Invasion of Babesia microti in NortheasternUSAYuchen(Lucy) Liu

(1)

Invasion of Babesia microti in Northeastern USA

Yuchen(Lucy) Liu

Degree project inbiology, Master ofscience (2years), 2012 Examensarbete ibiologi 45 hp tillmasterexamen, 2012

Biology Education Centre, Uppsala University, and School of Public Health, Yale University, USA Supervisors: Maria Diuk-Wasser and Alexander Eiler

External opponent: Ioana Onut Brännström, Jürg Brendan Logue

(2)

0

Adult ticks feed mainly on white-tailed deer (Odocoileus virginianus). This disease is hard to diagnose because of its unclear symptoms and low index of suspicion. This study is in attempt to study the ecology of Babesia microti, determine the patterns of nymphal infection prevalence and the relationship between Babesiosis and Lyme disease caused by Borrelia burgdorferiwhich shares the same vector with B. microti. Five sites in Connecticut were sampled and tested by traditional PCR for B.burgdorferi prevalence and quantitative PCR for B.microti prevalence.

Tick density was sampled by a dragging technique. The prevalence of B. microti appeared to be lower compared to B.burgdoferi; however, a large increase in prevalenceof B.microtibetween the sampling years was clearly observed. In addition, prevalence of B.microti can be detected before human cases were reported in new emerging areas. These results suggest that Babesiosis is expanding slowly, and has the potential to spread as far as Lyme disease. Therefore, it is important to raise more awareness to the general public and physicians in order to successfully control the disease.

INTRODUCTION

Life cycle of Babesia microti

The discovery and naming of the genus Babesia was established at the end of the 19^th century.In Romania, Babes first discovered micro-organisms in erythrocytes from Redwater fever infected cattle(Babes 1888). In 1983, Starcovici found similar parasites infevered cattle in Texas, USA, and named them Babesia bovis, Babesia ovis and Babesia bigemina

respectively(Starcovici1893). This appeared to be the firsttransmission of a protozoan parasite transmitted onto an arthropod (Smith and Kilbourne 1893). Babesia microti is a protozoal parasite in the family of Babesiidae, order of Piroplasmorida (Levine 1971). B. microti is ingested, when a tick takes a blood meal from an infected vertebrate host. Insidethe tick, the parasite develops into Strahlenkorper or ray bodies, an arrowhead-shaped organelle that fuses into a zygote during the tick's molting time which is usually within 14 to 18 days after feeding.

The zygote then reproduces asexually within the salivary gland of the tick. Further, the parasite expands to fill the hypertrophied host cells to form a sporoblast, a three-dimensional meshwork, where sporozoites can develop and bud off. The development of sporozoites inside the

sporoblast will only occurs after the tick has started to feed again. Finally, mature sporozoites (approximately 2.2 by 0.8 µm) are formed. A single sporoblast can form approximately 5,000 to 10,000 sporozoites (Mehlhorn and Shein1984). Because most of the sporozoites accumulate around the tick's mouth, the length of the attachment time affects the transmission rate between ticks and vertebrate hosts greatly. It has been proven that when ticks are allowed to feed to repletion, the infection rate reaches 100% (Piesman et al. 1987). Inside the vertebrate host, the sporozoites are transmitted to the host when the tick feeds on them. Transmitted sporozoites enter the host'serythrocytes by invagination and begin the process of infection. Inside

(4)

2

erythrocytes, sporozoites become trophozoites and reproduce asexually. Eventually, this leads to cell lysis and additional erythrocytes infection (Rudzinska et al. 1976). Figure 1 illustrates B.microti infected erythrocytes on stained blood smears.

Transmission hosts

The agent of human Babesiosis, B.microti, is transmitted by the black-legged tick(Ixodes scapularis),the invertebrate vector,andwhite-footed mouse(Peromyscus leucopus),the most competent vertebrate host (LoGiudice et al. 2003). I.scapularishasfour life stages (egg, larval, nymph, and adult). During its life time, approximately two years, female ticks have three blood meals while male ticks have two. Larval and nymphal ticks wait on top of leaf litter or low vegetation to grab onto passingvertebrate hosts. Adult ticks wait on taller vegetation and quest almost exclusively on deer (Randolphet al.1996). Feeding period of larval and nymphal ticks peak at early and late summer, and at late spring to midsummer respectively. Adult ticks feed during early fall and again in the spring if they did not feed in the fall (Nefedova et al. 2004, Wilson and Spielman 1985). Ticks are restricted to locations where the climate is suitable for completion of their life cycle, and any climate changes will shift their questing activity which would alter transmission rate, disease risks pattern, and human Babesiosis distribution. It is demonstrated that host-seeking phenology is strongly affected by temperature and precipitation.

For example, duration of peak questing activity is positively related to precipitation and

negatively related to air temperature in April to May(Eisenet al. 2002, Eisen et al. 2003, Eisen et al. 2004, Sonenshine 1993). It has also been shown that the peak period was 82% longer in cooler, coniferous locations compared to warmer, drier oak woodland areas (Eisen 2002, Eisen et al. 2003, Eisen et al. 2004, Sonenshine 1993).

Figure 1. Presentation of infected B.microti red blood cells (Centers for Disease Control and Prevention [CDC]), 2012)

(5)

3

The distribution of B.microti not only depends on local tick feeding areas, but also on host reservoirs. There are three categories of infectible hosts. First, species that do not develop systemic infections(infection in which the pathogen is distributed throughout the body rather then being concentrated in one areaand it is therefore insufficient at transmitting the disease to ticks (Randolph et al. 1996). Depends on where the tick bite, it may or may not become infected.

For example, deer and sheep do not develop systemic infections; however they are still part of the parasites transmission cycle. Second, species develop systemic infections but transmit disease primarily via non-systemic transmission. This means the host develops the infection throughout the whole body; however the tick only bites on a specific part of body. This is the case with laboratory mice infected with B.burgdoferi. Third, species can develop such high virus-induced infections, the host may die before it can transmit disease (Randolph et al. 1996).

For instance, 80% of grouse infected with the louping ill (LI) virus die (Reid 1984). Therefore, not all vertebrate hosts are competent hosts.For example, while 40.9% (660 cases) of white- footed mouse were infected with B.microti, only 21.2% (85 cases) of meadow vole (Microtus pennsylvanicus) and 3.8% (26 cases) of cottontail rabbit (Sylvilagus floridanus)were infected with the same parasite (Spielman et al. 1981).In addition, more ticks vectors were found attached to white-footed mouse than any other small mammals (Piesman and Spielman 1980). White- footed mice are suggested to be the primary vertebrate host since they are the most abundant small mammals found in the preferred habit and show the highest infection rate. Studies have also shown that white-footed mouse do not develop a high resistant to ticks (Trager 1939), and immature ticks have been found to increase their molting rate and delay their repletion time when feeding on mice (Hu et al. 1997). Enhanced molting rate would shorten the time between life stages of the tick, thus increase tick population and transmission efficiency. Delayed repletion time would allow tick to feed more blood which might increase the success of reproducing next generation. Hence, it helps increase transmission rate.

