Uppsala University
Department of Neuroscience Undergraduate thesis, 15 c Spring 2012
Parasite manipulation of host behaviour
Author: Julia Stark Supervisor: Svante Winberg
Abstract
The three‐spined stickleback (Gasterosteus aculeatus) is an intermediate host of the cestode Schistocephalus solidus. The parasite must specifically infect this fish to be able to continue its life cycle. For sticklebacks infected with S. solidus, behavioural changes have been reported and one of these observed alterations is reduced anti‐predator behaviour. The mechanisms underlying the changes in behaviour are still unclear. It has been proposed that the reduced anti‐predator behaviour is a result from an increased activity in the serotonergic system in brains of infected sticklebacks. Using RT‐qPCR, this study aimed to analyse the expression of different serotonin‐related genes in brains of infected and non‐
infected sticklebacks, to evaluate if parasite infection has any effects on the expression of these genes. The genes investigated were 5‐hydroxytryptamine receptor 1A (5‐HTR1A) and the rate‐limiting enzyme in the serotonin synthesis, tryptophan hydroxylase 1 (TPH1). The results for 5‐HTR1A showed a tendency of down regulation of the receptor in infected female sticklebacks, which potentially could lead to the increased serotonergic activity previously observed in infected sticklebacks. No difference in expression between infected and non‐
infected fish was found for TPH1, indicating that the parasite does not have any effect on the expression of this gene. However, a sex difference in expression of TPH1 was found.
Sammanfattning
Storspiggen (Gasterosteus aculeatus) är en intermediär värd för cestoden Schistocephalus solidus som specifikt måste infektera denna fiskart för att kunna fullborda sin livscykel. Beteendeförändringar hos S. solidus‐infekterade storspiggar har rapporterats och minskat antipredator‐beteende har observerats som en av dessa förändringar. De underliggande mekanismerna för beteendeförändringarna är idag ej klarlagda. Minskat antipredator‐beteende har föreslagits bero på en ökad aktivitet i serotoninsystemet i hjärnorna hos infekterade storspiggar. Med hjälp av RT‐qPCR ämnade denna studie analysera uttrycket av diverse serotonin‐relaterade gener i hjärnor från infekterade och icke‐infekterade storspiggar, för att utreda om parasit‐infektion påverkar uttrycket av dessa gener. De gener som undersöktes var 5‐hydroxytryptamin receptor 1A (5‐HTR1A) och det hastighetsbegränsande enzymet i serotoninsyntesen, tryptofanhydroxylas 1 (TPH1). Resultaten för 5‐HTR1A visade på en tendens till nedreglering av receptorn hos infekterade storspiggs‐
honor, vilket potentiellt skulle kunna leda till den ökade serotonerga aktiviteten som tidigare hittats hos infekterade storspiggar. För TPH1 observerades ingen skillnad i uttryck mellan infekterade och icke‐infekterade storspiggar, vilket indikerar att parasiten inte har någon effekt på uttrycket av denna gen.
Emellertid upptäcktes en könsskillnad i uttrycket av TPH1.
Introduction
Ever since the beginning of the 20th century, it has been known that parasites have the ability of manipulating the behaviour of their hosts to increase their transmission to the next host (for review, see Thomas et al. 2005). Today there is knowledge about parasite‐induced alterations of a host’s phenotype, for example behaviour, for several different host‐parasite systems. These manipulations can be achieved either through direct or indirect mechanisms. The parasite interacting with the host’s nervous system or muscles, for example by secretion of a neuroactive substance, is an example of a direct manipulation. However, parasites can affect other tissues of the host, which, for instance, gives rise to changes in host metabolism, development or immunity. When these changes secondarily induce alterations of host behaviour, the parasite manipulates its host through an indirect mechanism (Thomas et al. 2005).
