Examensarbete 16 Hp
The effect of redoxmodulation on osteoclastogenesis
Sara Witte
Examensarbetet utfört vid Karolinska institutet, Karolinska
universitetssjukhuset i Huddinge
LITH-IFM-G-EX--10/2265—SE
2010-06-15
Institutionen för Fysik, Kemi och biologi, Linköpings universitet
Avdelningen för Patologi, Karolinska institutet i Huddinge
The effect of redoxmodulation on osteoclastogenesis
Sara Witte
Examensarbetet utfört på Karolinska institutet i Huddinge
2010-06-15
Handledare
Docent Aristi Fernandes
Fil. Dr. Pernilla Lång
Examinator
1. Table of contents
1. Table of contents 3
2. Abstract 4
3. Abbreviations 5
4. Introduction 7
5. Materials and methods 11
5.1 Thawing and expansion of RAW 264.7 cells 11
5.2 Counting of RAW 264.7 cells 11
5.3 Stimulation of RAW 264.7 cells 11
5.3.1 RANKL stimulation of RAW 264.7 cells 11
5.3.2 LPS stimulation of RAW 264.7 cells 11
5.3.3 IL-4 stimulation of RAW 264.7 cells 11
5.4 Harvesting of RAW 264.7 cells 11
5.4.1 Harvesting of RAW 264.7 cells for total RNA day 2 and 4 11 5.4.2 Harvesting of RAW 264.7 cells for protein day 2 and 4 12
5.5 Determination of protein concentration 12
5.6 Western blot 12
5.6.1 SDS-PAGE electrophoresis 12
5.6.2 Transfer to membrane 13
5.6.3 Antibody staining of membrane 13
5.6.4 Development 13
5.7 Total RNA purification 14
5.8 Primer optimization of Trx1 and TrxR1 14
5.9 Primer design 15
5.10 cDNA synthesis using RT reaction 15
5.11 Morphological TRAP assay 15
5.12 GSH and Cysteine determination in RAW 264.7 cells 16
5.12.1 Reduced form of Glutathione and Cysteine 16
5.12.2 Total form of Gluthatione and Cysteine 16
5.13 xTT- viability assay 17
6. Results 18
6.1 Primer design and optimization 18
6.2 The effect of redox modulation on osteoclast and macrophage differentiation 20
6.3 Characterization of redoxsystems 24
7. Discussion 29
8. Acknowledgments 32
9. References 33
2. Abstract
During osteoclast differentiation and bone resorption the redox status in the cell display a decrease in reduction and a shift to an oxidized state. Structure, metabolism and function are some of the extensive changes that cells undergo during differentiation which alters both the extra- and intracellular redox environment. Osteoclasts express enzymes such as TRAP and NADPH oxidase which generates reactive oxygen species (ROS). ROS are molecules formed by oxygen reduction which gives these radicals at least one unpaired electron and makes them very reactive and chemically unstable. These are factors which stimulates differentiation of
osteoclasts and bone resorption. RAW 264.7 cells will differentiate to osteoclasts when stimulated with RANKL and to activated macrophages when stimulated with LPS.
The aim of this project was to analyze if the redox environment is affected during differentiation of RAW 264.7 cells to osteoclasts and macrophages. The reason for this was that we aimed to se if RAW 264.7 cells could be used as an in vitro system to study the effects of redox changes in osteoclasts and macrophages and their activation.
Results from Western blot showed that protein expression of the Cysteine/Glutamate transporter xCT was up regulated with LPS and downregulated with RANKL. Results from the GSH/Cys assay show that the treatments with redox modulators did not affect the levels of GSH and Cys to a measurable extent. However the levels increased for both intracellular and extracellular GSH and Cys forms at day 4 in the control and stimulated cells. Addition of the disulfide reductant DTT affected differentiation to osteoclasts, leading to smaller osteoclasts probably due to interference with fusion of mononuclear pre-osteoclasts. Thus, down regulation of the xCT transporter could be an important mechanism to maintain a low level of free thiols shown to interfere with the differentiation to osteoclasts.
3. Abbreviations
PCR Polymerase chain reaction DNA Deoxyribonucleic acid
cDNA complementary Deoxyribonucleic acid DTT 1,4-Dithiothreitol
DTNB 5,5'-Dithio-bis(2-nitrobenzoic acid)
TCEP tris(2-carboxyethyl)phosphine
RANKL Receptor Activator for Nuclear Factor κ B Ligand LPS Lipopolysaccharide
PBS Phosphate buffered solution
RAW Mouse leukaemic monocyte macrophage cell line RNA Ribonucleic acid
TRAP Tartrate Resistant Acid Phosphatase Trx1 Thioredoxin-1
TrxR1 Thioredoxin reductase -1 IL-4 Interleukin- 4
dNTP deoxyribonucleotide triphosphate kDa Kilo Dalton
MEM Minimum Essential Medium FBS Fetal Bovine Serum
T75 flask 75 cm2 of surface
mRNA messenger Ribonucleic acid RNase Ribonuclease
qPCR quantitative polymerase chain reaction β-ME β- mercaptoethanol
NCBI National Center for Biotechnology Information BLAST Basic Local Alignment Search Tool
GC- content Guanine-Cytosine content RT Reverse Transcription oligo dT primer deoxyThymidine dH2O distilled water
GAPDH Glyceraldehyde-3-phosphate dehydrogenase
HPLC High Performance Liquid Chromatography GSH reduced Glutathione
mBrB Monobromo bimane
4. Introduction
It has been shown that during osteoclast differentiation and osteoclast bone resorption the redox status in the cell display a decrease in reduction during differentiation and even more so during bone resorption(1). Structure, metabolism and function are some of the extensive changes that cells undergo during differentiation which alters both the extra- and intracellular redox
environment (2). When there is a more oxidized environment in the cell due to a redox shift many elements in the cell can be damaged (1). The term redox state for a cell often includes formation of free radicals and oxidative stress in the cell (3). Redox state is maintained in cells by energy release in an oxidation reaction which for example can be the process of maintaining cellular structures and this energy release leads to a more reduced environment which often means that many ROS producing cells are present (2).