Babesia in the World

Since the 19th century, babesiosis has become a well recognized disease in cattle, horses, dogs and gradually in humans. First European case of human babesiosis caused by Babesia bigemina occurred in Yugoslavia in 1957 (Skrabalo and Deanovic 1957). Since then, 31 more human cases have been reported and more than half of the cases are from France and British Isles. However, this observation is mostly due to the high awareness of local physicians than actual infection prevalence (Gorenflot et al.1998). In the case of B.microti, human cases are identified only based on morphological characteristics and antigenic reactivity. This is interesting because B.microti has been reported as a rodent parasite in England, Poland, and other parts of Europe. The fewer human Babesiosis cases in Europe compared to America can be explained by the fact that the tick vector-Ixodes trianguliceps does not bite humans easily (Randolph 1975) or that the European strain of the parasite is not as pathogenic to humans as the one found in eastern USA (Telford III and Spielman 1997). In 1969, the first human Babesiosis case was reported on Nantucket Island, eastern USA.B.microti was identified as the bacterial parasite (Western et al.1970), and since then, more than 300 cases were reported (M. Diuk-Wasser, personal communication, Dec 10^th 2011).Human Babesiosis caused by B. microti is harder to detect because of its wide range of clinical manifestations which include fever, chills, myalgia, fatigue,

(6)

4

hepatosplenomegaly and hemolytic anemia (Pfeiffer et al. 2007). Symptoms such as nausea, emesis, night sweats, weight loss and hematuria are also common and thought be to associated with high parasitemia (Benach and Habicht 1981). The incubation period of the disease in

humans can ranges from 1 week to 3 months (Horner et al. 2000) which adds more difficulties to clinical diagnosis. When humans are infected, there is a 5% case fatality rate in USA (Telford and Maguire 1999) and 42% case fatality rate in Europe (Gorenflot et al. 1998).

At the same time, coinfection with other parasites adds more difficulties in B.microti researches.

In California, Wisconsin and northeastern USA, Ixodes ticks are conifected with B.burgdorferi, Anaplasma phagocytophilum, and B.microti. The highest coinfection prevalence with two pathogens ranges from 1.0 % to 28.2% (Table 1).In Europe, coinfection with two pathogens is less than 13.4% (Table 1). Coinfection createsa more complex problem because the tick can be infected with multiple parasites and the prevalence rate of one parasite can influence the prevalence rate of another parasite. The closest disease to human Babesiosis is Lyme disease because it shares the same vectors and geographical ranges. Lyme disease is a vector-borne illness caused by B.burgdorferi, a spirochetal pathogen and is transmitted by the same vectors as human Babesiosis. B.burgdoferi is transmitted to humans through the bite of tickwithin 36-48 hours of attachment. A classical sign of Lyme disease is a bulls-eye rash and antibiotics usually can clear the infection. However if it is not diagnosed, the infection can develops into arthritis, muscle pain, heart disease, brain and nerve disorders which are fatal to human health (LoGiudice et al. 2003). Studies have shown that Lyme disease has increased 20 fold since 1982 with more than 30,000 cases being reported annually. B.microti is expanding more slowly into the

previously established B.burgdorferi-endemic areas (northeastern USA). B.microti infection has been found to strongly correlate with B.burgdorferi infection in the Upper Midwest area of USA (Hofmeister et al. 1998). However, the relationship between the two diseases is not clear.

(7)

5

Because human Babesiosis doesnot have clear symptoms and is less known by the general public compared to Lyme disease, it is important to assess the distribution of the disease and predict future trends to educate government officials and general public in order to develop more appropriate prevention plans. In this study, I compare nymphal infection prevalence of both pathogens in 2007 and 2009 to 2011 and determine what factors influence pathogen infection prevalence the most via logistic models.

We hypothesizedthat the infection prevalence of B.microti is lower compared to B.burgdorferi because it has lower transmission efficiency. Field work was carried out in five different sits of Connecticut, USA between May and August in 2011. Tick density was obtained by counting the number of ticks from dragged transects. In this study, I also included ticks from 2007, 2009 and 2010. Infection prevalence rate of B.burgdorferi and B.microti was determined by using PCR and qPCR assays respectively. We compared these measurements to determine the patterns of nymphal infection prevalence and the relationship between Lyme disease and human Babesiosis.

Aims

1. Determine patterns of nymphal infection prevalence of B.burgdorferi and B.microti and co-infection

2. Determine what factors affect infection prevalence via logistical model

MATERIALS AND METHODS Study sites

Host seeking I. scapularis nymphs were sampled in 2007, 2010 and 2011 in towns representing a range of human Babesiosis endemicities. Because of the ongoing expansion of Babesiosis, we defined endemicity based on what was the first of two consecutive years when Babesiosis cases were reported in the town. Based on this definition, my coworkers and I sampled highly endemic locations: Nantucket Island, MA (first cases reported in1969 [Western et al. 1970]); endemic locations: Old Lyme and Lyme (first cases reported in 1992 and 1996, respectively [M.Diuk- Wasser, personal communication, Dec 2^nd, 2011]) and emerging locations: Mansfield, Hampton, Willington and Eastford (first cases reported in 2002, 2007, 2007[only one case], no cases dated, respectively [M.Diuk-Wasser, personal communication, Dec 2^nd, 2011]).For the purpose of this study, I will focus more on the emerging locations.

Sampling of host-seeking ticks

Host-seeking ticks were sampled twice at each site during the nymphal host-seeking period: late May to early July in 2011. We used a standard dragging technique (Daniels et al. 2000) to estimate density of infected ticks among four sites (Hampton, Willington and Mansfield [3 properties]) in northeastern Connecticut and Nantucket during the summers of 2010 and 2011. At each site, we dragged 100-meter transects and inspected at every 20 meters to collect ticks.

Collected ticks were preserved in 70% ethanol. For the purpose of this study, we also included host-seeking ticks from sites in Lyme, Old Lyme and Eastford sampled in 2007. Furthermore, host-seeking ticks from Nantucket in year 2009 (S.Telford, personal communication, August 1^st 2011) were also included.

