CO)6, DBU, Pd(OAc)2,
THF, MW 100 8C, 15 min; c) TFA/DCM (1:1), RT, 2 h.
Table 1. Yields of synthesized benzamides and affinity towards human AT2R in HEK-293 cells by displacement of either
[125
I]CGP-42112A or [125
I]Sarile, and reference Kivalues from displacement of [ 125
I]Ang II from the AT2R in pig myometrial
membrane.
Entry Y Z Yield[a]
Yield[b]
Inhibition [%] of KiAT2R [mm]
X = tBu X = H [125
I]CGP binding Human Human Pig
1mm 10mm [125I]CGP [125I]Sarile [125I]Ang II
1 H 78 % 9 21 % 37[e] 6 10 2 H 66 % 10 56 % 38[e] 3 11 3 H 70 % 11 75 % 39[e] 4 13 4 H 76 % 12 82 % 40[e] – [c] 12 5 H 57 % 13 68 % 41[e] 5 6 6 H 24 % 14 73 % 42[e] 6 23 22.0 19.4 7 H 42 % 15 69 % 43[e] 2 4 8 H 75 % 16 65 % 44[e] 6 32 9.0 11.0 9 H 85 % 17 62 % 45[e] 6 7 10 H 55 % 18 95 % 46[e] 6 7
sults from the initial com-pound screen indicated that noncyclic disubstitut-ed benzamides (CONR1R2)
showed better interaction with AT2R. More lipophilic substituents on the benz-amide function led to higher affinity towards AT2R, and all compounds with activity in the initial screen had at least one benzyl group as substitu-ent, except the diethyl benzamide, 42 and 53. Based on the activities found in the screen, com-pounds were selected for Ki value determinations.
The ligands bearing a methyl substituent in para position showing a displacement of more than 30 % in the affinity screen [Table 1, entries 17 (53), 19 (55) and 22 (58)] were selected for Ki
de-terminations. Additionally, the para-unsubstituted derivatives [Table 1, en-tries 6 (42), 8 (44) and 11 (47)] were also included to evaluate the influence of substitution in this po-sition of the aromatic ring, even though they did not fully reach the same displacement. For the same reason, the para-ethyl derivatives [Table 1, entries 25 (61), 26 (62), 28 (64)] and the derivatives with the ben-zamides in the para posi-tion [Table 1, entries 29 (68), 30 (69), 31 (70)] were submitted directly for Ki determination,
de-spite not being included in the initial screen. Fur-thermore, it was decided to include the benzyleth-yl benzamides (48, 59, 63) based on the prelimi-nary results of the diethyl (42, 53) and dibenzyl compounds (47, 58).
Table 1. (Continued)
Entry Y Z Yield[a]
Yield[b]
Inhibition [%] of KiAT2R [mm]
X = tBu X = H [125I]CGP binding Human Human Pig
1mm 10mm [125 I]CGP [125 I]Sarile [125 I]Ang II 11 H 14 % 19 96 % 47[e] 13 43 7.5 9.6 12 H 43 % 20 64 % 48 14 [d] 31[d] 11.0 3.1 13 H 70 % 21 89 % 49 – [c] 12 14 Me 85 % 22 47 % 50[e] – [c] 7 15 Me 75 % 23 77 % 51[e] 7 13 16 Me 53 % 24 75 % 52[e] 4 7 17 Me 22 % 25 72 % 53[e] 28 62 2.4 2.6 18 Me 30 % 26 84 % 54[e] 1 18 19 Me 45 % 27 68 % 55[e] 16 34 7.6 11.2 20 Me 83 % 28 65 % 56[e] 1 7 21 Me 74 % 29 75 % 57[e] 1 4 22 Me 22 % 30 82 % 58[e] 18 62 2.5 2.3 23 Me 48 % 31 71 % 59 4 [d] 54[d] 3.4 1.5 24 Me 75 % 32 76 % 60 – [c] 6 25 Et 48 % 33 58 % 61 6 [d] 29[d] 10.0 26 Et 66 % 34 49 % 62 – [c] 26[d] 16.0
The Kivalues were determined from at least six data points
with test concentrations ranging from 30 pm to 1 mm. The concentration range was adjusted to be appropriate for the ex-pected Kivalues. The results are summarized in Table 1.
The para-H and para-methyl benzamide analogues, com-pounds 42/53, 44/55, 47/58 and 48/59, were also evaluated in a second radioligand binding assay, relying on the displace-ment of the AT1R/AT2R balanced peptide [125I]Sarile (Sarile;
[Sar1, Ile8]Ang II) instead of the AT
2R selective [125I]CGP-42112 A
from human AT2R (HEK293-hAT2R) as well as human AT1R
(HEK293-hAT1R).[8e, 18] No binding to the AT1R was observed,
and the Kivalues towards AT2R are summarized and compared
with Kivalues from the first HEK-293 binding assay in Table 1.
As can be seen, the Ki values from these two assays
corre-spond very well.
When comparing the affinity results given in Table 1, two trends become apparent. First, within each of the three sets of compounds differing only in the substituent in para position (i.e., H, Me, Et), the methyl substituted ligands show the
high-est affinities. The second trend is that the larger the substituents on the benzamide, the smaller the difference in Kivalue within each group. In the case of the diethyl substi-tuted compounds, the values are 22.0mm ([125I]CGP-42112A) for 42
as compared to 2.4mm ([125I]CGP-42112A) for 53,
and in the case of the di-benzyl substituted com-pounds, the difference is as low as 5mm between the para-methylated ligand 58 and the unsub-stituted compound 47. Moving the benzamide group to the para posi-tion leads to a significant loss in affinity. Only com-pound 70 still shows some affinity towards the AT2R with a Ki value of
35.0mm, but the com-pound is inferior to its meta analogues (47, 58 and 64). The dibenzyl substituted benzamides were the most consistent in affinity in all sets of an-alogues. The benzamides showing the best Ki
values correlate partly to the most potent benza-mide analogues of C21/ M024. The diethyl substituted analogues are among the com-pounds with highest affinities in both series, which could sug-gest that the amide functions of the two classes of compounds interact with the same environment in the receptor.[9b]
To be able to correlate the results from these new ligands targeting the human AT2R to our previous studies performed
with AT2R in membranes from pig uterus, a few reference
com-pounds were selected and included in the Kidetermination. To
our surprise, lead compound E (Table 1, entry 32) only exhibit-ed a Kivalue of 110.0mm. In our previous studies using the pig
AT2R, the Kivalue was found to be 16.6 nm.[6f]Furthermore,
re-duced binding affinities were encountered also for the other peptide analogues, that is, F with 63.0mm (pig AT2R
37.0 nm),[6f] C with 25 nm (pig AT
2R 0.5 nm),[6e] and Ang IV (B)
with a Ki value of 35 nm (pig AT2R 7.7 nm; see Table 1,
en-tries 33–35). The nonpeptide agonist C21/M024 (D) displayed a reduced binding but not to the same extent (Kihuman AT2R
9.8 nm versus Ki pig AT2R 0.4 nm). The values were verified by
the second binding assay, also targeting the human AT2R, but Table 1. (Continued)
Entry Y Z Yield[a]
Yield[b]
Inhibition [%] of KiAT2R [mm]
X = tBu X = H [125I]CGP binding Human Human Pig
1mm 10mm [125 I]CGP [125 I]Sarile [125 I]Ang II 27 Et 50 % 35 52 % 63 11 [d] 40[d] 8.3 28 Et 62 % 36 46 % 64 11 [d] 50[d] 4.4 29 H 68 % 65 74 % 68 – [c] –[c] n.c.[f] 30 H 73 % 66 88 % 69 – [c] 7[d] >100 31 H 16 % 67 57 % 70 – [c] 5[d] 35.0 Compound 32 E 110.0 47.0 0.0166 33 F 63.0 0.0370 34 C 0.025 0.0005 35 B (Ang IV) 0.035 0.0077 36 A (Ang II) 0.044 103 0.0028 0.0003 37 D (C21/M024) 0.0098 0.0076 0.0004
[a] Isolated yield after the aminocarbonylation reaction, > 95 % purity. [b] Isolated yield after the deprotection, > 95 % purity. [c] Not active. [d] Compound not included in the affinity screen, value taken from Kidetermination. [e] Evaluated
for AT1R affinity, none of the compounds exhibited any binding. [f] Not calculable—less than 25 % displacement at
with displacement of [125I]Sarile instead of [125I]CGP-42112A. In
this assay, lead compound E exhibited a Ki value of 47.0mm, C21 M024 (D) showed a Ki value of 7.6 nm, while Ang II (A) showed a 60 times higher Ki value (2.8 nm; see Table 1). C21/ M024 (D) has also been evaluated for binding towards the human AT2R by Bosnyak et al. with a reported IC50=2.29 nm (Ang II (A); IC50=0.522 nm).[19] Thus, while the drug-like C21/
M024 (D) binds with high affinity to AT2R both from human and pig, the lead E exhibits a remarkable difference in affinity in the two species.
The data suggest a species difference in the interaction of the peptide analogues and the nonpeptidic substances, re-spectively, with regard to their binding to AT2R, and emphasiz-es the importance of performing affinity studiemphasiz-es on human AT2R. The differences could of course be due to experimental conditions, in addition to species variations, for example, cell and receptor origin (endogenous membranes from uterus versus transfected kidney cells) and/or differences in the exper-imental design to measure ligand binding. However, the assays seem comparable, as the reference compounds exhibit the same relative order of affinity in both assays (Table 1, en-tries 32–37).
A comparison of the sequence of AT2R from human and pig
reveals that the receptors are very similar (95 % homology in the amino acid sequence),[20] and very fine-tuned receptor
models on a molecular level or mutation studies are required to investigate whether the observed discrepancy in binding data originates from species differences at the receptor level. It is conceivable that binding could be modulated by various levels of interferences in the two assays with partner proteins as AT2R-interacting proteins (ATIP), the promyelocytic zinc
finger protein (PLZF), the phosphatase SHP-1 or alpha subunit of G proteins. Such interactions might account for the incon-gruity reported herein.[21] Functional diversity of highly
homol-ogous proteins is rare (> 90 % amino acid identity), although it has been shown for AT2R orthologues when comparing rabbit
and human AT2R.[22]To verify if our results originates from
func-tional diversity (i.e., species differences) much more studies must be performed that are outside of the scope of this report. The AT2R exists as a single copy, localized on the
X chromosome and contains no intron in its coding region, and we hypothesize that it is more likely that the different binding data obtained are related to variations in tissues rather than species.