Osteoclasts are non- dividing multinucleated bone cells (4). They are responsible for bone resorption and are the only cell type with this ability (5). During bone resorption these cells undergo different phases where one phase is degradation of bone matrix, while the other phase is a non- resorptive phase where the osteoclast detaches from the bone surface and migrates to another area which is yet unresorbed (6). Osteoclasts have different membrane domains one of which is the ruffled border (RB). This domain is the resorbing organelle of osteoclasts which through exocytosis penetrates the bone matrix and the degradation products following this route is secreted to the extracellular space in the basolateral membrane (7). They also express enzymes such as TRAP and NADPH oxidase which generates reactive oxygen species (ROS) (8+9). ROS are molecules formed by oxygen reduction which gives these radicals at least one unpaired electron and makes them very reactive and chemically unstable. ROS includes for example superoxide, peroxides and hydroxyl radicals. They are involved in many different cellular functions such as cell proliferation, activation, growth inhibition and apoptosis (10). ROS is one factor which stimulates osteoclast differentiation and bone resorption in osteoclasts (10). RAW 264.7 are monocytic cells, which can either differentiate to osteoclasts or macrophages by using different stimulations. (11) The activation of macrophages can happen through two
different pathways: classical or alternative activation (12). In the classical activation, macrophages are induced by adding lipopolysaccaride (LPS), by which remaining
produce NO and oxygen-free radicals. In the alternative activation, where macrophages are induced with the action of interleukins such as IL-4 collagen production is induced (12). RAW cells will differentiate into osteoclasts when Receptor Activator for Nuclear Factor κ B Ligand (RANKL) is added to these cells (8)(Fig. 1)
Fig.1 Osteoclast differentiation steps with addition of RANKL.
Thioredoxins are important for the regulation of cellular redox status in bone and other tissues. Thioredoxin (Trx) and thioredoxin reductase (TrxR) is part of the thioredoxin system with NADPH also present. This system is present in all organisms from Archea to man (13). The sequence of Trx conserved active site is Cys-Gly-Pro-Cys and lies between the loop of the fifth beta-strand and the fourth Alfa-helix and through this site Trx acts as a protein-disulfide
reductase and therefore regulates different enzymes, receptors and transcription factors. Reduced Trx (Trx-(SH)2) becomes oxidized (Trx-S2) at reduction of a disulfide. The oxidized form of Trx
then becomes reduced by TrxR and NADPH (14) (fig.2)
Fig.2 The reduction of Trx by TrxR and NADPH (15)
Trx binds a substrate in the hydrophobic area that lies close to the conserved active site and thus creates a non-covalent binding between them (14). This binding close to the active site facilitate the redox reaction of Trx which acts as a hydrogen donor (13). In the reduced conformation Cys32 and Cys35 is further apart than in the oxidized form thus making more space and
therefore faciliate binding of substrate. The active site sequence for mammalian TrxR is Gly-Cys-SeCys-Gly, where SeCys is the unusual residue selenocysteine. This specific residue is essential for catalytic activity andmakes TrxR to have low substrate specificity (14).
Tartrate –Resistant Purple Acid Phosphatase (TRAP) is a glycoprotein (16). The cleaved form of TRAP consists of two subunits which is linked through a disulphide bond. TRAP is also referred to as mammalian PAPs, which contain a FeFe center in their active site. This binuclear iron center is located in a pocket on one of the edges of the sandwich, which consists of 2 beta-sheets with seven strands each and Alfa-helices on one of the sides of each sheet make up the enzymes 3D- structure. TRAPs physiological function is not yet known but in mammals TRAP is highly expressed in bone-resorbing osteoclasts in their later stages of differentiation (6) and in activated macrophages (16). TRAP can exist in two different states, either the inactive purple oxidized form or the active pink reduced state. In the inactive state the redox active iron is in ferric state and in the active state where this same iron is reduced to the ferrous state. When TRAP is in its active reduced state it can generate ROS through the Fenton reaction. In this reaction the ferrous iron reacts with hydrogen peroxide and produce very toxic hydroxyl radicals (9), ( Fig.3 step (8)) (17)
Fig.3 Fenton reaction, where the ferrous iron reacts with hydrogen peroxide and generates ROS. (17)
ROS which is generated from TRAP is capable of destroying the major bone matrix protein Collagen I. TRAP is localized in different compartments in osteoclasts or activated macrophages. In macrophages TRAP is found in the route for antigen presentation, which transports foreign material to the cell membrane for further presentation to cells of the immune system. In
osteoclasts TRAP is instead localized in specific vesicles which are involved in the transport of bone matrix to the secretory domain in the basolateral plasma membrane of epithelial cells (9). xc—system includes the xc- cysteine/Glutamate antiporter which mediates the uptake of Cystine and thereby exchange this for intracellular Glutamate. This xc- transporter is located in the
plasma membrane and consists of a heavy chain 4F2hc and the light chain xCT. The mechanism of this exchange of cystine to Glutamate happens inside the cell were cystine is rapidly reduced to cysteine (Fig.4) (18).
Fig.4 The extracellular reduction of Selenite is dependent on the xc- - antiporter by cystine uptake (20).
The aim of this project was to see if the redox environment of bone-resorbing osteoclasts is affected during differentiation of RAW 264.7 cells to osteoclasts and macrophages. The reason was that we aimed to see if RAW 264.7 cells could be used as an in vitro system to study the effects of redox changes in osteoclasts and macrophages and their activation. One sub aim was to stimulate these cells with RANKL and also treat them with DTT, DTNB, TCEP or Selenite and evaluate their effect on these cells during their differentiation to osteoclasts by using TRAP as a marker for differentiation to osteoclasts. The other sub aim was to treat RAW cells with
RANKL, LPS or IL-4 and to determine the total and reduced GSH/Cys levels in the intracellular or extracellular enviroment. The final sub aim was to determine how the redox associated genes Trx1 and TrxR1 expression on the mRNA level vary during differentiation to either
macrophages or osteoclasts.