(8)

6 Sampling of small mammals and feeding ticks

Small mammals were surveyed at five sites in northeastern Connecticut during the summers of 2010 and 2011. From late May to late August, we visited a total of five properties located in Hampton, Willington and Mansfield (3 properties). Repeated sampling throughout the summer months allows for detection of temporal patterns in mammalian density, tick burden, and infection prevalence. The Hampton and Willington sites were visited four times; the three Mansfield sites were visited three times. Each trapping session consisted of two consecutive nights of trapping, using a total of 65 Sherman traps (Tallahassee, RL, USA). In order to represent the heterogeneity in mouse density and tick exposure, we divided the 65 traps into three transects: 15 traps were placed around the house, 25 in forested areas in or adjacent to the property and 25 traps at the forest-lawn edge. Traps were set at dusk and checked at dawn the following day. In each trap, we put black oil sunflower seeds for overnight food source and cotton balls for thermal regulation. During the sampling period, a total of 7 trapping sessions were done. In addition, we recorded the species, sex, age, reproductive status and weight of each captured mammal, removed all attached ticks and stored them in 70% ethanol. The purpose of the collected data was to be used for the calculation of basic reproductive number (R0).

Unfortunately, I realized later that these data were not enough for the calculation. Therefore R0 is not calculated.

DNA extraction and PCR

All ticks were identified using a dissecting microscope and taxonomic keys.We extracted DNA from all I. scapularis nymphs with Qiagen DNeasy blood and tissue kit (Qiagen Inc., Valencia, CA, USA) using a modified protocol (S.Usamni-Brown, personal communication Nov 11^th, 2011). Ticks were crashed by pestle in eppendorf tube, and ticks DNA were degraded in warm (56°C) water bath. Prior to protein degradation, 180 μl of ATL buffer (Qiagen) and 20 μl of a proteinase K solution (14 mg/ml; Boehringer Mannheim, Indianapolis, Ind.) were added to the eppendorf tube. All other steps were followed according to the manufacturer’s protocol. Final volume for each tick DNA was 50 μl, and all DNA were stored at 4°C.We used nested PCR to amplify a portion of the B. burgdorferi 16S-23S rRNA intergenic spacer (IGS) region (Liveris et al.1999). B.burgdorferi infection was detected by visualizing bands using gel electrophoresis.

B.microti screening was done using the real-time Taqman polymerase chain reaction (PCR) targeting the 18S rDNA. All PCR protocol included a MasterTaq DNA polymerase kit (Eppendorf, Westbury, N.Y, USA). For each PCR product, 2.5 μl of tick DNA, 10.4μl of

deionized water, 2.5 μl of 10x Taq buffer (with 15 mM Mg²⁺) were added. Furthermore, forward primers (Sequence ATA ACG AAG AGT TTG ATC CTG GCand Sequence

CAGGGAGGTAGTGACAAGAAATAACA) were used for B.burgdorferi and B.microti

respectively. Real-time PCR’s amplification temperatures were set as 100 °C for 10 minutes, 100

°C for 45 cycles and 60 °C for 1 minute.

Statistical analyses

Logistic regression was used to determine how variables such as year, habitat type, distance to disease’ origin and B.burgdorferi infection prevalence affect B. microti infection prevalence in all sampling sites. These parameters were chosen based on the available data collected. Statistics

(9)

7

were performed using STATA 10 (Stata Statistical Software: Release 10. College Station, TX:

StataCorp LP, USA).

RESULTS

Prevalence of Babesia microti in Connecticut towns and Nantucket

In Old Lyme, Lyme and Eastford, prevalence of B.microtiwere 28 (15.9%) out of 176 nymphal ticks, 13 (20.6%) out of 63 nymphal ticks and 10 (6.0%) out of 167 nymphal ticks respectively.

From 2010 to 2011, prevalence of B.microti increased from 9.5% (14 out of 147 nymphal ticks) to 20% (4 out of 20 nymphal ticks) in Hampton. In Willington, prevalence increased more than double. Prevalence rate increased from 2.8% (4 out of 142 nymphal ticks) to 12.7% (22 out of 173 nymphal ticks). This is the same case for Mansfield 2. Prevalence rate increased from 0.7%

(1 out of 138 nymphal ticks) to 7.1% (5 out of 70 nymphal ticks) from 2010 to 2011. In Mansfield 3, infection prevalence was 15.4% (47 out of 306 nymphal ticks) (Table 2).

Prevalence of B.microti had significantly increased from 2010 to 2011 in newly invaded areas of Connecticut sites.

On Nantucket Island, prevalence of B.microti tripled from 2009 to 2010 and did not change much in 2011. Prevalence rate in 2009, 2010 and 2011 was 2.5% (5 out of 198 nymphal ticks), 9.2% (8 out of 87 nymphal ticks) and 11.1% (22 out of 199 nymphal ticks) respectively (Table 3).

(10)

8

Prevalence of Borrelia burgdoferi in Connecticut towns and Nantucket

Prevalence of B.burgdorferi in Old Lyme, Lyme and Eastford was 23 (12.6%) out of 182 nymphal ticks, 65 (20%) out of 65 nymphal ticks and 93 (53.1%) out of 175 nymphal ticks, respectively. Hampton, Willington and Mansfield sites' prevalence rate stayed around the same between 2010 and 2011. Between 2010 and 2011, B.burgdorferi was detected in 28.6% (42 out of 147 nymphal ticks) and 45% (9 out of 20 nymphal ticks) in Hampton. In Willington,

prevalence rate was 34.5% (49 out of 142 nymphal ticks) and 35.3% (61 out of 173 nymphal ticks). In Mansfield 1, 2 and 3, B. burgdorferi prevalence rate increased from 10.8% (12 out of 111 nymphal ticks) to 9.8% (5 out of 51 nymphal ticks), from 13% (18 out of 138 nymphal ticks) to 10% (7 out of 70 nymphal ticks) and 28.1% (86 out of 306 nymphal ticks), respectively (Table 4).

(11)

9

On Nantucket Island, prevalence of B.burgdorferi increased from 13.1% (26 out of 198 nymphal ticks) to 20.7% (18 out of 87 nymphal ticks) between 2009 and 2010. In 2011, prevalence of B.burgdorferiwas 14.1% (28 out of 199 nymphal ticks) (Table 5).

Co-infection

Co-infection prevalence varied from 0% to 10%. Highest co-infection prevalence was recorded in Hampton 2011, and lowest co-infection prevalence was recorded in Mansfield 2, 2010. For Hampton, Willington and two of the Mansfield sites, co-infection prevalence all increased from 2010 to 2011 (Table 6).

Logistic model

The best model that predicts the prevalence of B.microti is a combination of B.burgdorferi infection prevalence, distance to Stonington, year and habitat types. From this model, a tick is twice more likely to be infected with B.microti if it’s also infected with B.burgdorferi (Table 7 and 8), controlling for distance to Stonington, year and habitat. However, between 2010 and 2011, the best fit model that predicts the prevalence of B.microti is a combination of 3 variables

(12)

10

(B.burgdorferi infection prevalence, distance to Stonington and year) (Table 8).