Georgsson et al. described the possibility to reduce the ligand size from C to the structures E and F without a major loss of affinity (Figure 1).[6f]Interestingly, these smaller ligands
showed much higher Ki values when tested towards the
human AT2receptor. The herein presented new ligands are of
comparable size as E and F but show improved affinity to-wards the human receptor. Thus, these new compounds will serve as a new starting point for further improvement of this new class of AT2R-selective ligands.
Conclusions
In summary, an efficient palladium-catalyzed procedure for aminocarbonylation of aryl iodides utilizing molybdenum hexa-carbonyl (Mo(CO)6) as carbon monoxide source has been em-ployed to make a series of AT2R ligands. Even though the Ki values presented in this work are comparably high (micromolar range), 13 of the 15 evaluated compounds demonstrate higher affinities towards the human AT2R (HEK293-hAT2R) than the original lead structure E. The large drop in affinity going from pig to human AT2receptor assay was unexpected, and the dis-crepancy is more pronounced for the peptides and pseudo-peptides than for the nonpeptidic drug-like structure D. The presented data emphasize the importance of using human re-ceptors in drug discovery programs. However, with the synthe-sized benzamides, we have obtained new starting points for targeting the human AT2R, but significantly more efforts are
re-quired until equally high potency at the human AT2R as our previously reported selective nonpeptide AT2R agonist C21/
M024 (D), is achieved.
Experimental Section
ChemistryGeneral information and materials: The microwave heating was performed in a Biotage Initiator single mode reactor, which produ-ces controlled irradiation at 2450 MHz. The reaction temperature was determined using the built-in online IR sensor. Microwave mediated reactions were performed in sealed Smith process vials designed for 2–5 mL reaction volumes. Analytical TLC was per-formed using Merck aluminium-backed 0.2 mm silica gel 60 F-254 plates, and visualization was performed with UV light (l = 254 nm). Silica gel 60 was purchased from Merck. NMR spectra were record-ed on a Varian Mercury plus at 25 8C and 400 MHz for1
H NMR and 100 MHz for13
C NMR. Chemical shifts (d) are reported in ppm and referenced indirectly to TMS via the solvent (or residual solvent) signals. Analytical RP-HPLC–MS was performed on a Gilson-Finni-gan ThermoQuest AQA system (Onyx monolithic C18 column, 50 4.6 mm) and a Dionex Ultimate 3000 (C18 column, 50 3 mm) using a MeCN/H2O gradient with 0.05 % HCOOH. Detection was
performed using UV (l = 214 nm and 254 nm) and MS detection in ESI mode. Preparative RP-HPLC was performed on a Dionex Ulti-mate 3000 system (SB-C8 column, 21.2 150 mm; MeCN/H2O
gradi-ent with 0.05 % HCOOH) using UV detection (l = 214 nm and 254 nm). Molecular masses were determined on a mass spectrome-ter equipped with an electrospray ion source (ESI-HRMS; 7-T hybrid linear ion trap (LTQ) FT mass spectrometer modified with a nanoelectrospray ion source). The optical rotation was deter-mined using a PerkinElmer 241 polarimeter. Specific rotations ([a]25
589) are reported in 10 1
deg cm2
g 1
, and the samples were prepared at a concentration of 1.0 g/100 mL in CHCl3. All starting
materials, reagents and solvents are commercially available and were used as received.
General procedure A: Synthesis of iodoaryl OtBu-Ile derivatives 5–8: The iodo benzoic acid (1–4; 1 equiv), l-isoleucine tert-butyl ester hydrochloride (IleOtBu·HCl; 1.1 equiv) and 1-[bis(dimethylami-no)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluoro-phosphate (HATU; 1.1 equiv) were dissolved in N,N-dimethylforma-mide (DMF; 4 mL mmol 1). N,N-Diisopropylethylamine (DIEA;
overnight. The mixture was poured into H2O and extracted with
EtOAc (4 40 mL mmol 1). The combined organic layers were
washed with saturated NH4Cl (1 40 mL mmol 1), H2O (4
40 mL mmol 1) and brine (2 40 mL mmol 1). After drying over
Na2SO4, the solvent was evaporated in vacuo. Purification by
column chromatography provided the pure products in moderate to excellent yields (5: 94 %, 6: 98 %, 7: 38 %, 8: 88 %).
(2S,3 R)-tert-Butyl 2-(3-iodobenzamido)-3-methylpentanoate (5): According to general procedure A, 3-iodo benzoic acid (1, 1.24 g, 5.0 mmol) was reacted with IleOtBu (1.23 g, 5.5 mmol), HATU (2.09 g, 5.5 mmol) and DIEA (2.9 mL, 16.5 mmol) in DMF (20 mL). Purification by column chromatography (i-hexane/EtOAc, 0–100 %) afforded 5 as a white semi-solid (1.96 g, 94 %):1
H NMR (CDCl3):d = 0.96 (d, J = 6.9 Hz, 3 H), 0.95–1.00 (m, 3 H), 1.22–1.31 (m, 1 H), 1.45– 1.58 (m, 1 H), 1.49 (s, 9 H), 1.94–2.02 (m, 1 H), 4.68 (dd, J = 8.2 Hz, 4.4 Hz, 1 H), 6.68 (d, J = 8.1 Hz, 1 H), 7.16 (t, J = 7.8 Hz, 1 H), 7.74 (ddd, J = 7.8 Hz, 1.6 Hz, 1.1 Hz, 1 H), 7.82 (ddd, J = 7.9 Hz, 1.7 Hz, 1.1 Hz, 1 H), 8.12 ppm (t, J = 1.6 Hz, 1 H);13 C NMR (CDCl3): d = 11.8, 15.4, 25.5, 28.1, 38.5, 57.1, 82.4, 94.2, 126.1, 130.2, 136.1, 136.3, 140.5, 165.3, 171.1 ppm. (2S,3 R)-tert-Butyl 2-(4-methyl-3-iodobenzamido)-3-methylpenta-noate (6): According to general procedure A, 3-iodo-4-methyl-ben-zoic acid (2, 1.31 g, 5.00 mmol) was reacted with IleOtBu (1.23 g, 5.50 mmol), HATU (2.09 g, 5.50 mmol) and DIEA (2.90 mL, 16.50 mmol) in DMF (20 mL). Purification by column chromatogra-phy (i-hexane/EtOAc, 0–100 %) afforded 6 as a white semi-solid (2.12 g, 98 %): 1 H NMR (CDCl3): d = 0.93 (d, J = 6.9 Hz, 3 H), 0.93 (t, J = 7.3 Hz, 3 H), 1.18–1.32 (m, 1 H), 1.46 (s, 9 H), 1.47–1.55 (m, 1 H), 1.95 (ddd, J = 9.0 Hz, 4.5 Hz, 2.1 Hz, 1 H), 2.41 (s, 3 H), 4.66 (dd, J = 8.3 Hz, 4.6 Hz, 1 H), 6.79 (d, J = 7.8 Hz, 1 H), 7.21 (d, J = 7.9 Hz, 1 H), 7.61 (dd, J = 7.9 Hz, 1.8 Hz, 1 H), 8.18 ppm (d, J = 1.8 Hz, 1 H); 13 C NMR (CDCl3): d = 11.6, 15.3, 25.5, 27.98, 28.02, 38.3, 57.0, 82.2, 100.8, 126.6, 129.4, 133.3, 137.5, 145.1, 165.0, 171.2 ppm. (2S,3 R)-tert-Butyl 2-(4-ethyl-3-iodobenzamido)-3-methylpenta-noate (7): According to general procedure A, 3-iodo-4-ethyl-benzo-ic acid (3, 2.00 g, 7.25 mmol) was reacted with IleOtBu (1.78 g, 7.97 mmol), HATU (3.03 g, 7.97 mmol) and DIEA (4.20 mL, 23.91 mmol) in DMF (25 mL). Purification by column chromatogra-phy (i-hexane/EtOAc, 0–100 %) afforded 7 as a white semi-solid (1.20 g; 38 %):1 H NMR (CDCl3):d = 0.98 (t, J = 7.3 Hz, 6 H), 1.22–1.34 (m, 1 H), 1.29 (t, J = 7.5 Hz, 3 H), 1.49 (s, 9 H), 1.54 (ddd, J = 13.1 Hz, 7.6 Hz, 3.7 Hz, 1 H), 1.99 (dddd, J = 11.4 Hz, 6.8 Hz, 4.5 Hz, 2.3 Hz, 1 H), 2.95 (q, J = 7.5 Hz, 2 H), 4.70 (dd, J = 8.2 Hz, 4.4 Hz, 1 H), 6.79 (d, J = 7.9 Hz, 1 H), 7.43 (dd, J = 8.1 Hz, 2.1 Hz, 1 H), 7.94 (dt, J = 8.0 Hz, 1.7 Hz, 1 H), 8.27 ppm (d, J = 1.8 Hz, 1 H); 13 C NMR (CDCl3): d = 11.8, 14.7, 15.4, 25.6, 26.1, 28.1, 38.4, 57.2, 82.6, 110.0, 123.2, 131.1, 131.6, 133.3, 142.3, 164.5, 171.0 ppm. (2S,3 R)-tert-Butyl 2-(4-iodobenzamido)-3-methylpentanoate (8): According to general procedure A, 4-iodo-benzoic acid (4, 2.48 g, 10.0 mmol) was reacted with IleOtBu (2.46 g, 10.0 mmol), HATU (4.18 g, 10.0 mmol) and DIEA (5.75 mL, 33.0 mmol) in DMF (30 mL). Purification by column chromatography (i-hexane/EtOAc, 0–100 %) afforded 8 as a white semi-solid (3.69 g, 88 %):1
H NMR (CDCl3):d = 0.94 (d, J = 7.4 Hz, 3 H), 0.95 (t, J = 7.5 Hz, 3 H), 1.20–1.32 (m, 1 H), 1.47 (s, 9 H), 1.49–1.57 (m, 1 H), 1.92–2.01 (m, 1 H), 4.66 (dd, J = 8.2 Hz, 4.5 Hz, 1 H), 6.74 (d, J = 8.1 Hz, 1 H), 7.48–7.52 (m, 2 H), 7.73– 7.77 ppm (m, 2 H);13 C NMR (CDCl3): d = 11.8, 15.3, 25.6, 28.1, 38.4, 57.1, 82.3, 98.5, 128.6, 133.7, 137.7, 166.1, 171.1 ppm.