5. Materials and methods
5.1 Thawing and expansion of RAW 264.7 cells
The RAW cells were stored in the -135ºC freezer and thawed at room temperature. Cells were added to Minimum Essential Medium Eagle (MEMeagle), to which 10% FBS, L-glutamine and Gentamicine were also added. The mixture with cells and medium was centrifuged at 12,000 rpm for 5 minutes. The concentrated cell pellet was resuspended in a T75 culture flask (Sarstedt) and incubated at 37 ºC for 3 days.
5.2 Counting of RAW 264.7 cells
After three days the cells were analyzed in a microscope to see if the cells had expanded. The old media was removed and new media was added to the flask. Cells were scraped and added to a plastic tube. The cells were counted in 4 squares of the Burker chamber by using a click counter. The total cellnumber used was 28,000 cells/ml. Cells were then seeded to 6-well plates
5.3 Stimulation of RAW 264.7 cells
5.3.1 RANKL stimulation of RAW 264.7 cells
RANKL (2ng/ml) was added to cells and medium. The cell suspension was mixed by flipping the tube a couple of times. The cell suspension was added to four 6-well plates. The plates were put in an incubator with a temperature of 37°C for two and four days.
5.3.2 LPS stimulation of RAW 264.7 cells
LPS (1 µg/ml), were added to cells and medium. Mixture was done by flipping the tube a couple of times. This cell suspension with LPS stimulant was added to four 6-well plates. Plates were incubated at 37 °C for 2 and 4 days.
5.3.3 IL-4 stimulation of RAW 264.7 cells
This stimulation was done in the same way as the previous two, except IL-4 (50 ng/ml) were added to the cell/medium mixture. Incubation at 37°C for 2 and 4 days was performed.
5.4 Harvesting of RAW 264.7 cells
5.4.1 Harvesting of cells for total RNA day 2 and 4
Total RNA was purified using RNeasy plus Mini Kit (Qiagen). The cells were controlled in a microscope to see if the cells had been affected by the stimulations. For each of the stimulation
the same procedure was done. The cells were first washed twice with PBS. Buffer RLT with the addition of β-ME was added to each well. The cells were then scraped with a plastic cell scrape and pipetted to a QIAshredder column. QIAshredder columns were centrifuged at maximum speed for 2 minutes in a table centrifuge and the flow through was saved and stored at -20°C until RNA purification.
5.4.2 Harvesting of cells for protein day 2 and 4
The cells was checked in a microscope and then washed with PBS as above. A mixture of homogenization buffer with one tablet Complete protease inhibitor (Roche)was made. This mixture was added to each well and the cells were scraped. The scraped cells were pipetted to an eppendorf tube and centrifuged at max speed for 10 minutes in a table centrifuge. The
supernatant was removed and added to new eppendorf tubes for storage at -20°C.
5.5 Determination of protein concentration
Protein concentration was determined using the Micro BCA Protein assay Kit (Thermo
scientific). To determine the volume of working reagent (WR) needed the following formula was used: (no. standards + no. unknowns)x(no. replicates)x(volume of WR per sample)= total WR required. 9 standard samples were prepared in the range of 200 µg/ml-10 µg/ml, 36 samples and 2 replicates. The WR is prepared by mixing 25 parts of reagent MA and 24 parts MB with 1 part of reagent MC according to protocol. Standards and sample (30 µg/well) were pipetted to the wells of the 96-well plate. The plate was covered with sealing tape and incubated for two hours at 37°C. The plate was then cooled to room temperature and the absorbance was measured at 562 nm in an ELISA reader (PowerwaveHT, BioTek) which also gives the concentrations in the samples.
5.6 Western blot
5.6.1 SDS-PAGE electrophoresis
First a 7.5 % SDS- PAGE gel was run with RAW cell protein lysate and a molecular weight ladder. 1x Running buffer was added to the gel “box” and the gel was then added and the stack-glass was removed from the wells of the gel. The wells were rinsed with 1x running buffer by pipetting up and down a few times in each well. The molecular weight ladder( Precision Plus
Protein Standards, BioRad) was pipetted to one of the wells and the samples together with sample buffer was loaded to the wells. This gave a concentration of approximately 30 µg protein in each well. The SDS-PAGE gel was run for about one hour at 200 V.
5.6.2 Transfer to membrane
The gel was removed from the protection glass and the wells were cut off from the rest of the gel. For the gel not to break when removing it from the glass it was put in transfer buffer on a shaking board. The gel was left in the transfer buffer with shake for 30 minutes. The filter papers were put in transfer buffer before assembling. The membranes were prepared for assembling by first let them soak in a methanol bath for 15 seconds and then a dH2O bath for 2 minutes and lastly in a bath of transfer buffer for 5 minutes. The assembly for the transfer is performed by adding three filter papers on the red bottom plate (+), the membrane is laid over the papers, the gel is laid on top of the membrane and three filter papers are laid over the gel. To ensure that no air bubbles were present the filter papers were rolled before the black top (-) was assembled to the transfer. The transfer was run for 45 minutes at 64 mA.
5.6.3 Antibody staining of membrane
The membrane is left in blocking solution over night. The primary antibody (xCT) with concentration of 1 µg/ ml(abcam) was incubated with the membrane for two hours at room temperature. The membrane was washed three times with PBST for 10 minutes each after the first incubation with antibody whereupon the secondary antibody (polyclonal swine antirabbit immunoglobulin HRP)(abcam) diluted 1:2000 was added. The membrane was left to incubate for one hour in room temperature. The membrane was yet again washed three times each with PBST for 10 minutes. The developing solution was prepared by mixing equal parts of Enhanced Luminol reagent Plus and oxidizing solution Plus (Western lighting Kit). The membrane was left to incubate for about 2 minutes in this developing solution at room temperature. After incubation the membrane was wrapped in plastic film to ensure the membrane was not dried up.
5.6.4 Development
The maschine FluorChem SP (AlphaInnotech) and the program Flourocamp was used for development of the blot. Chemiluminiscense with filter 1 was used. Overall a protocol was followed but most of the parameters were choosen by testing different adjustments on the machine to obtain the best picture.