The parasite Schistocephalus solidus is a cestode whose life cycle includes three different hosts (for review, see Barber & Scharsack 2010). S. solidus is trophically transmitted and in its first intermediate host, cyclopoid copepods, it develops into procercoids. This is a stage of the tapeworm that is infectious to the three‐spined stickleback (Gasterosteus aculeatus) the second intermediate host. The three‐spined stickleback is specific to the parasite; it must reside here to be able to continue its life cycle. When S. solidus enters the gut of the stickleback, it penetrates the intestinal wall in order to develop into plerocercoids (the third stage of the tapeworm) in the body cavity of the fish.
These plerocercoids, which can grow to a large size, are infectious to fish‐eating birds, the parasite’s definitive host. When S. solidus has entered the bird, it undergoes sexual maturation and produces eggs. These eggs enter the water via the bird’s faeces, whereupon they hatch and coracidia (the first stage of the tapeworm) can swim out and, once again, be eaten by a cyclopoid copepod (Barber & Scharsack 2010).
With regard to the large body size of S. solidus plerocercoids compared to the size of the stickleback, the parasite is unusual since this feature is not often observed in other host‐parasite systems (Barber & Scharsack 2010).
Sticklebacks infected with S. solidus plerocercoids get an extended abdomen, different swimming gait and an increased energy demand due to the parasite relying on energy from its host while it grows enormously. Studies of naturally infected sticklebacks have demonstrated reduced growth and poor body condition, which led to decreased sexual development (Barber & Scharsack 2010). Secondarily, this led to the unlikeliness of participating successfully in spawning (Barber & Scharsack 2010), although there are exceptions in some stickleback populations (Heins & Baker 2008).
When sticklebacks get infected with S. solidus plerocercoids they also exhibit changes in behaviour: they tend to reduce their presence in shoals (see Barber & Huntingford 1995 for review) and show altered behaviour regarding anti‐predation and risk‐taking (Ness & Foster 1999), compared with non‐
infected conspecifics. These behavioural alterations increase the probability for the parasite to complete its life cycle (Barber & Scharsack 2010).
Among infected sticklebacks the stomachs have reduced space for food, compared with non‐infected fish, and they eat a smaller amount of food each
time (Barber & Huntingford 1995). They also spend more time with their prey (Cunningham et al. 1994), which results in reduced food competition ability. This weakness of infected sticklebacks gets even more substantial when shoaling, since the food competition then increases. One benefit with shoal membership is the increased protection against predators, something the infected sticklebacks probably can not take advantage of since they show reduced homogeneity to the other fish in the shoal due to their altered behaviour and appearance (Barber &
Huntingford 1995). Shoal membership rather increases the risk for these fishes to get attacked by predators (Landeau & Terborgh 1986; Ohguchi 1981). It therefore seems plausible that these two circumstances affect the infected sticklebacks in their decision to stay further away from the shoal, a decision that consequently makes them more vulnerable to predators (Barber & Huntingford 1995).
Studies of wild caught sticklebacks, naturally infected with S. solidus plerocercoids have shown features of reduced anti‐predator behaviour (Giles 1983; Ness & Foster 1999). Barber et al. (2004) studied female three‐spined sticklebacks, reared in the laboratory and experimentally infected with one single S. solidus plerocercoid, and investigated their anti‐predator behaviour relative to the size of the parasite. Previously, it has been established that a S.
solidus plerocercoid weighing >50mg is infective to its definitive host (Tierney &
Crompton 1992) and in Barber’s experiment (2004), the fish showed reduced anti‐predator behaviour when the parasite mass reached that level. Barber et al.