General procedure B: Aminocarbonylation reactions: Iodoaryl OtBu-Ile derivative (5–8; 1 equiv, 0.5–1.0 mmol), amine (3 equiv), Pd(OAc)2(0.1 equiv) and Mo(CO)6(1 equiv) were dissolved in
tetra-hydrofuran (THF; 2.5 mL mmol 1) in a 2–5 mL Smith process vial.
The mixture was stirred for 2 min at RT. Diazabicycloundecene (DBU; 3 equiv) was added, and the vial was immediately sealed and irradiated in a microwave reactor at 100 8C for 15 min. After cooling to RT, MeOH was added, and the suspension was filtered through a short plug of Celite
. The solvent was evaporated, and the crude mixture was purified by column chromatography (i-hexane/EtOAc, 0–100 %), giving the desired products in yields between 14 % and 85 %.
(2S,3 R)-tert-Butyl 2-(3-(diethylcarbamoyl)benzamido)-3-methyl-pentanoate (14): According to general procedure B, reaction of de-rivative 5 afforded 14 as a colorless oil (45 mg, 24 %): 1
H NMR (CDCl3): d = 0.93 (d, J = 6.9 Hz, 3 H), 0.94 (t, J = 7.4 Hz, 3 H), 1.02– 1.15 (m, 3 H), 1.16–1.30 (m, 4 H), 1.45 (s, 9 H), 1.43–1.56 (m, 1 H), 1.95 (ddt, J = 11.4 Hz, 6.8 Hz, 2.2 Hz, 1 H), 3.20 (s, 2 H), 3.51 (s, 2 H), 4.65 (dd, J = 8.2 Hz, 4.5 Hz, 1 H), 6.73 (d, J = 8.2 Hz, 1 H), 7.43 (t, J = 7.5 Hz, 1 H, CHAr), 7.47 (ddd, J = 7.6 Hz, 1.6 Hz, 1.1 Hz, 1 H, CHAr), 7.76 (t, J = 1.6 Hz, 1 H, CHAr), 7.80 ppm (dt, J = 7.3 Hz, 1.6 Hz, 1 H); 13 C NMR (CDCl3): d = 11.7, 12.7, 14.1, 15.3, 25.5, 28.0, 38.3, 39.3, 43.3, 57.1, 82.2, 124.9, 127.7, 128.7, 129.2, 134.6, 137.6, 166.2, 170.2, 170.9 ppm. (2S,3 R)-tert-Butyl 2-(3-(benzyl(methyl)carbamoyl)benzamido)-3-methylpentanoate (16): According to general procedure B, reac-tion of derivative 5 afforded 16 as a white semi-solid (165 mg, 75 %): 1 H NMR (CDCl3): d = 0.90–1.00 (m, 6 H), 1.18–1.32 (m, 1 H), 1.48 (s, 9 H), 1.46–1.58 (m, 1 H), 1.93–2.04 (m, 1 H), 2.84–3.08 (m, 3 H), 4.43–4.73 (m, 2 H), 4.76 (s br, 1 H), 6.63–6.78 (m, 1 H), 7.13–7.22 (m, 1 H), 7.27–7.32 (m, 1 H), 7.35 (s br, 3 H), 7.41–7.53 (m, 1 H), 7.58 (d, J = 7.5, 1 H), 7.82–7.87 (m, 1 H), 7.89 ppm (s br, 1 H); 13 C NMR (CDCl3): d = 11.8, 15.4, 25.5, 28.1, 33.3, 37.0, 38.4, 50.8, 55.1, 57.1, 82.3, 125.7, 126.6, 127.6, 128.0, 128.2, 128.4, 128.7, 128.9, 130.0, 134.8, 136.8, 138.8, 166.1, 168.3, 171.0 ppm. (2S,3 R)-tert-Butyl 2-(3-(dibenzylcarbamoyl)benzamido)-3-methyl-pentanoate (19): According to general procedure B, reaction of de-rivative 5 afforded 19 as a white semi-solid (72 mg, 14 %):1
H NMR (CDCl3):d = 0.94 (d, J = 7.0 Hz, 3 H), 0.95–1.00 (m, 3 H), 1.17–1.30 (m, 1 H), 1.46–1.58 (m, 1 H), 1.49 (s, 9 H), 1.92–2.02 (m, 1 H), 4.39 (s br, 2 H), 4.67 (dd, J = 8.3 Hz, 4.5 Hz, 1 H), 4.68–4.82 (m, 2 H), 6.67 (d, J = 8.2 Hz, 1 H), 7.08–7.18 (m, 2 H), 7.26–7.39 (m, 8 H), 7.45 (t, J = 7.8 Hz, 1 H), 7.59–7.64 (m, 1 H), 7.83 (ddd, J = 7.8 Hz, 1.7 Hz, 1.2 Hz, 1 H), 7.92 ppm (t, J = 1.5 Hz, 1 H); 13 C NMR (CDCl3): d = 11.8, 15.4, 25.5, 28.1, 38.4, 47.1, 51.5, 57.1, 82.3, 125.4, 126.9, 127.7, 128.2, 128.4, 128.7, 128.9, 129.6, 134.8, 136.1, 136.7, 166.0, 170.9, 171.3 ppm. (2S,3 R)-tert-Butyl 2-(3-(benzyl(ethyl)carbamoyl)benzamido)-3-methylpentanoate (20): According to general procedure B, reac-tion of derivative 5 afforded 20 as a white semi-solid (97 mg, 43 %): 1 H NMR (CDCl3): d = 0.92–1.00 (m, 6 H), 1.02–1.15 (m, 1 H), 1.15–1.27 (m, 3 H), 1.44–1.56 (m, 1 H), 1.47 (s, 9 H), 1.91–2.01 (m, 1 H), 3.18 (s br, 1 H), 3.51 (s br, 1 H), 4.46 (s, 1 H), 4.66 (s br, 1 H), 4.76 (s, 1 H), 6.70 (d, J = 33.1 Hz, 1 H), 7.10–7.38 (m, 5 H), 7.50–7.38 (m, 1 H), 7.54 (s, 1 H), 7.79–7.89 ppm (m, 2 H);13 C NMR (CDCl3):d = 11.7, 12.1, 13.6, 15.3, 25.5, 28.0, 38.4, 40.0, 42.9, 46.9, 52.1, 57.1, 82.2, 125.1, 126.6, 127.4, 127.9, 128.1, 128.4, 128.6, 128.8, 129.4, 133.1, 134.7, 137.1, 162.5, 166.1, 170.9 ppm. (2S,3 R)-tert-Butyl 2-(3-(diethylcarbamoyl)-4-methylbenzamido)-3-methylpentanoate (25): According to general procedure B, reac-tion of derivative 6 afforded 25 as a white semi-solid (43 mg, 22 %):1H NMR (CDCl
3):d = 0.94 (d, J = 6.8 Hz, 3 H), 0.95 (t, J = 7.2 Hz,
3 H), 1.02 (t, J = 7.1 Hz, 3 H), 1.17–1.23 (m, 1 H), 1.25 (t, J = 7.1 Hz, 3 H), 1.47 (s, 9 H), 1.49–1.56 (m, 1 H), 1.96 (ddt, J = 9.2 Hz, 6.8 Hz, 4.6 Hz, 1 H), 2.32 (s, 3 H), 3.06–3.14 (m, 2 H), 3.22–3.81 (m, 2 H), 4.66
(dd, J = 8.3 Hz, 4.5 Hz, 1 H), 6.65 (d, J = 8.2 Hz, 1 H), 7.26 (dd, J = 8.0 Hz, 0.4 Hz, 1 H), 7.59 (d, J = 1.7 Hz, 1 H), 7.68 ppm (dd, J = 8.0 Hz, 1.1 Hz, 1 H); 13C NMR (CDCl 3): d = 11.7, 12.8, 14.0, 15.3, 18.9, 25.5, 28.0, 38.4, 38.8, 42.7, 57.0, 82.2, 124.2, 127.1, 130.6, 132.1, 137.4, 138.0, 166.2, 169.8, 171.0 ppm. (2S,3 R)-tert-Butyl 2-(3-(benzyl(methyl)carbamoyl)-4-methylbenz-amido)-3-methylpentanoate (27): According to general procedur-e B, rprocedur-eaction of dprocedur-erivativprocedur-e 6 affordprocedur-ed 27 as a whitprocedur-e sprocedur-emi-solid (102 mg, 45 %): 1 H NMR (CDCl3): d = 0.91–1.00 (m, 6 H), 1.18–1.34 (m, 1 H), 1.49 (s, 9 H), 1.51–1.58 (m, 1 H), 1.92–2.03 (m, 1 H), 2.36 (s, 3 H), 2.70 (s, 2 H), 3.08 (s, 1 H), 4.35 (s, 1 H), 4.68 (dd, J = 8.3 Hz, 4.5 Hz, 1 H), 4.78 (s, 1 H), 6.67 (d, J = 8.3 Hz, 1 H), 7.09 (d, J = 7.6 Hz, 1 H), 7.25–7.36 (m, 3 H), 7.36–7.39 (m, 2 H), 7.66 (d, J = 1.7 Hz, 1 H), 7.71 ppm (t, J = 7.2 Hz, 1 H); 13 C NMR (CDCl3): d = 11.8, 15.4, 19.0, 25.5, 28.1, 32.6, 35.7, 38.5, 50.2, 54.6, 57.0, 82.3, 124.6, 127.0, 127.6, 128.4, 128.7, 128.8, 130.9, 132.3, 136.0, 136.7, 138.0, 166.2, 170.5, 171.1 ppm. (2S,3 R)-tert-Butyl 2-(3-(dibenzylcarbamoyl)-4-methylbenzamido)-3-methylpentanoate (30): According to general procedure B, reac-tion of derivative 6 afforded 30 as a white semi-solid (115 mg, 22 %):1 H NMR (CDCl3):d = 0.93 (d, J = 6.9 Hz, 3 H), 0.97 (t, J = 7.4 Hz, 3 H), 1.16–1.29 (m, 1 H), 1.49 (s, 9 H), 1.50–1.56 (m, 1 H), 1.91–1.99 (m, 1 H), 2.36 (s, 3 H), 4.22 (s, 2 H), 4.29–4.57 (m, 1 H), 4.64 (dd, J = 8.3 Hz, 4.5 Hz, 1 H), 4.87–5.34 (m, 1 H), 6.59 (d, J = 8.2 Hz, 1 H), 7.05– 7.10 (m, 2 H), 7.26–7.39 (m, 9 H), 7.67–7.71 ppm (m, 2 H); 13 C NMR (CDCl3): d = 11.8, 15.3, 19.2, 25.5, 28.1, 38.4, 46.7, 50.9, 57.0, 82.2, 124.6, 127.2, 127.5, 127.7, 127.8, 128.7, 128.8, 