In addition, tick density is only significant (p-value = 0.025) with B.burgdorferi infection prevalence; however, it is not significant (p-value = 0.416) with B.microti infection prevalence (Table 9).

Human Babesiosis cases are positively related to distance to disease origin. Old Lyme has 52.3 Babesiosis compared to all other sites and it is closest to the distance of disease origin. Lyme and Hampton have 39.1 and 46 Babesiosis cases per 100,000, respectively and they are 35.8 and 49 meters away from Stonington, respectively (M. Diuk-Wasser, personal communication, Dec

(13)

11

3^rd2011). Both Eastford and Willington are equally far away from the disease origin, and there have no cases been found so far. All Mansfield sites have 4 Babesiosis cases per 100,000 and they are approximately the same length to Stonington (Table 10).

DISCUSSION Persistence in host

In established areas (Hampton, Willington, Mansfield 1 & 2) the infection prevalence of B.microtiwas almost always lower than infection prevalence of B.burgdorferi (Tables 2-5).

Mather et al. (1990) found that on average, about 92% of nymphs derived from B.burgdorferi infected mice are proven infected, while only 45% of nymphs were infected from B.microti infected mice (Mather et al. 1990). They also found that B.burgdoferi could infect ticks more efficiently compared to B.microti. One possible explanation of this observation is the intensity of infection in mice. In mice, parasitemia of B.microti is relatively low (< 0.1%) (Etkind et al. 1980, Spielman et al. 1981); however, in other vertebrate hosts such as hamsters, the parasitemia of B.microti can reach up to 50-60% (Benach et al. 1978, Piesman and Spielman 1982). Other factors such as more limited reservoir host range for B. microti than for B. burgdorferi, and lack of avian reservoirs for B.microti also contribute to the lower infection prevalence of

B.microti(Mather 1990). In addition, lower survivorship of B. microti piroplasms in

overwintering nymphs appears to further reduce infection prevalence in nymphs (Piesman et al.

1987b) which does not occur with B.burgdorferi. Another factor that may affect the transmission efficiency ofB.microti is its complex life cycle. In order to transmit the disease

successfully,B.microti must migrate to the salivary gland of the tick. Compared to B.burgdorferi, B.microtifaces many barriers migrating to the salivary gland of the tick. Therefore, ticks may be more physically susceptible to B.burgdorferi infection. Overall, our finding is consistent with our hypothesis that theinfection prevalence of B.microti is lower than that of B.burgdorferi, and previous researches. Although B.microti has a low parasitemia in hosts, the parasitemia persists for a long period of time (Zintl et al. 2003). This benefitsB.microti because the long lasting parasitemia increase infection period in hosts, and low parasitemia save ticks from deleterious effects. A longer infection period in hosts would increase the likelihood of disease transmission, thus B.microti has more chances of being passed on. Moreover, by increasing the tick’s fitness, it also increases the chances of B.microti being transmitted (Yeruham et al. 2001). Another reason

(14)

12

Babesiaspecies are successful at transmitting the disease despite their low transmission efficiency is that they have developed strategies to adapt to the immune responseswhich decreases the chances of being cleared from their vertebrate hosts (Dao and Eberhard 1996, O’Connor and Allred 2000, Schetters et al. 1998). For example, some Babesia specieshave an adhesive mechanism, which prevents infected red blood cells (iRBC)to pass through the spleen, and therefore saves the parasite from clearance in the blood stream. This mechanism would help increase transmission rate when a large amount of parasites are accumulated close to the tick’s feeding sites on a vertebrate host (Chauvin et al. 2009).If the tick takes a blood meal from the part of body where all the blood stream is infected with B.microti, it is likely that the tick will become infected, thus increased the parasite’s transmission rate.

Increase in infection prevalence

Infection prevalence of B.microti increased on both mainland sites (Hampton, Willington, Mansfield 1 and 2) and island site (Nantucket Island) throughout the sampling years. On the mainland, infection prevalence ofB.microti increased from 6% to 10%, and on Nantucket Island, infection prevalence increased 2%. On average, there is also a higher infection prevalence of B.microti and B.burgdoferi on mainland sites compared to island sites (Tables 2-5). From Table 4, we observed the infection prevalence of B.microtiwas increasing rapidly between 2010 and 2011. This increase in infection prevalence can be suggested as the first potentialpeak of the raise of B.microti; however, further research is needed to predict the trends of B.microti. These

findings suggest that the characteristics of B.microti can potentially make up for the differences in transmission efficiency compared to B.burgdoferi, and the rapid increase in infection

prevalence we observed from this study predicts that transmission of B.microti is fast growing and it has the potential to spread as far as B.burgdorferi. However, the rate of expansion is in question.

Factors influence infection prevalence

According to logistic modeling (Table 7), the best model (lowest AIC value) that describes the infection prevalence of B.microti in mainland sites has four variables. These are:B.burgdorferi infection prevalence, distance to Stonington,CT (origin of the disease), year, and habitats (Hampton, Willington, Mansfield 1 and 2 are peridomestic sites, Mansfield 3, Old Lyme, Lyme and Eastford are natural sites). In this model, all factors were significant. Odds ratio value showed that B.burgdorferi infection prevalence increases B.microti infection prevalence by a factor of 1.9. Distance to Stonington, CT, year and habitats increases B.microti infection prevalence by a factor of 0.9, 1.1 and 0.6, respectively. Between 2010 and 2011, year increased the infection prevalence of B.microti by a factor of 2.9, distance to Stonington,CT and

B.burgdorferi infection prevalence increased infection prevalence of B.microti by a factor of 0.9 and 1.9 respectively (Table 8). These results are helpful for building disease prevalence modelsin future research. Both models show that the infection prevalence of B.microti is doubled in the presence of B.burgdorferiinfection. This suggests that B.burgdorferi can potentially enhance the infection prevalence of B.microti. However, it is interesting to note that tick-density (p-value = 0.025) was only significant in infection prevalence of B.burgdorferi, not in infection prevalence of B.microti (p-value = 0.416). This observation indicates that the number of ticks present in a particular area correlates with the infection prevalence of B.burgdorferi only. This means that infection prevalence of B.microti does not depend on the number of ticks present in an

area.Previous studies have shown that a threshold of greater than or equal to 20 nymphs per hour is needed to maintain the parasites in the habitat (Mather et al. 1996) and therefore transmits

(15)

13

disease to humans. Infection prevalence is closely related to vertebrate host community(Gage et al. 2008). If the prevalence ofB.microti does not depend on tick-density, it may depend on factors such as predator-prey dynamics, habitat suitability, and availability of food resources (Gage et al. 2008). However, due to study limitations such as number of consecutive years sampled and number of visits per site, and human errors, the results observed in tick-density versus infection prevalence of B.microti can potentially be regarded as unreliable.