(2004) compared infected female sticklebacks with sham‐exposed females in order to investigate their escape responses to a simulated avian predation. While the parasite mass was <50mg there was no significant difference between infected and sham‐exposed sticklebacks, whereas when the parasite had reached
>50mg and the fish were exposed to the avian stimulus, a significantly lower proportion of the infected sticklebacks performed directional responses compared to the sham‐exposed. Moreover, the infected sticklebacks showed reduced efficiency in reaching cover, were less likely to perform the most common escape response among non‐infected conspecifics (staggered dash response) and swam slower than sham‐exposed sticklebacks. The results from this experiment contributed evidence that the effects of S. solidus on anti‐
predator behaviour are delayed until the parasite becomes infective to its definitive host, which should be expected assuming that the behavioural changes of infected sticklebacks are a result of an adaptive manipulation caused by the parasite (for discussion, see Barber et al. 2004).
The mechanisms responsible for these behavioural alterations in S. solidus‐
infected sticklebacks are still unclear (Barber & Scharsack 2010), but the parasite seems to have the ability of evading the immune system of the stickleback (Bråten 1966). When S. solidus plerocercoids were transplanted to other fish species, the parasites died within a few days. These fishes’ immune systems are able to defeat the parasite, whereas S. solidus seems to have the capacity of adapting specifically to the stickleback immune system and manipulate it (Barber & Scharsack 2010). Scharsack et al. (2007) studied the activity of the immune system in sticklebacks reared in the laboratory and experimentally infected with S. solidus. The result showed no up regulation of the specific immune response and the innate immunity shifted its activation. The respiratory burst of the leucocytes were up regulated late, by the time the
parasite mass had reached 50mg. At this mass, the parasite was too big to be defeated by the immune system. This delayed up regulation of the respiratory burst activity may lead to neural changes that are responsible for the behavioural alterations in the infected sticklebacks (see Scharsack et al. 2007 for discussion). It is recognised that the activation of the innate immunity interfere with the neuroendocrine system in teleost fish (see Engelsma et al. 2002 for review).
Reduced anti‐predator behaviour is presumed to be a result from increased concentrations of monoaminergic neurotransmitters in the brains of infected sticklebacks (for discussion, see Overli et al. 2001), although the mechanisms responsible for these elevations are still unclear. The elevations could be a result of an immune response or another stressor, but they could also result from changes in energy or endocrine status in the fish. Moreover, the fact that the parasite manipulates the sticklebacks through secretion of a neuroactive substance cannot be excluded (Overli et al. 2001).
Among these elevated concentrations of monoamine transmitters, the serotonergic activity was particularly substantial in the hypothalamus and the brain stem (Overli et al. 2001). This does not only apply on S. solidus infected sticklebacks; effects on the serotonergic system have also been found in other host‐parasite systems (Helluy & Thomas 2003; Maynard et al. 1996). The serotonin system of the vertebrate brain is involved in both food intake (for review, see Lin et al. 2000) and anti‐predator behaviour (Winberg et al. 1993).
This project therefore aims to further investigate the serotonin system and examine how the expression of various serotonin related genes are altered in the brains of sticklebacks infected with S. solidus, compared with non‐infected sticklebacks. The genes this study aims to analyse are 5‐hydroxytryptamine receptor 1A (5‐HTR1A), tryptophan hydroxylase 1 (TPH1) and one of the serotonin transporters (SLC6A4).
Materials and methods
Animals
Three‐spined sticklebacks were caught in Askö, Östersjön, the 18th of May 2011.
The fish were kept in a 700L tank, with water containing 0.5% salinity, at 20°C with 16 hours of light a day. Three weeks later, the sticklebacks (n=26) were euthanized by an overdose of benzocaine (ethyl p‐aminobenzoate) and their brains were dissected and stored at ‐20°C in RNAlater (Ambion®) until use. The sex and infection status of the fish were also determined.
RNA extraction, DNase treatment and cDNA synthesis
RNA was extracted from whole brain using GenElute Mammalian Total RNA Miniprep Kit (Sigma‐Aldrich). The brains were thawed on ice and lysed by sonication. The subsequent steps were performed following the manufacturer’s instructions. A ND‐1000 Spectrophotometer (NanoDrop) was used in order to measure the RNA concentration and purity of the samples. The extracted RNA was stored at ‐80°C until later use.