128.8, 130.9, 132.1, 135.8, 136.4, 136.7, 138.5, 166.0, 170.96, 170.99 ppm. (2S,3 R)-tert-Butyl 2-(3-(benzyl(ethyl)carbamoyl)-4-methylbenz-amido)-3-methylpentanoate (31): According to general procedur-e B, rprocedur-eaction of dprocedur-erivativprocedur-e 6 affordprocedur-ed 31 as a whitprocedur-e sprocedur-emi-solid (101 mg; 45 %): 1 H NMR (CDCl3): d = 0.90–1.00 (m, 7 H), 1.12–1.33 (m, 3 H), 1.48 (s, 9 H), 1.50–1.58 (m, 1 H), 1.92–2.02 (m, 1 H), 2.36 (s, 3 H), 3.01–3.10 (m, J = 7.0 Hz, 2 H), 4.31–4.55 (m, 2 H), 4.68 (dd, J = 8.2 Hz, 4.4 Hz, 1 H), 6.67 (d, J = 8.2 Hz, 1 H), 7.10 (d, J = 7.9 Hz, 1 H), 7.21–7.41 (m, 5 H), 7.60–7.70 ppm (m, 2 H); 13 C NMR (CDCl3): d = 11.7, 12.2, 13.4, 15.3, 19.1, 25.5, 28.0, 38.4, 42.1, 51.5, 57.0, 82.2, 124.3, 127.0, 127.4, 127.7, 128.1, 128.6, 128.7, 130.6, 132.2, 136.3, 137.2, 138.1, 162.5, 166.0, 170.4 ppm. (2S,3 R)-tert-Butyl 2-(3-(diethylcarbamoyl)-4-ethylbenzamido)-3-methylpentanoate (33): According to general procedure B, reac-tion of derivative 7 afforded 33 as a white semi-solid (100 mg, 48 %): 1 H NMR (CDCl3): d = 0.99–0.93 (m, 6 H), 1.04 (t, J = 7.1 Hz, 3 H), 1.29–1.20 (m, 7 H), 1.48 (s, 9 H), 1.59–1.49 (m, 1 H), 2.02–1.92 (m, 1 H), 2.65 (q, J = 7.6 Hz, 2 H), 3.11 (q, J = 6.7 Hz, 2 H), 3.83–3.29 (m, 2 H), 4.67 (dd, J = 8.3 Hz, 4.5 Hz, 1 H), 6.64 (d, J = 8.2 Hz, 1 H), 7.33 (d, J = 8.1 Hz, 1 H), 7.58 (s, 1 H), 7.73 ppm (d, J = 6.7 Hz, 1 H); 13 C NMR (CDCl3): d = 11.8, 12.8, 14.0, 14.8, 15.4, 25.5, 25.9, 28.1, 38.5, 38.8, 42.9, 57.0, 82.2, 124.0, 127.0, 129.0, 132.1, 136.9, 144.1, 166.2, 169.8, 171.0 ppm. (2S,3 R)-tert-Butyl 2-(3-(benzyl(methyl)carbamoyl)-4-ethylbenz-amido)-3-methylpentanoate (34): According to general procedur-e B, rprocedur-eaction of dprocedur-erivativprocedur-e 7 affordprocedur-ed 34 as a whitprocedur-e sprocedur-emi-solid (155 mg, 66 %): 1H NMR (CDCl 3): d = 0.89–0.99 (m, 6 H), 1.16–1.28 (m, 4 H), 1.47 (s, 9 H), 1.49–1.56 (m, 1 H), 1.89–2.02 (m, 1 H), 2.65 (q, J = 7.5 Hz, 3 H), 2.68 (s, 2 H), 3.06 (s, 1 H), 4.20–4.53 (m, 1 H), 4.67 (dd, J = 8.2 Hz, 4.5 Hz, 1 H), 4.71–4.88 (m, 1 H), 6.69 (d, J = 7.8 Hz, 1 H), 7.09 (d, J = 7.9 Hz, 1 H), 7.32 (m, 5 H), 7.63 (d, J = 1.8 Hz, 1 H), 7.70–7.78 ppm (m, 1 H);13C NMR (CDCl 3):d = 11.7, 14.8, 15.3, 25.5, 25.9, 28.0, 32.6, 35.9, 38.4, 50.2, 54.7, 57.0, 82.2, 124.4, 126.9, 127.6, 127.7, 128.3, 128.6, 128.8, 129.0, 132.2, 136.0, 136.7, 144.2, 166.0, 170.4, 171.0 ppm. (2S,3 R)-tert-Butyl 2-(3-(benzyl(ethyl)carbamoyl)-4-ethylbenzami-do)-3-methylpentanoate (35): According to general procedure B, reaction of derivative 7 afforded 35 as a white semi-solid (120 mg, 50 %): 1 H NMR (CDCl3): d = 0.93–1.04 (m, 9 H), 1.19–1.33 (m, 4 H), 1.49 (s, 9 H), 1.54 (ddd, J = 13.0 Hz, 7.5 Hz, 5.1 Hz, 1 H), 1.93–2.02 (m, 1 H), 2.68 (q, J = 7.5 Hz, 2 H), 3.05 (q, J = 7.1 Hz, 2 H), 4.32 (d, J = 7.9 Hz, 2 H), 4.68 (dd, J = 8.3 Hz, 4.5 Hz, 1 H), 6.67 (d, J = 8.3 Hz, 1 H), 7.11 (d, J = 7.3 Hz, 1 H), 7.21–7.41 (m, 7 H), 7.59–7.67 (m, 1 H), 7.75 ppm (d, J = 7.8 Hz, 1 H); 13 C NMR (CDCl3): d = 11.8, 13.3, 15.0, 15.4, 25.5, 26.0, 28.1, 38.4, 42.2, 51.7, 57.0, 82.2, 124.2, 127.0, 127.5, 127.7, 128.3, 128.6, 128.8, 129.1, 132.1, 136.3, 137.3, 144.2, 166.0, 170.4, 171.0 ppm. (2S,3 R)-tert-Butyl 2-(3-(dibenzylcarbamoyl)-4-ethylbenzamido)-3-methylpentanoate (36): According to general procedure B, reac-tion of derivative 7 afforded 36 as a white semi-solid (339 mg, 62 %): 1 H NMR (CDCl3): d = 0.89–0.94 (m, 3 H), 0.96 (t, J = 7.4 Hz, 3 H), 1.15–1.27 (m, 1 H), 1.23 (t, J = 7.6 Hz, 3 H), 1.47–1.55 (m, 1 H), 1.49 (s, 9 H), 1.94 (s, 1 H), 2.61–2.75 (m, 2 H), 4.10–4.27 (m, 2 H), 4.27–4.45 (m, 1 H), 4.64 (dd, J = 8.3 Hz, 4.5 Hz, 1 H), 5.04–5.27 (m, 1 H), 6.57 (d, J = 8.0 Hz, 1 H), 7.07–7.11 (m, 2 H), 7.24–7.39 (m, 9 H), 7.68 (d, J = 1.9 Hz, 1 H), 7.75 ppm (dd, J = 8.0 Hz, 1.9 Hz, 1 H); 13 C NMR (CDCl3): d = 11.8, 15.0, 15.4, 25.5, 26.1, 28.1, 38.4, 46.6, 51.0, 57.0, 82.2, 124.5, 127.1, 127.7, 127.8, 128.7, 128.8, 128.9, 129.2, 132.1, 135.8, 136.0, 136.7, 144.5, 166.0, 170.9, 171.0 ppm. (2S,3 R)-tert-Butyl 2-(4-(diethylcarbamoyl)benzamido)-3-methyl-pentanoate (65): According to general procedure B, reaction of de-rivative 8 afforded 65 as a white semi-solid (133 mg, 68 %):1H NMR
(CDCl3): d = 0.94–0.99 (m, 6 H), 1.05–1.14 (m, 3 H), 1.22–1.27 (m, 3 H), 1.28–1.35 (m, 1 H), 1.48 (s, 9 H), 1.49–1.61 (m, 1 H), 1.94–2.02 (m, 1 H), 3.14–3.26 (m, 2 H), 3.49–3.58 (m, 2 H), 4.69 (dd, J = 8.2 Hz, 4.4 Hz, 1 H), 6.71 (d, J = 7.6 Hz, 1 H), 7.40–7.46 (m, 2 H), 7.80– 7.85 ppm (m, 2 H);13C NMR (CDCl 3): d = 11.8, 14.2, 15.4, 25.5, 28.1, 38.5, 39.4, 43.2, 57.1, 82.4, 126.5, 127.2, 134.9, 140.4, 166.3, 170.3, 171.1 ppm. (2S,3 R)-tert-Butyl 2-(4-(benzyl(methyl)carbamoyl)benzamido)-3-methylpentanoate (66): According to general procedure B, reac-tion of derivative 8 afforded 66 as a white semi-solid (160 mg, 73 %):1 H NMR (CDCl3):d = 0.94 (s br, 6 H), 1.18–1.32 (m, 1 H), 1.46 (s, 9 H), 1.49–1.63 (m, 1 H), 1.91–2.02 (m, 1 H), 2.80 (s, 2 H), 3.02 (s, 1 H), 4.44 (s, 1 H), 4.68 (s br, 1 H), 4.73 (s, 1 H), 6.78 (s br, 1 H), 7.12 (d, J = 6.6 Hz, 1 H), 7.37–7.25 (m, 4 H), 7.48 (t, J = 6.4 Hz, 2 H), 7.74– 7.85 ppm (m, 2 H);13 C NMR (CDCl3): d = 11.7, 15.3, 25.5, 28.0, 33.2, 36.8, 38.4, 50.7, 54.9, 57.1, 82.3, 126.5, 126.9, 127.2, 127.7, 128.2, 128.7, 128.8, 135.3, 136.1, 139.1, 166.1, 170.5, 171.0 ppm. (2S,3 R)-tert-Butyl 2-(4-(dibenzylcarbamoyl)benzamido)-3-methyl-pentanoate (67): According to general procedure B, reaction of de-rivative 8 afforded 67 as a white semi-solid (40 mg, 16 %):1
H NMR (CDCl3): d = 0.96 (d, J = 7.0 Hz, 3 H), 0.97 (t, J = 7.6 Hz, 3 H), 1.21– 1.30 (m, 1 H), 1.48 (s, 9 H), 1.50–1.58 (m, 1 H), 1.98 (ddt, J = 9.2 Hz, 4.7 Hz, 2.4 Hz, 1 H), 4.72 (s, 2 H), 4.36 (s, 2 H), 4.68 (dd, J = 8.2 Hz, 4.4 Hz, 1 H), 6.71 (d, J = 8.2 Hz, 1 H), 7.12 (d, J = 6.6 Hz, 2 H), 7.27– 7.39 (m, 8 H), 7.53–7.57 (m, 2 H), 7.79–7.83 ppm (m, 2 H);13 C NMR (CDCl3):d = 11.8, 15.4, 25.5, 28.1, 38.5, 47.0, 51.4, 57.1, 82.4, 126.8, 126.9, 127.3, 127.7, 127.8, 128.5, 128.7, 128.9, 135.4, 136.0, 136.7, 139.2, 166.0, 171.1, 171.3 ppm.