Co-infection

Although the prevalence of co-infection observed in this study is not high (Table 6),

epidemiology of co-infection cannot be overlooked. Co-feeding transmission can be achieved from two ways. First, an uninfected tick can become infected if it is feeding simultaneously with an infected tick even if there is a physical distance between them. Second, an uninfected tick may acquire infection if it is feeding on the same spot after an infected tick has completed feeding and dropped off (Randolph et al. 1996). Ixodes ticks can feed simultaneously because their blood meals can lasts from several days to several weeks, and more than 90% of immature I.ricinus ticks feed on the same spot-the ear of rodents (Randolph et al. 1996). 4% to 45% of patients with Lyme disease were shown evidences of co-infection with either human

Anaplsmosis and Babsiosis (Swanson et al. 2006). Co-infection is important in clinical diagnosis because Lyme disease patients coinfected with B.microti results in more symptoms and more persistent illness (Krause et al.1996). Although co-infection causes more illness in humans, it does not increase disease severity in mice. For example, Coleman et al. (2005) found that neither B.burgdorferi nor B.microti increased severity in co-infected disease susceptible C3H/HeN mice.

Their study also suggested that B.burgdorferi and B.microti follow different pathways in mice (Coleman et al. 2005). Within host, B.burgdorferiis transported within the lymphatic system with the help of Langerhans cells, whileB.microtitravels on their own mobility (Randolph et al. 1996).

Spreading of the pathogen

Distance to Stonington (Table 10) shows sites that are further away from the origin have less infection prevalence and Babesiosis cases. It interesting to see that even though there is no cases in Eastford (farthestplace to disease origin), our data shows there is a 6% in infection prevalence of B.microti. This finding suggests that in newly emerging areas, B.microti infection in ticks can be detected before human cases are reported. We also expect Willington to have more human cases since there is a large increase in infection prevalence of B.microti from 2010 to 2011.

These finding are useful in predicting future spread in tick infection prevalence. In order to predict disease spread, we first need to knowR0. R0 is the per generation growth in totally susceptible population (Hartemink et al. 2008). R0 is useful because if R0>1, an outbreak is possible when a pathogen is introduced. If R₀<1, the disease will die out. When there is an outbreak, R0 measures how likely this outbreak will actually occur, and the initial exponential increase in the pathogen. Moreover, when the outbreak actually occurs, R0 determines how much of the population need to be vaccinated in order to prevent the disease to spread further

(Hartemink et al. 2008). R0 is calculated as the following equation:

R

0

= Nf βv − t βt − t (βt − v)P

ⁿ

F

H(r + h)

(16)

14

N/H is the host ratio; f is the probability of a tick feeding on an individual of a particular host species. v represents vertebrate host, and t represents ticks. Therefore, βv-t is the transmission coefficient from vertebrate hosts to ticks, on the contrast βt-v is the transmission coefficient from ticks to vertebrate hosts. Likewise, βt-t is the transmission coefficient from ticks to ticks trans- stadially or transovarially. Transstadial transmission represents transmission from one life stage to another for example, from larvae to nymphs. Transovarial transmission represents

transmission from one female tick to its eggs. Variable P is the vector’s daily survival probability and n presents the extrinsic incubation period in days before an uninfected tick become infected.

F is the vector’s reproduction rate. r is the daily rate of loss of infectivity in the host, and h is the host’s daily mortality rate (Randolph 1998). Unfortunately, due to the limited data in this study, we do not have value for all parameters to calculate R₀. In future researches, R₀ would help determine whether B.microti infection prevalence will increase or decline overtime.

Control and Prevention strategies

The concept of Dilution effect provides information on how the prevalence of pathogens can become reduced in nature due to increased biodiversity.Dilution effect suggests that when an area is divided into smaller portions, less competent hosts will be found in one of the smaller portions (Jill 2006). By increasing biodiversity, it will increase the species richness found in one of the divided areas. Hence, ticks may feed on incompetent hosts, and since incompetent hosts havea low capacity to infect ticks, they are less likely to become infected. By increasing biodiversity in general, it will also add vertebrate hosts that transmit to tick via non-systemic (infection limits to a specific part of the body)pathways. For example, when ticks feed on such species, ticks may not become infected because the infection in the vertebrate host is limited to a specific part of the body and if the tick did not feed on the part where is infected with parasites.

This tick would not get infected. An example of non-systemic transmission species is deer.

However, it is not advised to increase deer population because although deer is not a competent host, it increases the population of I.scapularis ticks. Deer population has increased largely due to conservation efforts and landscape changes in the northeastern USA (Spielman1994).

Moreover, by increasing biodiversity in a given area, it will also increase the likelihood of introducing new parasites and diseases. Thus, tick eradication strategies are complex and should be carefully considered before carrying them out in nature.

Although it is difficult to control the spread of B.microtibiologically, various prevention and protection methods can be taken. At present, more people are taking their vacations and outdoor activities in the rural areas. On Nantucket, northeast USA, human population increased from 7000 to 35000 residents (M. Diuk-Wasser, personal communication, Dec 10^th2011). Increased residential and recreational activities can increase tick density in already tick-infested rural areas (Daszak et al. 2000). One simple way to protect ourselves is avoid going to tick-infested areas especially during the peaks of feeding ticks, and apply tick repellents when entering such areas.

Applying acaricides to host nests or habitats will interrupt transmission between ticks and hosts, therefore it will decreases the possibility of tick attachment. Another factor that contributes to human exposure to B.microti is the number of susceptible individuals. An increased population of HIV positive individuals might lead to an increase of human Babesiosis cases. Studies have shown that individuals who are positive for HIV or AIDS are found associated with four human Babesiosis cases (Benezra et al. 1987, Falagas et al. 1996, Machtinger et al. 1993, Ong et al.

1990). Individuals who use immunosuppressive drugs for cancer chemotherapy are also

associated with human Babesiosis (Evenson et al. 1998, Slouvut et al. 1996).At present, there is

(17)

15

no vaccine against human Babesiosis (Homer et al. 2000).Treatment for B.microti infected patients include a combination of oral clindamycin with oral quinine for the less ill patients (Krause et al. 2000). For severely ill patients, a combination of intravenous clindamycin with oral quinine is given (Krause 2003).

Future research

Due to time and money concerns, a simultaneous transmission experiment of B.burgdorferi and B.microti was not done; however the potential results of such experiment is worth noting. The method of such experiment would consist of three experimental groups: (1) infect mice with B.burgdorferi first (2) infect mice with B.microti first and (3) infect mice with both pathogens. In addition, infections with each pathogen only should also be used as control group.