A rigorous DNase treatment of the extracted RNA was done using TURBO DNA‐free Kit (Ambion), according to the manufacturer’s protocol. The samples were diluted to a concentration of 0.2µg nucleic acid/µL and the reaction sizes used were 25µL. After incubation with TURBO DNase, the RNA concentration and purity of the samples were again measured by spectrophotometry. Two samples were excluded after the DNase treatment due to low RNA concentrations. Information about the fish included throughout the whole experiment can be seen in Table 1.
After DNase treatment, cDNA was synthesized using Maxima First Strand cDNA Synthesis Kit for RT‐qPCR (Fermentas) in accordance with the manufacturer’s instructions. The reaction mixture contained 1µg template RNA and the product of the first strand cDNA synthesis was diluted 40‐fold (0.00125µg/µL) and stored at ‐20°C for subsequent quantitative real‐time RT‐
PCR (RT‐qPCR).
Table 1. Sticklebacks analysed with RT‐qPCR
Primer design and gene expression analysis
Exon specific primers (Table 2), surrounding one intron, were designed using Primer‐BLAST (NCBI website) and ordered from Invitrogen. The reference genes were selected using the GeNorm 3.5 software. This software compares a set of genes, in order to determine the most stable reference genes, and calculates a gene expression normalization factor for each sample based on the geometric mean of a defined number of reference genes.
Quantification of 5‐HTR1A, SLC6A4 and TPH1 relative to the reference genes (ATG16L1, H3F3B and β‐actin) was done using RT‐qPCR, carried out in a 7900HT Fast Real‐Time PCR System machine (Applied Biosystems), and analysed with SDS 2.3 software. Reactions were run in duplicate and contained a volume of 10µL. 5ng of cDNA and primers in a concentration of 0.5µM were run together with 1x Maxima® SYBR Green/ROX qPCR Master Mix (x2) (Fermentas).
The PCR cycling conditions were: initial denaturation for 10 min at 95°C, followed by 45 cycles of denaturation for 30 s at 95°C, annealing for 30 s at 60°C and elongation for 30 s at 72°C. At the end of the program a dissociation curve was included; 95°C for 15 s followed by 60°C for 15 s and 95°C for 15s.
Dissociation curves were used to ensure amplification of one single PCR product.
A dilution series, containing a cDNA mix of the samples, were made in order to run a standard curve in parallel with each gene. The cDNA mix, in a concentration of 0.005µg/µL, was serial diluted 4‐, 16‐, 64‐ and 256‐fold and the quantity of the transcripts in each well was calculated through comparison with the standard curve.
Sex Status Quantity (n)
Female Infected 6
Female Non‐infected 10
Male Infected 5
Male Non‐infected 3
Table 2. PCR primer design
Data analysis and statistics
To obtain normalization factors for each sample, the GeNorm 3.5 software was used. Following RT‐qPCR, these factors were calculated through analysis of the mean quantity of the reference genes for each sample. Subsequently, the mean quantity of the target genes for each sample was divided with the normalization factor for the corresponding sample.
Normalized data for gene expression of the target genes were analysed by two‐way analysis of variance (ANOVA).
Results
In order to investigate the expression of 5‐HTR1A, SLC6A4 and TPH1 in whole brain and evaluate if there are any differences between sticklebacks infected with S. solidus and non‐infected sticklebacks a RT‐qPCR analysis was done. Prior to RT‐qPCR analysis, brains were homogenised followed by RNA extraction, DNase treatment and cDNA synthesis.
Two different primer pairs were run on the SLC6A4 gene, for which both dissociation curves showed more than one product. Consequently, the expression of this target gene was not further investigated.
There was no significant effect of infection on 5‐HTR1A gene expression (Fig. 1), even though there appeared to be an interaction between sex and parasite infection (F1,24=3.507, p=0.076) with lower 5‐HTR1A expression in infected females. However, this effect did not reach the level of statistical significance.