General procedure C: Hydrolysis of tert-butyl esters: The ester (1 equiv, 0.08–0.6 mmol) was dissolved in CH2Cl2 (15mL/mmol).
stirred at RT for 3 h. The solvent was evaporated, and the crude mixture was purified using HPLC (MeCN/H2O, 0–100%). The pure
products were isolated in 46–96 % yield.
(2S,3 R)-2-(3-(Diethylcarbamoyl)benzamido)-3-methylpentanoic acid (42): According to general procedure C, reaction of ester 14 gave 42 as a white semi-solid (31 mg; 73 %): [a]25
589= +10.3; 1 H NMR (CD3OD):d = 0.97 (t, J = 7.4 Hz, 3 H), 1.03 (d, J = 6.8 Hz, 3 H), 1.14 (t, J = 6.4 Hz, 3 H), 1.27 (t, J = 6.4 Hz, 3 H), 1.30–1.41 (m, 1 H), 1.56–1.68 (m, 1 H), 1.98–2.10 (m, 1 H), 3.25–3.37 (m, 2 H), 3.57 (d, J = 6.8 Hz, 2 H), 4.57 (d, J = 6.3 Hz, 1 H), 7.56 (dt, J = 5.8 Hz, 3.2 Hz, 2 H), 7.86 (s, 1 H), 7.91–7.97 ppm (m, 1 H); 13 C NMR (CD3OD): d = 11.7, 13.1, 14.4, 16.1, 26.6, 38.1, 41.0, 45.0, 59.0, 126.5, 129.6, 130.0, 130.4, 135.9, 138.3, 169.4, 172.6, 174.9 ppm; HRMS (ESI): m/z [M + H]+
calcd for C18H26N2O4: 335.1971, found: 335.1972.
(2S,3 R)-2-(3-(Benzyl(methyl)carbamoyl)benzamido)-3-methyl-pentanoic acid (44): According to general procedure C, reaction of ester 16 gave 44 as a white semi-solid (51 mg, 65 %): [a]25
589= +8.0; 1 H NMR (CD3OD):d = 0.96 (t, J = 7.3 Hz, 3 H), 1.03 (d, J = 6.9 Hz, 3 H), 1.25–1.40 (m, 1 H), 1.54–1.68 (m, 1 H), 1.97–2.08 (m, 1 H), 2.89 (s, 2 H), 3.02 (s, 1 H), 4.52 (s br, 1 H), 4.57 (d, J = 6.0 Hz, 1 H), 4.76 (s br, 1 H), 7.17 (d, J = 6.8 Hz, 1 H), 7.25–7.42 (m, 4 H), 7.49–7.59 (m, 1 H), 7.62 (d, J = 6.5 Hz, 1 H), 7.89–7.98 ppm (m, 2 H);13 C NMR (CD3OD): d = 11.8, 16.3, 26.7, 33.9, 37.7, 38.3, 52.0, 56.3, 59.1, 127.2, 128.1, 128.8, 129.3, 129.8, 130.0, 130.1, 131.1, 136.1, 137.8, 138.2, 169.6, 173.0, 175.0 ppm; HRMS (ESI): m/z [M + H]+ calcd for C22H26N2O4: 383.1971, found: 383.1974. (2S,3 R)-2-(3-(Dibenzylcarbamoyl)benzamido)-3-methylpentanoic acid (47): According to general procedure C, reaction of ester 19 gave 47 as a white semi-solid (37 mg, 96 %): [a]25
589= +5.5; 1 H NMR (CD3OD):d = 0.95 (t, J = 7.4 Hz, 3 H), 1.00 (d, J = 6.9 Hz, 3 H), 1.23– 1.37 (m, 1 H), 1.59 (dqd, J = 14.9 Hz, 7.5 Hz, 4.3 Hz, 1 H), 1.95- 2.08 (m, 1 H), 4.44 (s br, 2 H), 4.55 (d, J = 6.3 Hz, 1 H), 4.63–4.77 (m, 2 H), 7.14 (s, 2 H), 7.29–7.44 (m, 8 H), 7.52 (t, J = 7.7 Hz, 1 H), 7.64 (dt, J = 7.7 Hz, 1.4 Hz, 1 H), 7.89–7.93 ppm (m, 1 H), 7.94 (t, J = 1.5 Hz, 1 H); 13 C NMR (CD3OD): d = 11.8, 16.3, 26.7, 38.3, 48.7, 53.3, 59.1, 127.0, 128.3, 128.9, 129.0, 129.5, 130.0, 130.1, 130.16, 130.21, 130.8, 136.2, 137.5, 137.7, 138.1, 169.6, 173.8, 175.0 ppm; HRMS (ESI): m/z [M + H]+
calcd for C28H30N2O4: 459.2284; found: 459.2287.
(2S,3 R)-2-(3-(Benzyl(ethyl)carbamoyl)benzamido)-3-methylpen-tanoic acid (48): According to general procedure C, reaction of ester 20 gave 48 as a white semi-solid (47 mg, 64 %): [a]25
589= +6.4; 1 H NMR (CD3OD):d = 0.97 (t, J = 7.4 Hz, 3 H), 1.03 (d, J = 6.7 Hz, 3 H), 1.06–1.25 (m, 2 H), 1.27–1.39 (m, 1 H), 1.54–1.69 (m, 1 H), 1.97–2.09 (m, 1 H), 3.22–3.29 (m, 1 H), 3.45–3.60 (m, 1 H), 4.54 (s br, 1 H), 4.56 (d, J = 6.4 Hz, 1 H), 4.80 (s, 1 H), 7.16–7.43 (m, 5 H), 7.49–7.65 (m, 2 H), 7.88–7.98 ppm (m, 2 H);13 C NMR (CD3OD):d = 11.8, 12.7, 14.1, 16.3, 26.8, 38.3, 41.8, 44.9, 48.9, 53.7, 59.2, 126.7, 128.2, 128.7, 128.9, 129.2, 129.9, 130.1, 130.2, 130.6, 136.2, 138.1, 138.7, 169.6, 173.4, 175.1 ppm; HRMS (ESI): m/z [M + H]+ calcd for C23H28N2O4: 397.2122, found: 397.2122. (2S,3 R)-2-(3-(Diethylcarbamoyl)-4-methylbenzamido)-3-methyl-pentanoic acid (53): According to general procedure C, reaction of ester 25 gave 53 as a white semi-solid (30 mg, 72 %): [a]25
589= +9.7; 1H NMR (CD 3OD):d = 0.96 (t, J = 7.4 Hz, 3 H), 1.02 (d, J = 6.8 Hz, 3 H), 1.07 (t, J = 7.1 Hz, 3 H), 1.29 (t, J = 7.1 Hz, 3 H), 1.31–1.39 (m, 1 H), 1.56–1.68 (m, 1 H), 1.08–2.08 (m, 1 H), 2.34 (s, 3 H), 3.08–3.28 (m, 2 H), 3.44–3.77 (m, 2 H), 4.55 (d, J = 6.5 Hz, 1 H), 7.39 (d, J = 8.0 Hz, 1 H), 7.70 (s, 1 H), 7.83 ppm (dd, J = 8.0 Hz, 1.8 Hz, 1 H); 13C NMR (CD3OD):d = 11.8, 13.2, 14.3, 16.3, 19.1, 26.8, 38.2, 40.7, 44.7, 59.0, 126.0, 129.3, 131.9, 133.3, 138.2, 139.5, 169.5, 172.4, 175.1 ppm;
HRMS (ESI): m/z [M + H]+ calcd for C
19H28N2O4: 349.2127, found:
349.2136.