Xenodiagnostic ticks will be examined in every 7-day interval. Ideal results would indicate whether the presence of one pathogen would enhance or suppress the prevalence of the other pathogen. For example, if the prevalence of B.microti increased from experimental group one compared to B.microti control group. This suggests the presence of B.burgdorferi infection enhances the prevalence of B.microti. This holds true for experimental group two. Results from experimental group three would indicate whether the result of co-infection is worse compared to either pathogen alone. This experiment can also be used to confirm or reject the results for example, a tick is twice more likely to be infected with B.microti if it’s also infected with B.burgdorferi obtained from logistic model.

A lot of studies have been done on Babesia persistence and adaptation in vertebrate hosts;

however, adaptation by Babesia in ticks remains unknown. For example, true gametocytes have not been identified in any Babesia species, and Babesia gene expression in tick is still unresolved (Chauvin et al. 2009, Mackenstedt et al. 1990). In Borrelia, tick saliva is known as one of the host defense responses (Tsao 2009). Tick saliva contains active components which help increased the length of feeding time on vertebrate hosts (Steen et al. 2006), and some of these components may also interact with anti-bacteria responses (Chauvin et al. 2009), which may lower the effects of tick bites. Therefore, it is important to understand the role of tick saliva in Babesia adaptation in hosts. In addition, in order to control the spread of B.microti successfully, seasonal synchrony in ticks life stages should be improved in prevalence models. A formal documentation of all possible variables used in R0 calculation should also be published, so researches can develop more practical models to control the spread of Babesiosis.

ACKNOWLEDGEMENTS

I would like to thank my main supervisor: Dr. Maria Diuk-Wasser and co-supervisors: Dr. Sahar Usmani-Brown, Tanner Steeves, Lindsay Rollend and Dr. Peter Krause for support, comments and suggestions. I would also like to thank my coordinator: Dr. Anna Brunberg, supporting supervisor: Dr. Alexander Eiler and my two opponents: Ioana Brannstrom and Jürg Brendan Logue for final edition and suggestions.

(18)

16 REFERENCE LIST

Adelson M.E, Rao R.V, Tilton R.C, Cabets K, Eskow E, Fein L, Occi J.L, Mordechai E. 2004. Prevalence of Borrelia burgdorferi, Bartonella spp., Babesia microti, and Anaplasma phagocytophila in Ixodes scapularis ticks collected in Northern New Jersey. Journal of Clinical Microbiology 42: 2799–2801.

Alekseev A.N, Semenov A.V, Dubinina H.V. 2003. Evidence of Babesia microti infection in multi-infected Ixodes persulcatus ticks in Russia. Experimental and Applied Acarology 29: 345–353.

Babes V. 1888, as referred in Uilenberg G. 2006. Babesia-A historical overview. Veterinary Parsitology 138: 3-10.

Benach J.L , Habicht G.S. 1981. Clinical characteristics of human babesiosis. Jounral ofInfectious Disease. 144:481.

Benach J.L, White D.J, McGovern J.P. 1978. Babesiosis on Long Island: Host-parasite relationships of rodent and human derived Babesia microti isolates in hamsters. American Journal of Tropical Medicine and Hygiene 27: 1073- 1078.

Benezra D, Brown AE, Polsky B, Gold JW, Armstrong D. 1987. Babesiosis and infection with human immunodeficiency virus (HIV). Annals of Internal Medicine 107:944

Centers for Disease Control and Prevention. 2012.Babesiosis. 20, July, 2009, Retrieved from http://www.dpd.cdc.gov/dpdx/HTML/ImageLibrary/Babesiosis_il.htm Date visited 10, April, 2012.

Chauvin A, Moreau E, Bonnet S, Plantard O, Malandrin L. 2009. Babesia and its hosts: adaptation to long-lasting interactions as a way to achieve efficient transmission. VectorReservoir 40: 37

Coleman J.L, LeVine D, Thill C, Kuhlow C, Benach J. 2005. Babesia microti and Borrelia burgdorferi follow independent courses of infection in mice. The Journal of Infectious diseases 192: 1634-41.

Courtney J.W, Dryden R.L, Montgomery J, Schneider B.S, Smith G, Massung R.F. 2003. Molecular characterization of Anaplasma phagocytophilum and Borrelia burgdorferi in Ixodes scapularis ticks from Pennsylvania. Journal of Clinical Microbiology 41: 1569–1573.

Dao A.H, Eberhard M.L 1996. Pathology of acute fatal babesiosis in hamsters experimentally infected with the WA- 1 strain of Babesia. Laboratory Investigation 74:853-859.

Daszak P, Cunningham A.A, Hyatt A.D. 2000. Emerging infectious diseases of wildlife-threats to biodiversity and human health. Science 287: 443-449.

Daniels T.J, Falco R.C, Fish D. 2000. Estimating population size and drag sampling efficiency for the blacklegged tick (Acari: Ixodidae). Entomological society of America 37:357-363

Eisen R.J, Eisen L, Castro M.B, Lane R.S. 2003. Environmentally related variability in risk of exposure to Lyme disease spirochetes in northern California: effect of climatic conditions and habitat type. Environmental Entomology 32: 1010-1018.

Eisen L, Eisen R.J, Chang C.C, Mun J, Lane R.S. 2004. Acarologic risk of exposure to Borrelia burgdorferi spirochaetes: long-term evaluations in north-western California, with implications for Lyme borreliosis risk- assessment models. Medical and Veterinary Entomology18: 38-49.

Eisen L, Eisen R.J, Lane R.S, 2002. Seasonal activity patterns of Ixodes pacificus nymphs in relation to climatic conditions. Medical and Veterinary Entomology16: 235-244.

Etkind, P, Piesman J, Ruebush T.K, Spielman A, Juranek D.D. 1980. Methods for detecting Babesia microti infection in wild rodents. Journal of Parasitology 66:107-110.

Evenson DA, Perry E, Kloster B, Hurley R, Stroncek DF. 1998. Therapeutic apheresis for babesiosis. Journal of Clinical Apheresis 13:32-36.

(19)

17

Falagas ME, Klempner MS. 1996. Babesiosis in patients with AIDS: a chronic infection presenting as fever of unknown origin. Clinical Infectious Disease 22:809-912.

Gage K.L, Burkot T.R, Eisen R.J, Hayes E.B. 2008. Climate and vectorborne diseases. American Journal of Preventive Medicine. 35:436-450.

Gorenflot A, Moubri K,Precigout E, Carcy B, Schetters P. 1988. Human babesiosis. Annals of Tropical Medicine and Parasitology 92:489-501.

