The presence and function of the Hippo pathway in Embryonic Stem cells
Wang Yan
Degree project inapplied biotechnology, Master ofScience (2years), 2010 Examensarbete itillämpad bioteknik 30 hp tillmasterexamen, 2010
Biology Education Centre and The Department of Medical Biochemistry and Microbiology(IMBIM), Uppsala University
Supervisor: Christoffer Tamm
The presence and function of the Hippo pathway in Embryonic Stem cells
By Wang Yan Abstract
Embryonic stem (ES) cells are one of the most promising resources of regenerative medicine in the future. Further knowledge about ES cells, especially the mechanism how the different factors and pathways function together to control ES cell
self-renewal and pluripotency is the key point to improve ES cell regenerative therapy efficiency and safety. The Hippo pathway has been shown to be a major signaling pathway to control organ size and cell-to-cell contact inhibition. Moreover, previous results in our group have identified putative Hippo pathway downstream
transcriptional factor TEAD and co-activator YAP to be important in self-renewal of ES cell. The purpose of this study is to investigate the presence and function of Hippo pathway in ES cells. Interestingly, the Hippo core components are expressed in mES cells and regulated during the differentiation process. Further on we will define the potential roles of these components role in ES cell self-renewal and differentiation.
Up to now, cell-to-cell contact inhibition in stem cell lines remains elusive. Here we showed that there is higher YAP s127phosphorylation in confluent mouse ES cells butno YAP cytoplasmic localization as in other confluent cell cultures. EdU labeling and other data show proliferation inhibition that is caused by confluence in ES cells is weaker and happens at a later stage, compared to differentiated cells, e.g. NIH 3T3 cells. These results strengthen our hypothesis that cell-to-cell contact inhibition is weak, and the Hippo pathway might be ignored in mES cells.
Tablet of content 1. Introduction
1.1. Origin and property of Embryonic Stem cells
1.1.1Origin and pluripotency of Embryonic stem cells 1.1.2 Selfnewal and maintainence of Embryonic stem cells
1.1.2.1 Extrinsic factors
LIF (Leukaemia-Inhibitory Factor) Wnt
BMP TGF beta 1.1.2.2 Intrinsic factors
Oct4 SOX2 Nanog
1.1.3. Induced pluripotent stem (iPS) cells 1.2. Hippo pathway and cell-to-cell contact
1.2.1 Hippo pathway signal transduction and its biological function.
1.2.2 Hippo pathway and cell-to-cell contact inhibition in cell cultures 1.2.3Hippo pathway in cancer biology
1.2.4 Known function of hippo components in ES cell and early embryo 1.2.4.1TAZ/YAP/TEAD2 in ES cell self-renewal
1.2.4.2 Hippo pathway’s crosstalk with other signaling pathway in ES cells
1.2.4.3 Lats/YAP/TEAD in early embryo
1.3. Cell-cell contact and signal transduction in Embryonic Stem cell 2. Aim of study
3. Material and Methods
3.1 Embryonic stem cell and NIH 3T3 culturing 3.2 Immunofluoresent staining
3.3 Quantitative real-time polymerase chain reaction (qPCR) 3.4 Cytosol fractionation
3.5 Flow cytometry 3.6 Western blot 3.7 Cell growth curve 3.8 Transfection procedures 3.9 Luciferase reporter assay 4. Results
4.l. The Hippo core components are expressed in mES cells and are regulated during the differentiation process.
4.2. YAP is not localized to the cytosol in confluent mES cells.
4.3. Cell cycle distrubution is slightly affected by cell density in mES cells.
4.4. Cell-to-cell contact cell proliferation inhibition occurs at much later stages in mES than in the NIH 3T3 cells.
4.5. YAP manipulation could affect the promoter activity in both positive and negative way.
5. Discussion
5.1. Hippo pathway in mES cell fate determination 5.2. Yap localization in mES cells
5.3. Weak or total lack of cell-to-cell contact inhibition of mES cell proliferation 5.4. The role of TEADs in cell-to-cell contact inhibition of mES cell proliferation.
5.5. Src cell density dependent kinase activity and YAP tyrosine phosphorylation.
6. Future work
7. Acknowledgements 8. References
9. Figures
1. Introduction
1.1. Origin and property of Embryonic Stem cells 1.1.1 Origin and pluripotency of
The blastocyst, an early-stage embryo 4
cells of two types: the inner cell mass (ICM) and trophoblast (ES) cells, which are derived from
The continuous human ES cell
cultivated in an undifferentiated state on fibroblast feeder cell become a powerful tool both
research. Embryonic stem cells are characterized by two distinct properties:
pluripotency and the capability blastocyst and differentiate into
germ cells3,4. Chimera formation and germline transmission make knock-out mice, which
animal development and human disease research.