(2S,3 R)-2-(3-(Benzyl(methyl)carbamoyl)-4-methylbenzamido)-3-methylpentanoic acid (55): According to general procedure C, re-action of ester 27 gave 55 as a white semi-solid (46 mg, 68 %): [a]25 589= +7.3; 1 H NMR (CD3OD):d = 0.96 (t, J = 7.4 Hz, 3 H), 1.02 (d, J = 6.9 Hz, 3 H), 1.24–1.39 (m, 1 H), 1.54–1.67 (m, 1 H), 1.97–2.07 (m, 1 H), 2.32 (s, 3 H), 2.75 (s, 2 H), 3.08 (s, 1 H), 4.39 (s br, 1 H), 4.56 (d, J = 6.7 Hz, 1 H), 4.66–4.87 (m, 1 H), 7.12 (d, J = 7.1 Hz, 1 H), 7.23–7.35 (m, 2 H), 7.35–7.44 (m, 3 H), 7.71–7.78 (m, 1 H), 7.80–7.86 ppm (m, 1 H); 13 C NMR (CD3OD): d = 11.8, 16.3, 19.2, 26.8, 33.5, 36.6, 38.2, 51.4, 55.8, 59.1, 126.2, 128.5, 129.0, 129.4, 129.5, 130.0, 130.1, 131.9, 133.6, 137.6, 138.2, 139.5, 169.5, 173.0, 175.1 ppm; HRMS (ESI): m/z [M + H]+
calcd for C23H28N2O4: 397.2127; found: 397.2117.
(2S,3 R)-2-(3-(Dibenzylcarbamoyl)-4-methylbenzamido)-3-methyl-pentanoic acid (58): According to general procedure C, reaction of ester 30 gave 58 as a white semi-solid (67 mg, 82 %): [a]25
589= +5.5; 1 H NMR (CD3OD):d = 0.95 (t, J = 7.4 Hz, 3 H), 0.99 (d, J = 6.8 Hz, 3 H), 1.23–1.35 (m, 1 H), 1.58 (ddt, J = 11.7 Hz, 7.5 Hz, 4.3 Hz, 1 H), 1.96– 2.05 (m, 1 H), 2.29 (s, 3 H), 4.28 (s, 2 H), 4.54 (d, J = 6.4 Hz, 1 H), 4.92 (s br, 2 H), 7.04–7.07 (m, 2 H), 7.20–7.44 (m, 9 H), 7.78 (s, 1 H), 7.81 ppm (dd, J = 7.9 Hz, 1.9 Hz, 1 H); 13 C NMR (CD3OD): d = 11.8, 16.3, 19.4, 26.7, 38.3, 48.8, 52.8, 59.0, 126.4, 128.7, 129.0, 129.1, 129.5, 129.8, 129.95, 130.02, 132.1, 133.3, 137.2, 137.5, 138.1, 134.0, 169.3, 173.5, 175.0 ppm; HRMS (ESI): m/z [M + H]+ calcd for C29H32N2O4: 473.2440; found: 473.2445. (2S,3 R)-2-(3-(Benzyl(ethyl)carbamoyl)-4-methylbenzamido)-3-methylpentanoic acid (59): According to general procedure C, re-action of ester 31 gave 59 as a white semi-solid (48 mg, 71 %): [a]25 589= +6.4; 1 H NMR (CD3OD):d = 0.96 (t, J = 7.4 Hz, 3 H), 0.99 (d, J = 6.9 Hz, 3 H), 1.01–1.26 (m, 3 H), 1.26–1.39 (m, 1 H), 1.54–1.67 (m, 1 H), 1.95–2.07 (m, 1 H), 4.40 (s br, 1 H), 4.55 (d, J = 6.5 Hz, 1 H), 2.34 (s, 3 H), 3.07–3.40 (m, 2 H), 4.69–4.96 (m, 1 H), 7.11–7.16 (m, 1 H), 7.25–7.46 (m, 5 H), 7.69–7.77 (m, 1 H), 7.82 ppm (ddd, J = 13.8 Hz, 8.0 Hz, 1.9 Hz, 1 H);13 C NMR (CD3OD):d = 11.8, 12.7, 13.8, 16.3, 19.3, 26.8, 38.4, 41.4, 44.3, 48.3, 53.2, 59.3, 126.1, 128.6, 128.9, 129.0, 129.3, 129.5, 129.9, 130.0, 132.0, 133.5, 137.9, 138.8, 139.7, 169.3, 173.0, 175.3 ppm; HRMS (ESI): m/z [M + H]+ calcd for C24H30N2O4: 411.2278, found: 411.2289. (2S,3 R)-2-(3-(Diethylcarbamoyl)-4-ethylbenzamido)-3-methyl-pentanoic acid (61): According to general procedure C, reaction of ester 33 gave 61 as a white semi-solid (31 mg, 58 %): [a]25
589= +9.7; 1 H NMR (CD3OD):d = 0.96 (t, J = 7.4 Hz, 3 H), 1.02 (d, J = 6.9 Hz, 3 H), 1.08 (t, J = 7.1 Hz, 3 H), 1.25 (t, J = 7.6 Hz, 3 H), 1.28 (t, J = 7.1 Hz, 3 H), 1.31–1.39 (m, 1 H), 1.62 (ddq, J = 14.9 Hz, 7.5 Hz, 4.3 Hz, 1 H), 1.97–2.08 (m, 1 H), 2.61–2.72 (m, 2 H), 3.09–3.27 (m, 2 H), 3.39–3.56 (m, 1 H), 3.71 (s br, 1 H), 4.56 (d, J = 6.5 Hz, 1 H), 7.45 (d, J = 8.1 Hz, 1 H), 7.69 (s, 1 H), 7.88 ppm (dd, J = 8.1 Hz, 2.0 Hz, 1 H); 13 C NMR (CD3OD):d = 11.8, 13.1, 14.3, 15.4, 16.3, 26.8, 27.1, 38.3, 40.6, 44.8, 59.1, 126.1, 129.5, 130.4, 133.3, 137.7, 145.6, 169.4, 172.4, 175.0 ppm; HRMS (ESI): m/z [M + H]+ calcd for C20H30N2O4: 363.2278, found: 363.2278. (2S,3 R)-2-(3-(Benzyl(methyl)carbamoyl)-4-ethylbenzamido)-3-methylpentanoic acid (62): According to general procedure C, re-action of ester 34 gave 62 as a white semi-solid (45 mg, 49 %): [a]25 589= +4.2; 1H NMR (CD 3OD):d = 0.96 (t, J = 7.4 Hz, 3 H), 1.02 (d, J = 6.9 Hz, 3 H), 1.18–1.28 (m, 3 H), 1.28–1.39 (m, 1 H), 1.54–1.67 (m, 1 H), 1.97–2.08 (m, 1 H), 2.60–2.73 (m, 2 H), 2.76 (s, 2 H), 3.08 (s, 1 H), 4.38 (s, 1 H), 4.55 (d, J = 6.5 Hz, 1 H), 4.60–4.80 (m, 1 H), 7.11–7.16 (m, 1 H), 7.23–7.36 (m, 2 H), 7.37–7.47 (m, 3 H), 7.72 (t, J = 7.5 Hz, 1 H), 7.87 ppm (dt, J = 8.1 Hz, 1.8 Hz, 1 H); 13C NMR (CD 3OD): d =
11.8, 15.5, 16.3, 26.8, 27.1, 33.5, 37.0, 38.2, 51.5, 56.0, 59.1, 126.4, 128.5, 129.0, 129.6, 129.8, 130.0, 130.1, 130.5, 133.6, 137.4, 138.2, 145.7, 169.6, 173.0, 175.1 ppm; HRMS (ESI): m/z [M + H]+ calcd for
C24H30N2O4: 411.2284; found: 411.2276.