Protein Task Primer sequences (5’‐3’) Accession number
Autophagy related 16‐like 1 (ATG16L1) Reference F‐GCGCGGATCTGGATGGAGGC
R‐AACACTCAGCACGCCGCTCC ENSGACT00000001833 Histone, family 3B (H3F3B) Reference F‐GCGGGGTGAAGAAGCCCCAC
R‐GGCTTCCTGCAGGGCACCAA
ENSGACG00000008983
β‐actin Reference F‐ GTTCCGTTGCCCAGAGGCCC
R‐ GCATCCTGTCGGCGATGCCA DQ018719.1
5‐hydroxytryptamine receptor 1A (5‐
HTR1A) Target F‐GACGGCACGAACGCGGTAACT
R‐AGCGATGGCAGCCACAACGC ENSGACG00000006930 Tryptophan hydroxylase 1 (TPH1) Target F‐CGGTGCTCGAGGGGCGGAAT
R‐TGGTTGCTGTCGCAGTCCACA ENSGACG00000005752
Solute carrier family 6
(neurotransmitter transporter, serotonin), member 4 (SLC6A4)
Target F‐CTCGGGGCTCTCTCCACGCT R‐GGCAGATGGCCACCCAGCAG
ENSGACG00000006192
There was no effect of parasite infection on TPH1 gene expression (Fig. 2) but a clear sex effect (F1,24=27.5, p<0.0001) with females showing significantly higher expression than males.
Fig. 1. RT‐qPCR analysis. Relative expression of 5‐HTR1A in whole brain from infected and non‐infected female (n = 6 and 10, respectively) and infected and non‐infected male stickleback (n = 5 and 3, respectively). Bars represent the mean ± S.E.M. There was no significant difference in expression between infected and non‐infected fish.
Fig. 2. RT‐qPCR analysis. Relative expression of TPH1 in whole brain from infected and non‐infected female (n = 6 and 10, respectively) and infected and non‐infected male stickleback (n = 5 and 3, respectively). Bars represent the mean ± S.E.M. Asterisks (***) show a significant difference (p<0.0001) in TPH1 expression between males and females. There was no significant difference in expression between infected and non‐
infected fish.
Discussion
The results from this study show a tendency towards lower 5‐HTR1A expression in infected females. It is possible that this tendency would be significant if RT‐
qPCR analysis were done on more fish. Furthermore, the expression of TPH1 show now significant difference in infected sticklebacks compared to non‐
infected conspecifics, which indicate that S. solidus has no influence on the expression of this gene. However, there is a clear a sex difference in the expression of TPH1 where female sticklebacks show a significantly higher gene expression compared to males.
The tendency of down regulation of the 5‐HT1A receptor in infected female sticklebacks could be interpreted as a potential reason for the increased serotonergic activity seen in a previous study (Overli et al. 2001). Overli et al.
(2001) found a significantly higher serotonergic activity in the brain stem and hypothalamus of infected female sticklebacks, compared to non‐infected females.
5‐HT1A receptors are inhibitory Gi/0 coupled receptors that are expressed throughout the brain as either autoreceptors or heteroreceptors (see McDevitt &
Neumaier 2011 for review). Autoreceptors are expressed in serotonergic neurons, whereas non‐serotonergic neurons express the 5‐HTR1A gene as heteroreceptors. Consequently, only the 5‐HT1A autoreceptors have an impact on the serotonergic activity in the brain (McDevitt & Neumaier 2011). Therefore, I find it plausible that the autoreceptors could be the receptors that show a tendency of down regulation, which secondarily could lead to the increased serotonergic activity in infected female sticklebacks. The differentiation between 5‐HT1A auto‐ and heteroreceptors is complicated (McDevitt & Neumaier 2011).