5.7 Total RNA purification
The RNA was purified using RNeasy Plus Mini Kit (Qiagen). The homogenization of cells was performed during the harvesting step by adding the lysate into a QIAshredder column as described above. This homogenizated lysate was then transferred to a gDNA Eliminator spin column and centrifuged for 30 s at 10,000 rpm. The flow-through was saved and the column discarded. 70% ethanol was added to the flow-through and mixing was performed by pipetting up and down in the tube. In the next step of purification, the sample was transferred to an
RNeasy spin column that was placed in a collection tube. This was centrifuged for 15 s at 10,000 rpm. The column was saved and the flow through was discarded. The column was placed in the same collection tube as the previous step and Buffer RW1 was added. Centrifugation for 15 s at 10,000 rpm was performed to wash the column membrane. Again the flow through was
discarded and Buffer RPE (with ethanol added) was added to the column and centrifuged for 15 s at 10,000 rpm, to wash the spin column membrane. The flow through was discarded again and Buffer RPE was again added to the column. To ensure that the membrane was totally dry, centrifugation for 2 min at 10,000 rpm was needed. The RNeasy spin column was removed from the old collection tube and placed in a new one. To elute the RNA, RNase-free water was added to the column and centrifuged for 1 min at 10,000 rpm. The RNA concentration was measured by adding a small amount of each sample to the Nanodrop, which measures the absorbance at 260/280 nm which then gives the concentrations of the RNA.
5.8 Primer optimization of Trx1 and TrxR1
The primers were purchased from Cybergene AB. At a first attempt primers which already had been purchased were tested with the qPCR. The first step was to make stock solutions of each primer, to get appropriate working concentration. This was done by mixing the primers with nuclease-free water to a final concentration of 10 µM. The concentrations to be tested for the primers were 300/300, 300/900, 900/300 and 900/900 (nM) for each of the primers. Forward and reverse primers were mixed with 2*PCR mix and water according to protocol. The sample volume in each well of the 96-well plate was 10 µl. To determine the effectivity of the primers a standard curve were incorporated with cDNA from mouse spleen. The concentrations of the standard curve ranged from 20 ng/well – 0.15625 ng/well.
5.9 Primer design
Because the initial Trx1 primers did not give any useful results from the qPCR, new primers had to be designed. This was done by using the software program Beacon designer 3. The accession number from the BLAST search at the NCBI webpage was used. The program then searches for the best primer pair by comparing primers according to melting points, GC- content, hairpin loops and so on. At the BLAST search the gene of interest is checked to see the position of exons in the gene and this is to minimize the amplification of genomic DNA. Primers are chosen that spans over two exons. The primer sequences for Trx1, TrxR1, TRAP, Actin and xCT is shown in Table 1. Actin was used as the housekeeping gene in this project, which is used to normalize the genes of interest in order to approximate the amount of mRNA that is expressed for each of the genes during the amplification
Table 1- primer sequences
Primer name Forward Reverse
Trx1 TTTCCATCTGGTTCTGCTGAGAC CAGAGAAGTCCACCACGACAAG
TrxR1 CCATCCAGGCGGGGAGATTG GAGTAAACACAGTCGTTGGGACAT
TRAP GCTTTTTGAGCCAGGACAGC CAGCCCAAAATGCCTCCGA
Actin AAGACCTCTATGCCAACACAGTG CAGGAGGAGCAATGATCTTGATCT
xCT ACCTGCCTCTTCATGGTTGTC TGGTTCAGACGATTATCAGACAGA
5.10 cDNA synthesis using RT reaction
cDNA synthesis was performed using the Omniscript Reverse Transcriptase Kit. A master mix containing 1*RT buffer, dNTP mix (0.5 mM), Omniscript (4U) and oligodT primer (1 µM) was prepared and mixed with 2µg RNA and nuclease free water per reaction. Incubation for one hour at 37ºC.
5.11 Morphologic TRAP assay
RAW cells were thawed and expanded as previously described. The cells were seeded in two 24-well plates (day 0 and day 4) with a cell density 12,500 cells/ml and media. The MEMeagle media with cells was first mixed with either 2ng/ml RANKL or 1µg/ml LPS and added to the
wells. RANKL cells were then immediatly treated with DTT, DTNB, TCEP or selenite at final concentrations in each well of 50 µM, 100 µM, 50 µM and 0.5 µM respectively. The same was done for the wells that were stimulated with LPS. The negative control had only MEMeagle media in the wells and the positive control contained media plus either RANKL or LPS in the wells. The media was renewed on day two. TRAP staining was performed on day 4 using Leukocyte acid Phosphatase (TRAP) kit (Sigma-Aldrich). First Fast Garnet GBC Base Solution (7 mg/ml in 0.4 M HCl) were mixed carefully with Sodium Nitrate Solution (0.1 M) in an eppendorf tube. This was set aside for 2 minutes in room temperature. In a Falcon tube, dH2O with the temperature of 37 °C were mixed with the following solutions: diazotized fast garnet GBC solution (the mixture described above), Naphtol AS-BI Phosphate Solution (12,5 mg/ml), Acetate Solution (2.5M pH5.2) and Tartrate Solution. This mixture was prepared with stirring the whole time. The cells were then washed with 0.9 % NaCl and then fixed in formaldehyde solution (4 %) for 15 minutes at room temperature. After the fixation of cells, TRAP-solution were added to each of the wells and left at 37°C for approximately 1 hour. The plate was
checked every 15 minutes in the microscope, until satisfactory colour had developed in the cells. The staining was aborted by adding dH2O to each of the wells. The final step was to add
formaldehyde (4 %) to the wells again, which keep the cells preserved for a long time.
5.12 GSH and Cysteine determination in RAW cells 5.12.1 Reduced form of Glutathione and Cysteine
The cells were seeded in 6-well plates. After 2 days the media was removed and PBS were added for the intracellular determination and media were added for the extracellular determination. In each well 8 mM mBrB was added and was set to incubate at room temperature for 2 minutes. The reaction was stopped by adding 80% SSA to each well. The wells were then scraped and the sample was collected in eppendorf tubes. Centrifugation of these tubes was done to get a pellet of any precipitated protein, whereas the supernatants were measured with HPLC (19).