(2S,3 R)-2-(3-(Benzyl(ethyl)carbamoyl)-4-ethylbenzamido)-3-methylpentanoic acid (63): According to general procedure C, re-action of ester 35 gave 63 as a white semi-solid (46 mg, 52 %): [a]25 589= +5.7; 1 H NMR (CD3OD):d = 0.95 (t, J = 7.4 Hz, 3 H), 1.02 (t, J = 7.1 Hz, 3 H), 1.20 (t, J = 7.6 Hz, 3 H), 1.24 (t, J = 7.6 Hz, 3 H), 1.27– 1.38 (m, 1 H), 1.51–1.66 (m, 1 H), 1.93–2.08 (m, 1 H), 2.59–2.70 (m, 2 H), 3.04–3.17 (m, 1 H), 3.61–3.86 (m, 1 H), 4.36 (d, J = 4.6 Hz, 1 H), 4.54 (d, J = 6.5 Hz, 1 H), 4.57–5.03 (m, 1 H), 7.10–7.16 (m, 1 H), 7.21– 7.33 (m, 2 H), 7.34–7.45 (m, 3 H), 7.67–7.75 (m, 1 H), 7.86 ppm (dd, J = 8.1 Hz, 2.0 Hz, 1 H); 13 C NMR (CD3OD):d = 11.8, 12.6, 15.5, 16.3, 26.8, 27.2, 38.3, 41.3, 44.4, 48.1, 53.4, 59.1, 126.2, 128.6, 128.9, 129.0, 129.5, 129.9, 130.0, 130.5, 133.4, 137.4, 138.8, 145.7, 169.3, 173.0, 175.1 ppm; HRMS (ESI): m/z [M + H]+ calcd for C25H32N2O4: 425.2440; found: 425.2442. (2S,3 R)-2-(3-(Dibenzylcarbamoyl)-4-ethylbenzamido)-3-methyl-pentanoic acid (64): According to general procedure C, reaction of ester 36 gave 64 as a white semi-solid (138 mg, 46 %): [a]25
589= + 5.5;1 H NMR (CD3OD):d = 0.96 (t, J = 7.4 Hz, 3 H), 0.98–1.03 (m, 3 H), 1.20 (t, J = 7.6 Hz, 3 H), 1.23–1.36 (m, 1 H), 1.53–1.65 (m, 1 H), 1.95– 2.06 (m, 1 H), 2.63 (q, J = 7.4 Hz, 2 H), 4.29 (s, 2 H), 4.33–4.49 (m, 1 H), 4.52 (d, J = 6.3 Hz, 1 H), 4.90–5.22 (m, 1 H), 7.10 (d, J = 7.2 Hz, 2 H), 7.22–7.41 (m, 8 H), 7.43 (d, J = 8.1 Hz, 1 H), 7.76 (s br, 1 H), 7.85 ppm (dd, J = 8.1 Hz, 1.9 Hz, 1 H); 13 C NMR (CD3OD): d = 11.9, 15.5, 16.3, 26.7, 27.2, 38.5, 48.7, 53.0, 59.3, 126.2, 128.7, 129.05, 129.09, 129.7, 129.9, 130.0, 130.1, 130.6, 133.5, 137.0, 137.2, 138.2, 146.0, 169.2, 173.5, 175.5 ppm; HRMS (ESI): m/z [M + H]+ calcd for C30H34N2O4: 487.2591, found: 487.2606. (2S,3 R)-2-(4-(Diethylcarbamoyl)benzamido)-3-methylpentanoic acid (68): According to general procedure C, reaction of ester 65 gave 68 as a white semi-solid (70 mg, 74 %): [a]25
589= +15.4; 1 H NMR (CD3OD):d = 0.97 (t, J = 7.4 Hz, 3 H), 1.04 (d, J = 6.9 Hz, 3 H), 1.12 (t, J = 7.0 Hz, 3 H), 1.26 (t, J = 7.0 Hz, 3 H), 1.30–1.41 (m, 1 H), 1.63 (ddq, J = 14.9 Hz, 7.5 Hz, 4.3 Hz, 1 H), 1.98–2.11 (m, 1 H), 3.27 (q, J = 7.0 Hz, 2 H), 3.56 (q, J = 6.9 Hz, 2 H), 4.58 (d, J = 6.4 Hz, 1 H), 7.44–7.49 (m, 2 H), 7.90–7.94 ppm (m, 2 H); 13 C NMR (CD3OD):d = 11.9, 13.2, 14.5, 16.3, 26.7, 38.3, 41.0, 45.0, 59.0, 127.5, 129.1, 136.6, 141.2, 169.7, 172.7, 174.9 ppm; HRMS (ESI): m/z [M + H]+ calcd for C18H26N2O4: 335.1965, found: 335.1967. (2S,3 R)-2-(4-(Benzyl(methyl)carbamoyl)benzamido)-3-methyl-pentanoic acid (69): According to general procedure C, reaction of ester 66 gave 69 as a white semi-solid (42 mg, 88 %): [a]25
589= + 13.2; 1 H NMR (CD3OD): d = 0.90–0.98 (m, 3 H), 0.98–1.05 (m, 3 H), 1.25–1.38 (m, 1 H), 1.60 (dt, J = 12.4 Hz, 7.5 Hz, 1 H), 1.96–2.06 (m, 1 H), 2.87 (s, 2 H), 3.02 (s, 1 H), 4.49–4.53 (m, 1 H), 4.55 (d, J = 6.5 Hz, 1 H), 4.75 (s br, 1 H), 7.16 (d, J = 7.4 Hz, 1 H), 7.24–7.39 (m, 4 H), 7.53 (d, J = 8.1 Hz, 2 H), 7.86 (d, J = 7.9 Hz, 1 H), 7.92 ppm (d, J = 8.1 Hz, 1 H); 13 C NMR (CD3OD):d = 11.8, 16.3, 26.7, 33.8, 37.7, 38.3, 51.9, 56.2, 59.1, 128.1, 128.2, 128.9, 129.0, 129.1, 129.3, 130.0, 130.1, 137.0, 137.7, 138.2, 140.5, 169.8, 173.0, 175.0 ppm; HRMS (ESI): m/z [M + H]+
calcd for C22H26N2O4: 383.1965, found: 383.1968.
(2S,3 R)-2-(4-(Dibenzylcarbamoyl)benzamido)-3-methylpentanoic acid (70): According to general procedure C, reaction of ester 67 gave 70 as a white semi-solid (20 mg, 57 %): [a]25
589= +11.9; 1H NMR (CD 3OD):d = 0.95 (t, J = 7.4 Hz, 3 H), 1.01 (d, J = 6.9 Hz, 3 H), 1.25–1.38 (m, 1 H), 1.60 (ddq, J = 14.9 Hz, 7.5 Hz, 4.3 Hz, 1 H), 1.95– 2.07 (m, 1 H), 4.43 (s br, 2 H), 4.54 (d, J = 6.3 Hz, 1 H), 4.71 (s br, 2 H), 7.14 (d, J = 6.9 Hz, 2 H), 7.26–7.40 (m, 8 H), 7.54–7.59 (m, 2 H), 7.86– 7.91 ppm (m, 2 H);13C NMR (CD 3OD):d = 11.9, 16.3, 26.7, 38.4, 48.7, 53.2, 59.2, 127.9, 128.3, 128.9, 129.2, 129.4, 130.0, 130.1, 137.1, 137.5, 138.1, 140.4, 169.7, 173.8, 175.2 ppm; HRMS (ESI): m/z [M + H]+calcd for C 28H30N2O4: 459.2278, found: 459.2289. Biology
Cell cultures: The human embryonic kidney 293 (HEK-293) cell line stably expressing human Flag-AT1 receptor was a generous gift
from Dr. Richard Leduc (Department of Pharmacology, Universit de Sherbrooke, Sherbrooke, Quebec, Canada) and prepared as pre-viously described.[23]
The native 293/FRT cell line (HEK-293 cell line with single genome-integrated Flp recombinase target site (FRT)) was maintained in high-glucose DMEM with 7 % FBS, 2 mm Gluta-MAX and 100mg mL 1
zeocin.
The stable cell line stably expressing the human AT2receptor was
established as described previously.[24] First, the forward primer
containing a HindIII restriction site and a Myc epitope (ttaaact-taagcttaccatggaacaaaaactcatctcagaagaggatctgatgaagggcaactccacc) was used with a reverse primer containing a SalI site (agcaagcaaga-cacatgtcgacttaagacacaaaggtctcc) with the Expand High FidelityPLUS
PCR System (Roche) to create a HindIII-Myc-AT2 receptor-SalI
frag-ment, which was cloned into pcDNA5/FRT between its HindIII and XhoI sites, thus creating the pcDNA5/FRT/Myc-AT2 R vector. Then,
the cell line stably expressing Myc-human AT2receptor (293/FRT/
Myc-hAT2R) was generated by Flp recombinase-mediated
homolo-gous recombination system (Flp-InTM) and was maintained with
100mg mL 1hygromycin B.[24]
Binding experiments
First radioligand binding assay: This study was performed at Cerep (France) according to literature.[16–17]
The assays were per-formed in HEK-293 cells transfected with recombinant human AT2R
or AT1R and relying on the displacement of [ 125 I]CGP-42112 A (AT2R) [16] and [125 I][Sar1 , Ile8 ]Ang II (AT1R) [17]
with radiolabeled Ang II as reference compound in the AT2R assay and radiolabeled
sarala-sin [Sar1
, Val5
, Ile8
]Ang II in the AT1R assay. Unlabeled Ang II was
used for nonspecific binding in both the AT2R (1mm) and AT1R
(10mm) assay. In the initial screen the % inhibition of [125
I]CGP-42112 A (AT2R) or [
125
I][Sar1
, Ile8
]Ang II (AT1R) binding was measured
at 1 and 10mm of the compounds. The Kivalues were determined
from at least six data points with test concentrations ranging from 30 pm to 1 mm. The concentration range was adjusted to be ap-propriate for the expected Kivalues.
Second radioligand binding assay: Binding studies were conduct-ed in HEK-293 transfectconduct-ed cells with human AT1R or AT2R and were
performed as recently described.[8e]
Briefly, the analogue [Sar1
, Ile8
]Ang II was iodinated by the Iodogen method, and binding assays were performed on cultured cells. The hormone binding re-action was initiated by addition of 0.1 nm of [125
I][Sar1
, Ile8
]Ang II (1000 Ci mmol 1
) to each Petri dish (1.0 106
cells/Petri dish) either alone (total binding) or in the presence of increasing concentra-tions of Ang II or the ligands under investigation, including 10mm Ang II for nonspecific binding (which represents less than 10 % of total binding). Incubations were performed in duplicate for 30 min at RT (22 8C). After incubation, cells were rapidly detached from the substratum with a rubber policeman; cells and media were filtered through Whatman GF/C filters (presoaked overnight in 2 % BSA), rinsed three times and counted in a Beckman g-counter. The en-dogenous ligand Ang II, the selective nonpeptide AT1 antagonist
nonpeptide AT2 antagonist PD 123,319 were used as reference
compounds for the binding studies. In radioligand binding experi-ments, IC50values were obtained by fitting radioligand competition
data to a sigmoidal function by use of a nonlinear least-squares program (GraphPad Software Inc., San Diego, CA). Kivalues were
determined using the Cheng–Prusoff equation: Ki=IC50/(1+H/KD)
where H is the radioligand concentration and KDis the KDvalue for
the radioligand.
Acknowledgements
We gratefully acknowledge the financial support from the Swed-ish Research Council. The authors wSwed-ish to thank Lucie Chouinard and Sandra Pinard (Universit de Sherbrooke, Sherbrooke, Quebec, Canada) for experimental assistance and for stimulating discussions. We sincerely thank Dr. Richard Leduc and Dr. Emma-nuel Escher (Department of Pharmacology, Universit de Sher-brooke) for the respective gifts of the AT1and AT2receptor cDNA
and of [125I][Sar1, Ile8]-Ang II. We also thank Simon Roy (PhD
stu-dent) for generating the AT1- and AT2- receptor-transfected HEK
cells. Work from the Sherbrooke team was supported by grants from the Canadian Diabetes Association (grant no. OG-3–10– 3021-NG) and by the Alzheimer Society of Canada (#1136). Final-ly, we would like to acknowledge the Beijer Laboratory (Uppsala, Sweden) where this research was conducted.