To facilitate this differentiation and further investigate whether the tendency of 5‐HTR1A down regulation in S. solidus‐infected females concerns the autoreceptors, a dissection of the raphe nuclei could be done in order to measure 5‐HTR1A expression in this specific region. In the vertebrate brain, there are serotonergic cell bodies concentrated to the raphe region (see Winberg &
Nilsson 1993 for review), thus 5‐HT1A autoreceptors, which are localised somatodendritically (McDevitt & Neumaier 2011), are also found here.
The result for the TPH1 gene expression in this study showed no significant difference between infected and non‐infected sticklebacks. This gene encodes for the rate‐limiting enzyme in the serotonin synthesis (Winberg & Nilsson 1993), therefore I expected an up regulation of TPH1 in infected sticklebacks that would give rise to the elevated concentrations of serotonin observed by Overli et al.
(2001). In addition to TPH1, three‐spined sticklebacks also have a gene encoding for TPH2 (see Lillesaar 2011 for review), therefore it may be of interest to investigate whether this gene shows an altered expression in sticklebacks infected with S. solidus.
Apart from the raphe nuclei, the fish brain also has regions of serotonergic neurons in the hypothalamus (Lillesaar 2011). Today, the function of these neurons is unclear, but it is suggested that they are cerebrospinal fluid (CSF)‐
contacting with a sensory function. In zebrafish (Danio rerio), the TPH2 gene is expressed in the raphe nucleus, whereas the TPH1 gene is expressed in the hypothalamus (Lillesaar 2011). If this also refers to sticklebacks, and if the serotonergic neurons in the hypothalamus are CSF‐contacting, the sex difference
observed in the expression of TPH1 could maybe be explained by these cells binding to a substance, for example a sex hormone, that induces the expression of the TPH1 gene in females, or suppresses the gene expression in males.
In addition to the serotonin system, it would be interesting to analyse other neurotransmitter systems in the brains of sticklebacks to further investigate if they are affected by infection with S. solidus. One suggestion could be the GABA system. It has been reported that this system is involved in the behavioural alterations of larval coral reef fish living in water with elevated levels of carbon dioxide (Nilsson et al. 2012). For example, these fish show an attraction to odours that they normally avoid (e. g. predator odour) which is generated by an impaired olfactory function mediated by changes in the GABAA receptor signalling, caused by the carbon dioxide (Nilsson et al. 2012). This is an example of a total shift in behaviour, which the behavioural alterations of infected sticklebacks also could be. Thereby, it is possible that this system also contribute to the observed changes in behaviour of S. solidus‐infected sticklebacks.
This study examined the effects of infection on the expression of two serotonin related genes in brains of three‐spined sticklebacks. In conclusion, the parasite does not seem to influence the expression of TPH1, whereas parasite infection show a tendency towards lower 5‐HTR1A expression in infected females. To bring clarity to what triggers the increased serotonergic activity and to understand the underlying mechanisms responsible for the observed behavioural alterations of S. solidus‐infected sticklebacks, further investigations are needed.
References
Barber, I. & Huntingford, F. A. 1995 The effect of Schistocephalus solidus (Cestoda:
Pseudophyllidea) on the foraging and shoaling behaviour of the three‐spined sticklebacks, Gasterosteus aculeatus. Behaviour 132, 1223‐1240.
Barber, I. & Scharsack, J. P. 2010 The three‐spined stickleback‐Schistocephalus solidus system: an experimental model for investigating host‐parasite interactions in fish.
Parasitology 137, 411‐24.
Barber, I., Walker, P. & Svensson, P. A. 2004 Behavioural responses to simulated avian predation in female three spined sticklebacks: The effect of experimental Schistocephalus solidus infections. Behaviour 141, 1425‐1440.
Bråten, T. 1966 Host specificity in Schistocephalus solidus. Parasitology 56, 657‐664.
Cunningham, E. J., Tierney, J. F. & Huntingford, F. A. 1994 Effects of the cestode Schistocephalus solidus on food intake and foraging decisions in the three‐spined stickleback, Gasterosteus aculeatus. Ethol 97, 65‐75.