Hartemink N.A, Randolph S.E, Davis S.A, Heesterbeek A.P. 2008. The basic reproduction number for complex disease systems: Defining R0 for Tick-borne Infections. The American Naturalist 171:743-754.

Halos L, Jamal T, Maillard R, Beugnet F, Le Menach A, Boulouis H.J, Vayssier-Taussat M. 2005. Evidence of Bartonella sp. in questing adult and nymphal Ixodes ricinus ticks from France and co-infection with Borrelia burgdorferi sensu lato and Babesia sp. Veterinary Research 36: 79–87.

H Jill. 2006. The dilution effects. Download document. 5 April 2006, Retrieved from http://www.greendecade.org/download/dilution_effect.pdf. Date visited 10 December 2011.

Hofmeister EK, Kolbert CP, Abdulkarim AS, Magera JM, Hopkins MK, Uhl JR, Ambyaye A, Telford III SR, Cockerill III FR, Persing DH. 1998. Consegregation of a novel Bartonella species with Borrelia burgdorferi and Babesia microti in Peromyscus leucopus. Journal of Infectious Disease 177:409-416.

Holden K, Boothby J.T, Anand S, Massung R.F. 2003. Detection of Borrelia burgdorferi, Ehrlichia chaffeensis, and Anaplasma phagocytophilum in ticks (Acari: Ixodidae) from a coastal region of California. Journal of Medical Entomology 40: 534-539.

Holman M. S, Caporale D.A, Goldberg J, Lacombe E, Lubelczyk C, Rand P.W, Smith R.P. 2004. Anaplasma phagocytophilum , Babesia microti , and Borrelia burgdorferi in Ixodes scapularis , southern coastal Maine.

Emerging Infectious Disease journal 10: 744–746.

Homer M.J, Aguilar-delfin I, Telford III S.R, Krause P.J, Persing D.H. 2000. Babesiosis. American Society for Microbiology 13:451-469.

Hu R. Hyland K.E, Markowski D. 1997. Effects of Babesia microti infection on feeding pattern, engorged body weight, and molting rate of immature Ixodes scapularis (Acari:Ixodidae). Journal of Medical Entomology 34: 559- 564.

Krause P.J. 2003. Babesiosis diagnosis and treatment. Vector Borne Zoonotic 3:45-51.

Krause P.J, Lepore T, Sikand V.K, Gadbaw Jr J, Burke G, Telford III S.R, Brassard P, Pearl D, Azlanzadeh J, Christianson D, McGrath D, Spielman A. 2000. Atovaquone and azithromycin for the treatment of babesiosis. The New England Journal of Medicine 343: 1454-1458.

Krause P.J, Telford III S.R, Spielman A, Sikand V, Ryan R, Christianson D, Burke G, Brassard P, Pollack R, Peck J, Persing D.H. 1996. Concurrent Lyme disease and babesiosis: evidence for increased severity and duration of illness.

The Journal of the American Medical Association 275: 1657-1660.

Lane R.S, Steinlein D.B, Mun J. 2004. Human behaviors elevating exposure to Ixodes pacificus (Acari: Ixodidae) nymphs and their associated bacterial zoonotic agents in a hardwood forest. Journal of Medical Entomology 41:239- 248.

Levine ND. 1971. Taxonomy of piroplasms Transactions of the American Microsopical Society 90:2-33

Liveris D, Varde S, Iyer R, Koenig S, Bittker S, Cooper D, McKenna D, Nowakowski J, Nadelman R. B, Wormser G.P, Schwartz I. 1999. Genetic diversity of Borrelia burgdorferi in Lyme diseasepatients as determined by culture versus direct PCR with clinicalspecimens. Journal of Clinical Microbiology 37: 565–5 69

(20)

18

LoGiudice K, Ostfeld R, Schmidt K.A, Keesing F. 2003. The ecology of infectious disease:Effects of host diversity and community composition on Lyme disease risk. Ecology100:567-571.

Machtinger L, Telford III SR, Inducil C, Klapper E, Pepkowitz SH, Goldfinger D. 1993. Treatment of babesiosis by red blood cell exchange in an HIV-positive, splenectomized patient. Journal of Clinical Apheresis8:78-81.

Mackenstedt U, Gauer M, Mehlhorn H, Schein E, Hauschild S. 1990. Sexual cycle of Babesia divergens confirmed by DNA measurements. Parasitology Research 76: 199-206

Mather TN, Nicholson MC, Hu R, Miller NJ. 1996. Entomological correlates of Babesia microti prevalence in an area where Ixodes scapularis (Acari: Ixodidae) is endemic. Journal of Medical Entomology 33: 866-870.

Mather T.N, Telford III S.R, Moore S.I, Spielman A. 1990. Borrelia burgdorferi and Babesia microti: Efficiency of Transmission from Reservoirs to Vector Ticks (Ixodes dammini). Experimental parasitology 70: 55-61.

Mehlhorn H, Shein E, 1984, The piroplasms: life cycle and sexual stages. Advances in Parasitology 23: 37-103.

Nefedova Y, Huang M, Kusmartsev S, Bhattacharya R, Cheng P, Salup R, Jove R, Gabrilovich D. 2004.

Hyperactivation of STAT3 is involved in abnormal differentiation of dendritic cells in cancer, Journal of Immunology 172: 464-474.

O’Connor R.M, Allred D.R. 2000. Selection of Babesia bovis-infected erythrocytes for adhesion to endothelial cells coselects for altered variant erythrocyte surface antigen isoforms. Journal of Immunology 164:2037-2045.

Ong KR, Stavropoulos C, Inada Y. 1990. Babesiosis, asplenia, and AIDS. Lancet 336:112.

Pancholi P, Kolbert C.P, Mitchell P.D, Reed K.D, Dumler Jr. J.S, Bakken J.S, Telford III S.R, Persing D.H. 1995.

Ixodes dammini as a potential vector of human granulocytic ehrlichiosis. Journal of Infectious Disease 172:1007–

1012.

Piesman, J, Mather T.N, Sinsky R,J, Spielman A. 1987. Duration of tick attachment and Borrelia burgdorferi transmission. Journal of Clinical Microbiology 25: 557-558.

Piesman, J, Mather T. N, Dammin G. J, Telford S. R, Lastavica C.C, Spielman A. 1987b. Seasonal Variation of Transmission Risk of Lyme-Disease and Human Babesiosis. American Journal of Epidemiology 126: 1187-1189.

Piesman J, Mather T.N, Telford III S.R, Spielman A. 1986. Concurrent Borrelia burgdorferi and Babesia microti infection in nymphal Ixodes dammini. Journal of Clinical Microbiology 24: 446–447.

Piesman J, Spielman A. 1980. Human babesiosis on Nantucket Island: prevalence of Babesia microti in ticks.

American Journal of Tropical Medicine andHygiene 29:742-6.