Keywords: aminocarbonylation · AT2 receptor · medicinal chemistry · palladium catalysis · peptide mimics
[1] M. de Gasparo, K. J. Catt, T. Inagami, J. W. Wright, T. Unger, Pharmacol. Rev. 2000, 52, 415.
[2] a) R. M. Carey, S. H. Padia, Trends Endocrinol. Metab. 2008, 19, 84; b) U. M. Steckelings, F. Rompe, E. Kaschina, P. Namsolleck, A. Grzesiak, H. Funke-Kaiser, M. Bader, T. Unger, J. Renin Angiotensin Aldosterone Syst. 2010, 11, 67.
[3] L. Yu, M. Zheng, W. Wang, G. J. Rozanski, I. H. Zucker, L. Gao, J. Renin An-giotensin Aldosterone Syst. 2010, 11, 214.
[4] a) U. M. Steckelings, E. Kaschina, T. Unger, Peptides 2005, 26, 1401; b) S. Padia, R. Carey, Pflugers Arch. - Eur. J. Physiol. 2013, 465, 99.
[5] a) J. Tamargo, J. Lpez-Sendn, Nat. Rev. Drug Discovery 2011, 10, 536; b) D. Lauer, S. Slavic, M. Sommerfeld, C. Thçne-Reineke, Y. Sharkovska, A. Hallberg, B. Dahlçf, U. Kintscher, T. Unger, U. M. Steckelings, E. Kas-china, Hypertension 2014, 63, e60.
[6] a) U. Rosenstrçm, C. Skçld, G. Lindeberg, M. Botros, F. Nyberg, A. Karln, A. Hallberg, J. Med. Chem. 2004, 47, 859; b) U. Rosenstrçm, C. Skçld, B. Plouffe, G. Lindeberg, M. Botros, F. Nyberg, G. Wolf, A. Karln, N. Gallo-Payet, A. Hallberg, J. Med. Chem. 2005, 48, 4009 ; c) J. Georgsson, C. Skçld, B. Plouffe, G. Lindeberg, M. Botros, M. Larhed, F. Nyberg, N. Gallo-Payet, A. Gogoll, A. Karlen, A. Hallberg, J. Med. Chem. 2005, 48, 6620; d) U. Rosenstrçm, C. Skçld, G. Lindeberg, M. Botros, F. Nyberg, A. Karln, A. Hallberg, J. Med. Chem. 2006, 49, 6133; e) J. Georgsson, U. Rosenstrçm, C. Wallinder, H. Beaudry, B. Plouffe, G. Lindeberg, M. Botros, F. Nyberg, A. Karlen, N. Gallo-Payet, A. Hallberg, Bioorg. Med. Chem. 2006, 14, 5963; f) J. Georgsson, C. Skold, M. Botros, G. Lindeberg, F. Nyberg, A. Karlen, A. Hallberg, M. Larhed, J. Med. Chem. 2007, 50, 1711.
[7] a) S. Perlman, H. T. Schambye, R. A. Rivero, W. J. Greenlee, S. A. Hjorth, T. W. Schwartz, J. Biol. Chem. 1995, 270, 1493 ; b) S. D. Kivlighn, W. R.
Huckle, G. J. Zingaro, R. A. Rivero, V. J. Lotti, R. S. L. Chang, T. W. Schorn, N. Kevin, R. G. Johnson, Jr., Am. J. Physiol. 1995, 268, R820.
[8] a) Y. Wan, C. Wallinder, B. Johansson, M. Holm, A. K. Mahalingam, X. Wu, M. Botros, A. Karlen, A. Pettersson, F. Nyberg, L. Faendriks, A. Hallberg, M. Alterman, J. Med. Chem. 2004, 47, 1536; b) Y. Wan, C. Wallinder, B. Plouffe, H. Beaudry, A. K. Mahalingam, X. Wu, B. Johansson, M. Holm, M. Botros, A. Karlen, A. Pettersson, F. Nyberg, L. Faendriks, N. Gallo-Payet, A. Hallberg, M. Alterman, J. Med. Chem. 2004, 47, 5995; c) U. M. Steckel-ings, M. Larhed, A. Hallberg, R. E. Widdop, E. S. Jones, C. Wallinder, P. Namsolleck, B. Dahlof, T. Unger, Curr. Opin. Pharmacol. 2011, 11, 187; d) U. M. Steckelings, L. Paulis, P. Namsolleck, T. Unger, Curr. Opin. Neph-rol. Hypertens. 2012, 21, 142; e) M.-O. Guimond, C. Wallinder, M. Alter-man, A. Hallberg, N. Gallo-Payet, Eur. J. Pharmacol. 2013, 699, 160; f) C. McCarthy, R. Widdop, K. Denton, E. Jones, Curr Hypertens Rep 2013, 15, 25.
[9] a) A. M. S. Murugaiah, C. Wallinder, A. K. Mahalingam, X. Wu, Y. Wan, B. Plouffe, M. Botros, A. Karln, M. Hallberg, N. Gallo-Payet, M. Alterman, Bioorg. Med. Chem. 2007, 15, 7166; b) C. Wallinder, M. Botros, U. Rose-nstrçm, M.-O. Guimond, H. Beaudry, F. Nyberg, N. Gallo-Payet, A. Hall-berg, M. Alterman, Bioorg. Med. Chem. 2008, 16, 6841; c) A. K. Mahalin-gam, Y. Wan, A. M. S. Murugaiah, C. Wallinder, X. Wu, B. Plouffe, M. Botros, F. Nyberg, A. Hallberg, N. Gallo-Payet, M. Alterman, Bioorg. Med. Chem. 2010, 18, 4570.
[10] a) N.-F. K. Kaiser, A. Hallberg, M. Larhed, J. Comb. Chem. 2002, 4, 109; b) X. Y. Wu, M. Larhed, Org. Lett. 2005, 7, 3327; c) J. Wannberg, D. Dallin-ger, C. O. Kappe, M. Larhed, J. Comb. Chem. 2005, 7, 574; d) O. Lager-lund, M. Larhed, J. Comb. Chem. 2006, 8, 4.
[11] a) J. Wannberg, N.-F. K. Kaiser, L. Vrang, B. Samuelsson, M. Larhed, A. Hallberg, J. Comb. Chem. 2005, 7, 611; b) X. Wu, J. K. Ekegren, M. Larhed, Organometallics 2006, 25, 1434.
[12] a) C. H. Cho, B. Neuenswander, R. C. Larock, J. Comb. Chem. 2010, 12, 278; b) X.-F. Wu, H. Neumann, M. Beller, Chem. Asian J. 2010, 5, 2168; c) M. Pizzetti, A. Russo, E. Petricci, Chem. Eur. J. 2011, 17, 4523. [13] a) P. Hermange, A. T. Lindhardt, R. H. Taaning, K. Bjerglund, D. Lupp, T.
Skrydstrup, J. Am. Chem. Soc. 2011, 133, 6061; b) Y. Wan, M. Alterman, M. Larhed, A. Hallberg, J. Comb. Chem. 2003, 5, 82; c) S. D. Friis, R. H. Taaning, A. T. Lindhardt, T. Skrydstrup, J. Am. Chem. Soc. 2011, 133, 18114.
[14] a) M. A. Letavic, K. S. Ly, Tetrahedron Lett. 2007, 48, 2339; b) A. Begouin, M. J. R. P. Queiroz, Eur. J. Org. Chem. 2009, 2820; c) O. Lagerlund, M. L. H. Mantel, M. Larhed, Tetrahedron 2009, 65, 7646; d) A. Wickow-ska, R. Fransson, L. R. Odell, M. Larhed, J. Org. Chem. 2011, 76, 978; e) L. Odell, R. F. Russo, M. Larhed, Synlett 2012, 685.
[15] a) V. Brechler, P. W. Jones, N. R. Levens, M. de Gasparo, S. P. Bottari, Regul. Pept. 1993, 44, 207; b) B. Buisson, S. P. Bottari, M. de Gasparo, N. Gallo-Payet, M. D. Payet, FEBS Lett. 1992, 309, 161.
[16] S. Tsuzuki, T. Ichiki, H. Nakakubo, Y. Kitami, D. F. Guo, H. Shirai, T. Inaga-mi, Biochem. Biophys. Res. Commun. 1994, 200, 1449.
[17] M. T. Le, J.-P. De Backer, L. Hunyady, P. M. L. Vanderheyden, G. Vauquelin, Eur. J. Pharmacol. 2005, 513, 35.
[18] D. T. Pals, F. D. Masucci, G. S. Denning, F. Sipos, D. C. Fessler, Circ. Res. 1971, 29, 673.
[19] S. Bosnyak, E. Jones, S. A. Christopoulos, M.-I. Aguilar, W. Thomas, G. R. Widdop, Clin. Sci. 2011, 121, 297.
[20] T U. Consortium, Nucleic Acids Res. 2012, 40, D71.
[21] a) M. Mogi, M. Iwai, M. Horiuchi, Arterioscler. Thromb. Vasc. Biol. 2007, 27, 2532 ; b) H. Funke-Kaiser, J. Reinemund, U. Steckelings, M. T. Unger, J. Renin Angiotensin Aldosterone Syst. 2010, 11, 7.
[22] Y.-H. Feng, L. Zhou, Y. Sun, J. G. Douglas, Kidney Int. 2005, 67, 1731. [23] G. Servant, S. A. Laporte, R. Leduc, E. Escher, G. Guillemette, J. Biol.
Chem. 1997, 272, 8653.
[24] S. Roy, M. Rached, N. Gallo-Payet, Mol. Endocrinol. 2007, 21, 1656.
Received: November 18, 2013 Published online on March 13, 2014