Engelsma, M. Y., Huising, M. O., van Muiswinkel, W. B., Flik, G., Kwang, J., Savelkoul, H. F. &
Verburg‐van Kemenade, B. M. 2002 Neuroendocrine‐immune interactions in fish:
a role for interleukin‐1. Vet Immunol Immunopathol 87, 467‐79.
Giles, N. 1983 Behavioural effects of the parasite Schistocephalus solidus (Cestoda) on an intermediate host, the three‐spined stickleback, Gasterosteus aculeatus L. Anim Behaviour 31, 1192‐1194.
Heins, D. C. & Baker, J. A. 2008 The stickleback‐Schistocephalus host‐parasite system as a model for understanding the effect of a macroparasite on host reproduction.
Behaviour 145, 625‐645.
Helluy, S. & Thomas, F. 2003 Effects of Microphallus papillorobustus (Platyhelminthes:
Trematoda) on serotonergic immunoreactivity and neuronal architecture in the brain of Gammarus insensibilis (Crustacea: Amphipoda). Proc Biol Sci 270, 563‐8.
Landeau, L. & Terborgh, J. 1986 Oddity and the 'confusion effect' in predation. Anim Behaviour 34, 1372‐1380.
Lillesaar, C. 2011 The serotonergic system in fish. J Chem Neuroanat 41, 294‐308.
Lin, X., Volkoff, H., Narnaware, Y., Bernier, N., Peyon, P. & Peter, R. 2000 Brain regulation of feeding behavior and food intake in fish. Comp Biochem Physiol A 126, 415‐434.
Maynard, B. J., DeMartini, L. & Wright, W. G. 1996 Gammarus lacustris harboring Polymorphus paradoxus show altered patterns of serotonin‐like immunoreactivity. J Parasitol 82, 663‐6.
McDevitt, R. A. & Neumaier, J. F. 2011 Regulation of dorsal raphe nucleus function by serotonin autoreceptors: a behavioral perspective. J Chem Neuroanat 41, 234‐46.
Ness, J. H. & Foster, S. A. 1999 Parasite‐associated phenotype modifications in threespine stickleback. Oikos 85, 127‐134.
Nilsson, G., Dixson, D., Domenici, P., McCormick, M., Sorensen, C., Watson, S. & Munday, P.
2012 Near‐future carbon dioxide levels alter fish behaviour by interfering with neurotransmitter function. Nature Clim Change 2, 201‐204.
Ohguchi, O. 1981 Prey density and selection against oddity by threespined sticklebacks.
Adv Ethol 23, 1‐79.
Overli, O., Páll, M., Borg, B., Jobling, M. & Winberg, S. 2001 Effects of Schistocephalus solidus infection on brain monoaminergic activity in female three‐spined sticklebacks Gasterosteus aculeatus. Proc Biol Sci 268, 1411‐5.
Scharsack, J. P., Koch, K. & Hammerschmidt, K. 2007 Who is in control of the stickleback immune system: interactions between Schistocephalus solidus and its specific vertebrate host. Proc Biol Sci 274, 3151‐8.
Thomas, F., Adamo, S. & Moore, J. 2005 Parasitic manipulation: where are we and where should we go? Behav Processes 68, 185‐99.
Tierney, J. F. & Crompton, D. W. 1992 Infectivity of plerocercoids of Schistocephalus solidus (Cestoda: Ligulidae) and fecundity of the adults in an experimental definitive host, Gallus gallus. J Parasitol 78, 1049‐54.
Winberg, S., Myrberg, A. A. & Nilsson, G. E. 1993 Predator exposure alters brain serotonin metabolism in bicolour damselfish. Neuroreport 4, 399‐402.
Winberg, S. & Nilsson, G. E. 1993 Roles of brain monoamine neurotransmitters in agonistic behaviour and stress reactions, with particular reference to fish. Comp Biochem and Physiol 106C, 597‐614.