Centrifugation was done for 3 minutes at 3000xg. The samples were stored at -70˚C. The same procedure was used for day four cells.
5.12.2 Total form of Glutathione and Cysteine
As described above, cells were also seeded in 6-well plates. After 2 days the media was removed and PBS containing 50 mM DTT was added to each of the wells for the intracellular assay. For
the extracellular assay media containing 50 mM DTT was instead added to new wells. The plates were incubated in room temperature for 30 minutes. 20 mM mBrB were added to each well and the plates were incubated in the dark for 10 minutes at room temperature. The reaction was then stopped by adding 80% SSA. The cells were scraped from the wells and collected in eppendorf tubes. After centrifugation for 3 minutes at 3000xg both the pellet and the supernatant were saved and stored at -70˚C.
5.13 xTT- viability assay
RAW cells were first thawed and expanded by adding cells to a Falcon tube and suspended with MEMeagle media. The tube was then centrifuged for five minutes at 12,000 rpm to obtain a concentrated pellet of cells. The pellet was resuspended and added to a T75- flask and left in the incubator for three days at 37ºC. After three days the old media was removed and new media was added, after which the cells were removed from the flask with a cell scrape. The different treatments and concentrations to be tested with RAW cells were DTT (50 and 25 µM), DTNB (50 and 25 µM), TCEP (50 and 25 µM), Selenite (1 and 0.5 µM) and Glutamate (60, 30 and 15 mM). Each treatment and concentration was seeded to four wells in a 96-well plate. A control with only RAW cells and media were also included. The plate was put in an incubator for five days at 37ºC, and the media was renewed day two. At day five the xTT- Cell Proliferation Kit II (Roche) were used. xTT labeling reagent were mixed with Electron coupling reagent. This mixture was added to each of the wells in the 96-well plate. The plate was put in an incubator for two hours at 37 ºC. After two hours the absorbance at 470 nm was determined by using an ELISA-reader. The control should have an absorbance of approximately 1, otherwise longer incubation is needed.
6. Results
6.1 Primer design and optimization
The determination of primer annealing temperature (Table 2) was performed using a gradient program in the qPCR. Both Trx1 and TrxR1 showed best optimization with the temperature 60 ºC and for xCT this temperature was also 60 ºC. TRAP and Actin primer pairs had already been optimized before.
Table 2 Primer pairs and their annealing temperatures Primer name Annealing temperature (ºC) Trx1 60 TrxR1 60 TRAP 62 Actin 62 xCT 60
The design of xCT and Trx1 primer pair was performed using the program BeaconDesign3 which suggested two pimer pairs spanning over exon-exon junction with good grading according to the recomendations from the program for a good primer pair. Optimization of these primers was carried out using real time qPCR. A standard curve of different concentrations of cDNA was included as a control for the determination if amplification of cDNA has doubled in each of the cycles in the qPCR The optimization showed that maximal amplification was achieved with the concentrations of 300/300 nM for Trx1, 900/900 nM for TrxR1 and for xCT the concentration which gave maximum amplification was 900/300nM. The melt curves for Trx1 and TrxR1 is shown in (Fig. 5 and 6), were also the standard curves shows the efficiency for the both primer pairs. Efficiency for Trx1 was 98.9% and for TrxR1 this value was 98.3%.
A.
B.
Fig. 5 Optimization data for the Trx1 primer pair. The concentration of both forward and reverse primer was 300nm. A. Melt curve for Trx1showing a peak at 87ºC. B. Standard curve showing an
efficiency of 98.9%
B.
Fig.6 Optimization data for the TrxR1 primer pair. The concentration of both forward and reverse primer was 900nm. A. Melt curve for TrxR1showing a peak at 82ºC. B. Standard curve showing an
efficiency of 98.3%
6.2 The effect of redox modulation on osteoclast and macrophage differentiation
In an attempt to see if the intracellular or the extracellular redox environment of RAW 264.7 cells was affected during differentiation to osteoclasts and/or macrophages and by the precence of redox modulators, the enzyme TRAP was selected to use as a marker for differentiation. Results from the morphological TRAP assay shows that after the staining of cells the differentiation to osteoclasts worked as seen in (Fig.7) where one can detect multinuclear osteoclasts stimulated with only RANKL where some of them are TRAP positive as can be seen from their purple/brown colour and also multinuclearity.
Fig.7 Stained day 5 RAW cells stimulated with RANKL.
The treatment of differentiating cells stimulated with RANKL with DTT gave smaller and more rounded osteoclasts than the control (Fig. 8A). The cells treated with TCEP (50 µM) did not give as many large multinuclear osteoclasts, but instead small mononuclear cells that were TRAP positive was observed (Fig. 8B) Cells treated with Selenite (0.5 µM) as can be seen from (Fig.8C) gave a few multinuclear osteoclasts that were weakly TRAP positive and some
mononuclear cells that were weakly TRAP positive. Almost all cells died when stimulated with DTNB (100 µM) as can be seen in (Fig.8D). The only cells surviving were some at the edges of the well and these did not look like the other cells but were deformed.
A. B.
C. D.
Fig.8 Comparison of TRAP stained RANKL stimulated RAW cells day 5 A. Cells treated with DTT (50
µM). B. Cells treated with TCEP (50 µM). C. Cells treated with Selenite (0.5 µM) and D. treatment with DTNB (100 µM)
The cells stimulated with LPS did not show any or a little differentiation towards macrophages (Fig.9). In the control well (Fig.9A) one large multinuclear TRAP negative macrophage can be
seen, but after stimulation with LPS the majority of the cells should have this appearance. So from these results we can probably conclude that differentiation with LPS did not work as expected. From the different treatments with redox modulators a few multinuclear cells could be detected, but not nearly as many to make any conclusions. Also for this part of the assay, the cells treated with DTNB (100µM) did not survive.