Figure1. Structure of blastocyst 1.1.2 Self-renewal and maint
Both intrinsic and extrinsic factors are essential for the self Because of the importance of ES cell
interest in discovering more factors that may maintenance.
1.1.2.1 Extrinsic factors LIF
The most critical pathways regulating self mediated by Leukaemia-Inhibitory Factor
Origin and property of Embryonic Stem cells Origin and pluripotency of embryonic stem cells
stage embryo 4–5 days post fertilization, contain
inner cell mass (ICM) and trophoblasts. Mouse embryonic stem , which are derived from the ICM, were first isolated and cultured in 1981 continuous human ES cell line was first established in 19982. The ES cell cultivated in an undifferentiated state on fibroblast feeder cells, are a thought to
both for medical therapy and in vast areas of scientific Embryonic stem cells are characterized by two distinct properties:
pluripotency and the capability of self-renewal. They can be injected back blastocyst and differentiate into all parts of the newborn chimaera pups
himera formation and germline transmission provide the possibility to out mice, which today is the most powerful and fundamental tool in
ent and human disease research.
lastocyst
and maintenance of embryonic stem cells
Both intrinsic and extrinsic factors are essential for the self-renewal of ES cells.
Because of the importance of ES cells in regenerative medicine, there is a great more factors that may play essential roles in ES cell
The most critical pathways regulating self-renewal in mouse ES (mES)
Inhibitory Factor (LIF)5. During ES cell culturing part of the 5 days post fertilization, contains 50–150
embryonic stem isolated and cultured in 19811.
. The ES cells can be are a thought to
scientific Embryonic stem cells are characterized by two distinct properties:
back into the aera pups, e.g. skin or provide the possibility to most powerful and fundamental tool in
renewal of ES cells.
there is a great in ES cell
(mES) cells are those ES cell culturing part of the
LIF needed to sustain the ES cells is usually supplied by the fibroblast feeder layer and the rest is added to the growth medium. LIF/receptor interaction leads to heterodimerization of two LIF-specific receptor subunits LIFRβ and the gp130 subunit, as well as a conformational change in the intracellular part of the receptor and activation of four different downstream pathways: JAK (Janus tyrosine
kinase)/STAT (signal transducer and activator of transcription), Ras/ERK1/2
(extracellular-signal-related kinases 1/2), PI3K (phos- phoinositide 3-kinase) and SFK (Src family kinase) pathways6. Notably, STAT3 activation is sufficient to prevent mES cell differentiation in the presence of serum7.
Wnt
Unlike the different roles of LIF in mouse and human ES cells, evidence has been provided that the Wnt pathway could be critical in the maintenance of both human and mouse ES cells pluripotency8. Activation of the Wnt pathway by
6-bromoindirubin-3-oxime (BIO), a specific pharmacological inhibitor of glycogen synthase kinase-3, can maintain the undifferentiated phenotype of ES cells and sustain expression of the ES cells specific markers Oct4, Rex1 and Nanog. Wnt signaling is endogenously activated in ES cells and is downregulated upon differentiation9. Wnt signaling activation can upregulate STAT3 expression, suggesting that it could be an intersect from LIF mediated pathway10. BIO may provide a huge improvement in human ES cell culture techniques and prevent cross-species contamination from mouse feeder cells for future transplantation surgery.
BMP
LIF is insufficient to maintain mES self-renewal under serum-free conditions. Several factors in serum has been show to help LIF to sustain the undifferentiated state, such as bone morphogenetic protein 4 (BMP4)11. BMP4 have been shown to phosphorylate Smad1/5 in both human and mouse ES cells. Smad1/5 activation results in the
expression of inhibitor of differentiation (Id) protein, which blocks neural differentiation11. However, in contrast to the selfrenewal function in mES cells, BMP4 leads to hES cells trophoblast or primitive endoderm differentiation12. TGFb/Activin/Nodal pathway
TGFb/Activin/Nodal pathway includes TGFb superfamily and its correlated factors, e.g Nodal. Activin A, a TGFb member is known as the mouse embryonic feeder secretion component that can sustain human undifferentiated state in absence of condition medium (CM) or STAT3 activation13. This pathway is activated through the transcription factors Smad2/3 in undifferentiated cells. Smad2/3 activation
suppresses Smad1/5 activity, thus TGFb/Activin/Nodal can negatively regulate BMP4 in human ES cells13,14. Smad2/3 activity is not necessary for maintenance of
undifferentiated state in mouse ES cells14. The interaction of TGFb pathway with other pathways in ES cells and its role in self-renewal still needs to be elucidated.
1.1.2.2 Intrinsic factors
To date there is an abundance of transcription factors known to be involved in both self-renewal and differentiation of ES cells.