Piesman, J, Spielman A. 1982. Babesia microti: infectivity of parasites from ticks for hamsters and white-footed mice. Experimental Parasitology 53:242-248.

Pfeiffer C.D; Kazmierczak J.J; Davis J,P. 2007. Epidemiologic features of Human babesiosis in Wisconsin, 1996- 2005. Wisconsin Medical Journal 106:191-195.

Randolph SE. 1975. Patterns of distribution of the tick Ixodes trianguliceps Birula on its hosts. Journal of Animal Ecology 44: 425-49

Randolph S.E. 1998. Ticks are not insects: consequences of contrasting vector biology for transmission potential.

Parasitology Today 14: 186-192.

Randolph S.E, Gern L, Nuttall P.A. 1996. Co-feeding ticks: Epidemiological significance for tick-borne pathogen transmission. Parasiology Today 12: 472-479.

Reid H.W, 1984. In Vectors in Virus Biology (Mayo, M.A and Harrap, K.A eds), pp 161-178, Academic Press

(21)

19

Rudzinska M.A, Trager W, LewengrubS.J, Gubert E. 1976. An electron microscopic study of Babesia microti invading erythrocytes. Cell Tissue Research 169: 323-334.

Schauber E.M, Gertz S.J, Maple W.T, Ostfeld R.S. 1998. Coinfection of blacklegged ticks (Acari: Ixodidae) in Dutches County, New York, with the agents of Lyme disease and human granulocytic ehrlichiosis. Journal of Medical Entomology 35:901–903.

Schulze T.L, Jordan R.A, Schulze C.J, Mixson T, Papero M. 2005. Relative encounter frequencies and prevalence of selected Borrelia, Ehrlichia, and Anaplasma infections in Amblyomma americanum and Ixodes scapularis (Acari:

Ixodidae) ticks from central New Jersey. Journal of Medical Entomology 42: 450–456.

Schetters T.P, Kleuskens J, Scoltes N, Gorenflot A. 1998. Parasite localization and dissemination in the Babesia- infected host, Annual of Tropical Medicine and Parasitology 92:513-519.

Skotarczak B, Wodecka B, Cichocka A. 2002. Coexistence of DNA of Borrelia burgdorferi sensu lato and Babesia microti in Ixodes ricinus ticks from north-western Poland. Annals of Agricultural and Enviornmental Medicine 9:

25–28.

Skotarczak B, Rymaszewska A, Wodecka B, Sawczuk M. 2003. Molecular evidence of coinfection of Borrelia burgdorferi sensu lato, human granulocytic ehrlichiosis agent, and Babesia microti in ticks from northwestern Poland. Journal of Parasitology 89: 194–196.

Skrabalo Z, Deanovic Z. 1957. Piroplasmosis in man. Doc de Med Geogret Trop 9: 11-16

Slovut DP, Benedetti e, Matas AJ. 1996. Babesiosis and hemophagocytic syndrome in an asplenic renal transplant recipient. Transplantation 62:537-539.

Smith T, Kilborne F.L, 1893. Investigations into the nature, causation, and prevention of Texas or southern cattle fever, 8^th and 9^th Repts. Bureau of Animal Industry U.S. Department of Agriculture 177-304.

Sonenshine, D. 1993. Biology of Ticks volume 2. New York: Oxford University Press.

Spielman A, Etkind P, Piesman J, Ruebush T.K, Juranek, D.D and Jacobs M.S. 1981. Reservoir hosts of human babesiosis on Nantucket Island. American Journal of Tropical Medicine and Hygiene 30: 560-565.

Spielman A. 1994. The emergence of Lyme disease and human babesiosis in a changing environment. Annual of New York Academic Science 740: 146-156.

Starcovici C. 1893, as referred in Uilenberg G. 2006. Babesia-A historical overview. Veterinary Parsitology 138: 3- 10.

Stanczak J, Gabre R.M, Kruminis-Lozowska W, Racewicz M, Kubica-Biernat B. 2004. Ixodes ricinus as a vector of Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum and Babesia microti in urban and suburban forests.

Annals of Agricultural and Environmental Medicine 11: 109–114.

Steen N.A, Barker S.C Alewood P.F. 2006. Proteins in the saliva of the Ixodida (ticks):pharmacological features and biological significance. Toxicon 27:1-20.

Swanson S.J, Neizel D, Reed K.D, Belongia E.A. 2006. Coinfections acquired from Ixodes ticks. Clinical microbiology Reviews19:708-727

Telford III S.R, Dawson J.E, Katavolos P, Warner C.K, Kolbert C.P, Persing D.H. 1996. Perpetuation of the agent of human granulocytic ehrlichiosis in a deer tick-rodent cycle. Proceedings of the National Academy of Sciences of the United States of America 93: 6209–6214.

Telford III S.R, Maguire J.H. 1999. Babesiosis. In tropical infectious disease: principles, pathogens, and practice, vol. 1 (ed. Guerrant, R.L, Walker, D.H & Weller, P.F) pp 767-773. Churchill Livingstone, London, UK.

(22)

20

Telford III SR,Spielman A. 1997. Babesiosis of humans. In: Collier L, Balows A, Sussman M, Kreier JP, editors.

Topley and Wilson’s microbiology and microbial infections. 9^th ed. London:Edward Arnold pp.349-359.

Trager W. 1939. Acquired immunity to ticks. Journal of Parasitology. 25: 57-81.

Tsao J.I. 2009. Reviwing molecular adaptations of Lyme borreliosis spirochetes in the context of reproductive fitness in natural transmission cycles. Vector Research 40:36

Western K.A, Benson G.D, Gleason H.H, Healy G.R, Schultz M.G. 1970. Babesiosis in a Massachusetts resident.

The New England Journal of Medicine 283: 854-856.

Wilson M.L, Spielman A. 1985. Seasonal activity of immature Ixodes dammini (Acari:Ixodidae). Journal of .Medical Entomology 22:408-414.

Varde, S, Beckley J, Schwartz I. 1998. Prevalence of tick-borne pathogens in Ixodes scapularis in a rural New Jersey County. Emerging Infectious Disease journal 4: 97–99.

Yeruham I, Hadani A, Galker F. 2001. The effects of the ovine host parasitaemia on the development of Babesia ovis (Babes, 1892) in the tick Rhipicephalus bursa (Canestrini and Fanzago, 1877), Vector Parasitology 96: 195- 202.

Zintl A, Mulcahy G, Skerrett H.E, Taylor S.M, Gray J.S 2003. Babesia divergens, a bovine blood parasite of veterinary and zoonotic importance, Clinical Microbiology Reviews 16: 622-636.

Invasion of Babesia microti in NortheasternUSAYuchen(Lucy) Liu