A. B.
C. D.
Fig.9 LPS stimulated day 5 RAW cells. A. Showing the control, B. Showing cells treated with DTT (50
µM), C. Cells treated with TCEP (50 µM) and D. shows cells treated with Selenite (0.5 µM)
To see if the selected concentrations of the different treatments (DTT, TCEP,DTNB and
Selenite) were appropriate for cell survival an xTT- viability assay was done. This assay showed that all the concentrations used allowed cells to survive exept for the highest concentration of DTNB where all the cells died, (Fig.10). From this assay we can see that probably the maximum concentration to be used for DTNB were (50 µM) as seen from the absorbance that were little over one which is a value that indicates many live cells.
0 0,2 0,4 0,6 0,8 1 1,2 1,4 1,6 1,8 2 ko ntroll DTT 50 µM DT T 25 µM DTNB 50µM DT NB 25µM TC EP 50 µM TCE P 2 5µM Se leni t 1µM Se len it 0. 5µM glu tam at 60 mM glu tam at 30 mM glu tam at 15 mM behandling Abs o rb an s 47 0n m
Fig.10 xTT-viability assay. The control shows an absorbance of approximately 1, which indicates many
live cells. The other concentrations show values higher than one except Glutamate 15mM, stating that many cells survive at these concentrations.
Calculations of TRAP positive and multinuclear cells (Table 3) were performed in the microscope where the mean value of two wells were calculated for the controls. The treated cells were only in one well each so here the absolute value for TRAP positive and total multinuclear cells was calculated.
Table 3. Number of total multinuclear and TRAP positive multinuclear cells
Total multinuclear TRAP positive multinuclear
RANKL 18 11 RANKL + DTT 25 18 RANKL + TCEP 10 5 RANKL + Selenite 8 1 LPS 2 1 LPS + DTT 1 0 LPS + TCEP 6 2 LPS + Selenite 0 0
6.3 Characterization of redoxsystems
The western blot demonstrated that xCT expression was up regulated with stimuli of LPS and downregulated with RANKL (Fig. 11) relative to the control.
3 4 5 6 7 8 9 10 11
Fig.11 Western blot of xCT for day 5 RAW 264.7 cells , where wells 3-5 show RAW 264.7 cells stimulated
with RANKL, wells 6-8 cells stimulated with LPS and the control are wells 9-11.
From the GSH/Cys assay we can see that the treatments them self did not affect the levels of GSH and Cys to a measurable extent (Fig. 12). However the levels increased intracellularly for both GSH and Cys total forms at day 4 in the control and treated cells. From (Fig. 12B) we see that the levels of total GSH extracellularly is markedly increased for day four cells compared to day two which indicates that the majority of cells are in an oxidized state which is an important mechanism of differentiation. If we compare this with (Fig.12D) we see here that Cys total levels are relatively constant through out the differentiation period. LPS also seem to have a tendency to increase both intracellular and extracellular GSH relative to control cells (Fig.12 A and B)
A. 0 50 100 150 200 250 300 350 Cont rol RA NKL LPS IL-4 Co ntrol RA NKL LPS IL-4 Reduced Total G S H /GS S G i n tr a. co n cen tr ati o n (µ M ) Day 2 Day 4 B. 0 5 10 15 20 25 30 35 Kont roll RANK L LPS IL-4 Kont roll RANK L LPS IL-4 Reducerat Totalt GS H /G S S G ext ra . co n cen tr at io n (µ M ) Dag2 Dag4
C. 0 100 200 300 400 500 600 700 Cont rol RA NK L LPS IL-4 Cont rol RA NK L LPS IL-4 Reduced Total C yst ei n e /C ys ti n e i n tr a co n cen tr at io n ( µ M ) Day 2 Day 4 D. 0 50 100 150 200 250 300 350 400 450 Kont roll RA NK L LPS IL-4 Kont roll RAN KL LPS IL-4 Reducerat Totalt Cys te in e /C ysti n e ex tr a. c o n c en tr ati o n (µ M ) Dag2 Dag4
Fig.12 HPLC analysis of total and reduced GSH/Cys. blue bars show day two cells and purple bars show day four cells. A. Intracellular levels of Gluthatione, reduced and total form. B.
Extracellular levels of Gluthatione, reduced and total form. C. Intracellular levels of Cysteine and D. Extracellular levels of Cysteine reduced and total form.
The effect of RANKL, LPS or IL-4 on mRNA expression of Trx1, TrxR1 and TRAP in RAW 264.7 cells is shown in Fig.13. From (Fig.13) we can see the expression of Trx1 divided in two different experiments. By comparison of the two first diagrams Fig.13 A and B) results show that there is a slight up regulation of Trx1 for day 4 cells compared to day 2 with stimulation of both RANKL and LPS. From the second experiment (Fig.13C) similar tendencies was observed that an up regulation of Trx1 expression occurred with RANKL and LPS for day 4 compared with day 2. The result does not however show an up regulation of Trx1 expression with RANKL and LPS compared to control in either of the two experiments. We can also see a slight up regulation of Trx1 for cells stimulated with IL-4 compared to control (Fig. 13A).
A. 0 0,5 1 1,5 2 2,5 3 3,5 4 kont roll d2 RANK L d2 LPS d 2 IL‐4 d 2 stimulering re la ti v sk illna d Serie1 B. 0 1 2 3 4 5 6 Erik k ontro ll d4 Erik R ANK L d4 Erik LPS d4 stimulering re la ti v sk illn ad Serie1 C. 0 1 2 3 4 5 6 7 ex3 kont roll d 2 ex.3 rank l d2 ex.3 lps d 2 ex.3 kont roll d4 ex.3 rank l d4 ex.3 lps d 4 stimulering rel at iv s kill n ad Serie1
Fig.13 Trx1 expression in RAW 264.7 cells stimulated with RANKL, LPS or IL-4. The control represent cells without stimulant. A. Comparison of stimulated cells day 2.B. Comparison of stimulated
cells day 4 from Erik. C. Experiment two were day 2 and day 4 were compared.
The results from TrxR1 expression show that there also here was an up regulation with both RANKL and LPS at day 4 compared to day 2 cells (Fig. 14A and B) in the first experiment. Compared to the control day 2 both RANKL and LPS gave an up regulation, but for day 4 cells there was only an up regulation compared to the control for LPS and down regulation of TrxR1 with RANKL stimulation. However in the second experiment (Fig.14C) an up regulation for RANKL was seen at day four compared to day 2 cells. For LPS there was a marked down regulation of TrxR1 expression. In the second experiment there was a down regulation for both RANKL and LPS compared to control for day 4 cells. From (Fig.14 A) a down regulation of TrxR1 expression for day 2 cells stimulated with IL-4 was observed.