Oct4
Oct4 is highly expressed in human and mouse ES cells, and its expression diminishes when these cells differentiate and lose their pluripotency. Expression levels of this gene are controlled in a window, or the ES cells will differentiate. Hence, the level of Oct 4 is an important determination of cell fate15,16. Loss of Oct4 results in
differentiation of ES cells into trophectoderm, whereas over-expression of Oct4 results in differentiation into primitive endoderm and mesoderm17. Several target genes of Oct4 in ES cells have been identified, and these include Fgf4, Utf1, Opn, Rex1/Zfp42, Fbx15, and Sox28.
Sox2
Sox2 is an HMG-family protein, which together with Oct4 as a complex, targets many genes required for ES cells pluripotency sustenance. Sox2 is expressed in ES cells, early embryos, germ cells and neural stem cells, which may indicate a general
stemness factor role of Sox218. Disruption of Sox2 in mouse ES cells with conditional knockout or RNAi results in rapid differentiation19.
Nanog
Nanog is a major regulator of the pluripotent state. Mouse ES cells with Nanog overexpression can self-renew in absence of LIF, although the self-renewal capability is reduced. Nanog disruption in ES cells results in differentiation to endoderm
lineages.21,22. Nanog regulates pluripotency mainly via transcriptional repression of downstream differentiation genes and the activation the other self-renewal genes, e.g.
Rex1. Rex1 is also a target gene of the Oct4/Sox2 complex22. 1.1.3. Induced pluripotent stem (iPS) cells
The transcription factors described above are sufficient to reprogram somatic cells into induced pluripotent stem (iPS) cells23,24. Previous accumulated knowledge of these self-renewal factors lead to this revolutionary breakthrough. The groups of Yamanaka and Thomson used different combination of factors (Sox2, Oct4, c-Myc, Klf 4)23and (Oct4, Sox2, Nanog, and Lin28)24to produce mouse and human iPS cells.
iPS cells was recently shown to be capable to generate full-term mice via tetraploid blastocysts complementation, which demonstrates its full pluripotency25. The therapeutic potential of iPS cells has been assessed in Sickle-cell disease and hemophilia A mouse models26,27. Transplantation of hematopoietic progenitors derived from corrected iPS cells significantly suppresses the symptoms of sickle cell anemia26. Similar therapeutic effect was also acquired on the hemophilia A mouse, which prevented death from bleeding27. The iPS cells are an attractive resource of regenerative medicine, because of two major advantages. First, iPS cells can be produced from patients’ own somatic cells to avoid immunological rejection problem in transplantation. Second, there is no ethical issue in iPS cells as adaption of embryos
or oocytes. The safety issues are the main obstacle needed to be overcome from the lab research to clinical applications, e.g the oncogenic potential of iPS. The future research of ES cell self-renewal and differentiation factors could be very helpful to improve the efficiency and safety of iPS cells.
1.2. Hippo pathway and cell-to-cell contact
1.2.1 Hippo pathway signal transduction and its biological function.
Mechanisms controlling organ size is an important area of biological research. The Hippo pathway has been shown to be a major organ size control signaling pathway28. Components of the Hippo pathway have been shown to be preserved in Drosophila and mammals, and include Mst1/2 (the mammal homolog to the Drosophila protein Hpo), WW45 (Sav homolog), Lats1/2 (Wts homolog), Mob1 (Mats homolog), and the Yes-associated protein (YAP) and its paralog transcriptional coactivator with PDZ binding motif (TAZ), both Yki homologs, as well as NF2 (Mer homolog), FRMD6 (Ex homolog), and Fat4 (Fat homolog)28. The TEAD (TEA domain) family
transcription factors are a type of newly discovered conserved key transcription factor downstream of YAP/TAZ to mediate Hippo pathway biological functions29. At the present the Hippo pathway is thought to be initiated via cell-to-cell contact, which subsequently induces a kinase cascade involving the core components Lats1/2, Mst1/2, WW45 and Mob130. The biochemical mechanisms of Mer, Ex and Fat in regulation of the Hippo pathway core components are not clear. In the mammalian Hippo pathway kinase cascade, Mst is considered to the most central factor on the basis of its capacity to phosphorylate all three other core components, Lat, WW45, Mob. Mst1/2
phosphorylates Lats1/2 on the activation loop and hydrophobic motif31. There are SARAH domains on WW45 and Mst to form an interface to facilitate phosphorylation by Mst32. Phosphorylation by Mst1/2 enhances Mob1interaction with Lats133. Activation of Lats leads to the serine phosphorylation and ensuing cytoplasmic localization of YAP/TAZ/Yorkie transcription co-activators with the help of protein 14-3-328. One of the most intriguing questions right now is; which cell-cell contact signal or adhesion molecular is actually initiating Hippo signal transduction?