A. 0 0,2 0,4 0,6 0,8 1 1,2 1,4 1,6 kont roll d 2 RANK L d2 LPS d2 IL‐4 d 2 stimulering rel at iv sk illn ad Serie1 B. 0 0,5 1 1,5 2 2,5 3 3,5 Erik kont roll d 4 Erik RAN KL d 4 Erik LPS d4 stimulering rel at iv sk ill n ad Serie1 0 0,5 1 1,5 2 2,5 3 3,5 ex3 kontr oll d 2 ex.3 rankl d2 ex.3 lps d 2 ex.3 kont roll d4 ex.3 rank l d4 ex.3 lps d4 stimulering rel at iv sk illn ad Serie1 C.
Fig.14 TrxR1 expression of RAW 264.7 cells stimulated with RANKL, LPS or IL-4. Control represent cells without stimulant. A. Day 2 cells from the first experiment. B. Day 4 cells from the first
experiments, cells courtesy of Erik Karlström. C. Comparison of cells from both day 2 and day 4 cells from the second experiment.
TRAP expression in these cells stimulated with RANKL, LPS or IL-4 (Fig.15) shows that there is up regulation for day 2 cells in the first experiment (Fig.15A) and down regulation of TRAP for the day 4 cells compared to day 2, but slight up regulation compared to day 4 control (Fig.15B). In the second experiment (Fig.15C) we can see a marked decrease in TRAP
expression with LPS stimulation comparing day 2 and day 4 cells. The results here also shows that there is no effect on the TRAP mRNA expression in RANKL stimulated cells when
comparing day 2 and day 4 cells. IL-4 stimulated cells (Fig.15A) here gives a down regulation of TRAP.
A. 0 0,2 0,4 0,6 0,8 1 1,2 1,4 kont roll d2 RANK L d2 LPS d2 IL‐4 d 2 stimulering re la ti v sk illn ad Serie1 B. 0 0,05 0,1 0,15 0,2 0,25 Erik kont roll d4 Erik RANKL d4 Erik LPS d 4 stimulering rel at iv sk ill n ad Serie1 0 0,2 0,4 0,6 0,8 1 1,2 1,4 1,6 1,8 2 ex3 kontr oll d 2 ex.3 rankl d2 ex.3 lps d 2 ex.3 kont roll d4 ex.3 rank l d4 ex.3 lps d4 stimulering rel at iv sk illn ad Serie1 C.
Fig.15 TRAP expression in RAW 264.7 cells stimulated wit RANKL, LPS or IL-4. Control represent un stimulated cells. A. day 2 cells from the first experiment. B. Eriks day 4 cells in the first experiment. C. Second experiment comparison of day 2 and day 4 stimulated cells.
7. Discussion
The results from design and optimization of primer pairs in qPCR showed an efficiency of 98.9% and 98.3% for Trx1 and TrxR1 respectivly. From the melt cuves of these primer pairs only one peak could be seen which indicate that only the gene of interest was amplified. Although multiple peaks were not noted in the melt curves there can still be other genes detected with the same melt temperature that is hidden in the peak of the specific gene. For the xCT primer pairs, from own data not shown in this study, earlier optimization of these primers only gave one peak in the melt curve and that the efficiency was close to the values for Trx1 and TrxR1. To be absolutely sure no other products has been amplified an agarose gel electrophoresis can be performed to determine if the amplified PCR fragment has the expected size and ideally sequence the entire fragment. Due to time limitations this was not performed.
To analyze if the intracellular or the extracellular environment of RAW cells was affected during differentiation to osteoclasts and/or macrophages in the presence of redox modulators such as DTT and TCEP, a morphological TRAP assay was done. This assay first showed that the differentiation to osteoclasts was accurate when stimulated with RANKL, but the differentiation to macrophages when stimulated with LPS did not yield many multinucleated cells. The different treatments with redox modulators in the presence of RANKL did not show any clear cut changes in cell numbers probably because the number of cell samples counted was too low, but
indications that differentiation of RAW 264.7 cells by RANKL are affected by redox
modulators could be observed by microscopy after staining for TRAP. Osteoclasts formed in the presence of DTT were smaller and more round than the untreated cells. Since DTT freely penetrates cell membranes, the impermeable reducing agent TCEP was used to discriminate whether the effect of thiol reduction was acting intra-or extracellularly. The TCEP treatment gave more smaller mononuclear TRAP-positive cells, probably unfused pre-osteoclasts, than untreated cells. The more pronounced effect with TCEP compared to DTT suggests that extracellular rather than intracellular thiols are involved in the inhibitory effect on osteoclast differentitation. Selenite treatment showed that the cells were not as TRAP positive as for the other treatments. Obviously this assay need to be repeated, because I had a lot of problems getting the differentiation to work as expected which is critical for this project. For example, a
new batch of RAW 264.7 cells with lower passage number should have been tried. New lots of RANKL and LPS for stimulation of differentiation would also be possible to try.
Results from the GSH/Cys assay showed that the treatments with redox modulators did not affect the levels of total GSH and Cys to a measurable extent. However the levels increased for both intracellular and extracellular oxidized GSH and Cys forms at day 4 in both the control and stimulated cells.The results from the GSH/Cys assay has not yet been confirmed for RAW 264.7 cells, so this assay needs to be repeated before anything definitive can be concluded about this result. Although when this assay has been performed on other cells than RAW cells the results here differ from those cells so it would be quite interesting to repeat the GSH/Cys assay on RAW cells as well as on a different cell line run in parallel.
Western blot showed that xCT is up regulated when stimulated with LPS and down regulated when stimulated with RANKL. The result that LPS up regulates xCT has previously been shown at the mRNA levels (21), but that a corresponding increase in xCT protein after LPS stimulation has not previously been published. Neither has the reduction of xCT protein by RANKL been previously demonstated, but is in agreement with data from the lab showing that xCT mRNA was undetectable in RANKL-differentiated RAW 264.7 osteoclast-like cells compared to
unstimulated cells.(Kevin Egan, personal communication). Since the xCT transporter provide the dithiol cystine for intracellular reduction to the free monothiol cysteine (18) for subsequent transport to the extracellular environment, down regulation of the xCT transporter could be an important mechanism to maintain a low level of free thiols shown in this study to interfere with the differentiation to osteoclasts.
Results from the qPCR for Trx1 showed a great variation between the two different experiments. In principle they contradict each other in regard to whether there is an up- or down- regulation in the expression of Trx1 after stimulation with RANKL and LPS. This contradiction was also seen in the qPCR results were expression of TrxR1 and TRAP was analyzed. This variation can depend on several different factors, but the main problem was probably that the differentiation did not work in this specific experiment. This conclusion is drawn because of the unexpected
results from TRAP expression which is usually used as a control to verify that differentiation has worked properly, and expected to increase 5-10-fold by day 4.
In conclusion, this study indicate that an oxidized environment is promotive for osteoclast differentiation and that this redox balance is partly controlled by regulation of the dithiol transporter xCT.
8. Acknowledgments
First I would like to thank my supervisors Aristi Fernandes and Pernilla Lång for excellent teaching and answers to all my questions throughout this project. Thanks for all the positivity and help whenever I needed it.
I would also like to thank Mikael Björnstedt and his group, especially Lisa Arodin for her patience while showing me new methods and Inma Ribera for providence of materials and protocols.
Thanks to Erik Karlström for providing me with cells and sharing his RNA when mine did not work. I also want to thank Carolina Wejheden and Christina Patlaka for their assistance in the lab whenever I asked.
9. References
(1) Kim H, Kim I Y, Lee S O, Jeong D (2006) Bimodal actions of reactive oxygen specis in the differentiation and bone-resorbing functions of osteoclasts. FEBS letters 580, 5661-5665 (2) Vené1 R, Delfino L, Castellani P, Balza E, Bertolotti M, Sitia R, Rubartelli A (2009) Redox remodeling allows and controls B cell activation and differentiation. Not yet published.
(3) Schafer F.Q, Buettner G.R (2001) Redox environment of the cell as viewed through the redox state of the glutathione disulfide/glutathione couple. Free radical biology and medicine, vol. 30, no. 11, pp. 1191-1212
(4) Minkin C (1982) Bone acid phosphatise: Tartrate- resistant acid phosphatise as a marker of osteoclast function. Calcified tissue international, 34:285-290
(5) Quinn J M.W, Gillespie M T (2005) Modulation of osteoclast formation. BBRC. 328, 739-745
(6) Ek- Rylander B, Andersson G (2010) Osteoclast migration on phosphorylated osteopontin is regulated by endogenous tartrate-resistant acid phosphatase. Experimental cell research 316, 443-451
(7) Halleen J.M, Räisänen S, Salo J.J, Reddy S.V, Roddman D.G, Kaija H, Vihko P, Väänänen K.H (1999) Intracellular fragmentation of bone resorption products by reactive oxygen specis generated by osteoclastic tartrate- resistant acid phosphatise. The journal of biological chemistry, vol. 274, no. 33
(8) Lean J M, Jagger C J, Kirstein B, Fuller K, Chambers T J (2005) Hydrogen peroxide is essential for estrogen-deficiency bone loss and osteoclast formation. Endocrinology. 146(2): 728-735
(9) Kaija H, Alatalo S. L, Halleen J.M, Lindqvist Y, Schneider G, Vääänänen K.H, Vihko P (2002) Phosphatase and oxygen radical- generating activities of mammalian purple acid phosphatase are functionally independent. Biochemical and biophysical research communications, 292, 128-132
(10) Xu Y, Morse L.R, Bezerra da Silva R.A, Odgren P.R, Sasaki H, Stashenko P, Battaglino R.A (2009) PAMM: A redox regulatory protein that modulates osteoclast differentiation. Not yet published.
(11) Lean J, Kirstein B, Urry Z, Chambers T, Fuller K (2004) Thioredoxin-1 mediates osteoclast stimulation by reactive oxygen specis. BBRC
(12) Classen A, Lloberas J, Celada A (2009) Macrophage activation: Classical vs. alternative. Macrophages and dendric cells, Methods in molecular biology. Vol. 531
(13) Arne´r E, Holmgren A (2000) Physiological functions of thioredoxin and thioredoxin reductase. Eur. J. Biochem. 267, 6102-6109
(14) Pekkari K, (2001) Human truncated Thioredoxin(Trx80) as a novel mitogenic cytokine for white blood cells
(15) (http://www2.biocentrum.dtu.dk/dk/research/bng/Figure1.jpg)
(16) Ljusberg J, Ek-Rylander B, Andersson G (1999) Tartrate-resistant purple acid phosphatise is synthesized as a latent proenzyme and activated by cysteine proteinases. Biochem J. 343, 63-69 (17) http://ehp.niehs.nih.gov/realfiles/members/1998/106p375-384kelly/kellyequ7-8.GIF)
(18) Lo M, Ling V, Wang YZ, Gout PW (2008) The xc- cystine/glutamate antiporter: a mediator of pancreatic cancer growth with a role in drug resistance. British Journal of Cancer, 99, 464 – 472
(19) –Luo JL, Hammarqvist F, Andersson K, Wennerman J (1998) Surgical trauma decreases gluthatione synthetic capacity in human skeletal muscle tissue. Am J Physiol 275:E359-365 (20) Selenius M, Rundlöf A-K, Olm E, Fernandes A, Björnstedt M (2010) Selenium and the selenoprotein thioredoxin reductase in the prevention, treatment and diagnostics of cancer. Antioxidants & redox signalling, vol. 12, no.7
(21) Taguchi K, Tamba M, Bannai S, Sato H. (2007) Induction of cystine/glutamate transporter in bacterial lipopolysaccharide induced endotoxemia in mice. Journal of inflammation , vol.4, no.20