The Hippo pathway limits organ size by inhibiting cell proliferation and promoting apoptosis. Such regulation is achieved at least partly by transcriptional activation of target genes like cycE and diap134. Inducible YAP overexpression could give a severe reversible increase in liver size35. Moreover, TEAD1/2 double knockout mice embryo shows a similar reduced cell proliferation and increased apoptosis phenotype as YAP knockout embryo36. It indicates that YAP control organ size via TEAD1/2 by cell proliferation and apoptosis regulation in mammals.
Figure. 2 The signal transduction of Hippo pathway in Drosophila and mammals28.
homolog components in Drosophila and mammals are shown in the same color. Dashed arrows indicate unknown biochemical mechanism and question marks repesents unknown components
1.2.2 Hippo pathway and cell-to-cell contact inhibition in cell cultures A fundamental property of in vitro cultured cells is to cease proliferation upon
reaching confluence, a phenomenon referred to cell contact inhibition37.How the cells sense the confluence in vitro is a puzzle as well as the question how the cells sense the organ size in vivo. Results up to date show that Hippo pathway components function in a similar manner in sensing cell confluence and organ size. First, Mer has been shown to regulate YAP localization and inhibit its activity in cell culture30. Second, overexpression of YAP increases saturation cell density in NIH-3T3 cell culture, a mouse fibroblast cell line30. It is a typical lack of cell-to-cell contact phenomenon. A dominant negative form of TEAD2 can mimic this lack of cell-to-cell contact
inhibition by the YAP overexpression in NIH 3T3 cell38. Loss of function evidence in vitro also shed light on discovering the function of endogenous YAP and the Hippo pathway in organ size. Replacement of the activation domain of YAP converts it into weak or strong co-repressors of TEAD strongly reducing cell proliferation rate and saturation density. Although the function of endogenous YAP in vivo still remains elusive, an organ size decrease in a YAP conditional knockout mouse might be speculated. More importantly, a dominant-negative form of YAP restores contact inhibition in the human renal adenocarcinoma cell lines ACHN, which has a Sav defect and thus a loss of a functioning Hippo pathway, and stops the cells from growing on top of each other30. This provides a promising target to decrease the malignancy in various cancers. Cell cultures provide convenient in vitro model to study the Hippo pathway and organ size control mechanisms.
1.2.3 Hippo pathway in cancer biology
Escaping of cell-to-cell contact inhibition is one of the main properties of cancer cells, which facilitates the tumor invasion and metastasis. Since the main function of the Hippo pathway is cell-to-cell contact inhibition, it has become a research hot spot in cancer research. YAP is to date considered to be a candidate oncogene because it presence in human chromosome 11q amplicon, which is very common in several human cancer39,40. There are some experiments supplying evidence for YAP’s oncogenic function. YAP overexpression in MCF10A cells induces
epithelialmesenchymal transition (EMT), which is very important in cancer
metastasis39. Inducible YAP overexpression could initiate presence of nodules and eventually develop tumors35. Many results have also indicated tumor-suppressor function of Hippo pathway upstream components, which is consistent with YAP’s oncogenic role28. Because of the similar indefinite proliferation ability of the ES and cancer cells, it is very interesting to dissect how the Hippo pathway is involved in ES cell self renewal, and how it escape from the Hippo pathway mediated cell-to-cell contact inhibition.
1.2.4 Known function of Hippo pathway components in ES cell and the early embryo
1.2.4.1 TAZ/YAP/TEAD2 in ES cell self-renewal
Several components in the Hippo pathway have been show to be involved in ES cell self-renewal, e.g. TAZ/YAP and TEAD2. TAZ has been shown to maintain hES cell pluripotency by binding Smad2/3-4 and contribute to its nuclear accumulation under TGF activation. Loss of TAZ leads to inhibition of TGF signaling and
differentiation of hES cells into a neuroectoderm lineage41. Transcriptional profiling of mES cells found an enrichment of the YAP and TEAD2 in mES cells42, and silencing of these genes results in a significant decrease in ES cell colony formation capacity (Tamm et al, unpublished data). In addition, inhibition of TEAD2 activity causes differentiation of ES cells into primitive endoderm, whereas an up-regulation of TEAD2 results in differentiation into what is suspected to be trophectoderm (Tamm et al, unpublished data). Three-dimensional EB5 cell aggregates, a mouse ES cell line, has been done to examine whether the degree of cell-cell contact can regulate the subcellular localization of YAP. According to that study YAP was only detected in the cytoplasm of cells internal of the aggregates, whereas YAP was detected in both the nucleus and cytoplasm of the outer cells43.
1.2.4.2 Hippo pathway’s crosstalk with other signaling pathway in ES cells The crosstalk between the Hippo pathway and other signaling pathways especially in ES cells is another key question needed to be addressed. A recent study has revealed a link between BMPs and the Hippo pathway44. Both these signaling cascades have the capacity to control organ size. YAP is recruited to BMP-activated Smad1 in response to BMP in mES cells. Both these two factors were bound to the BMP-responsive region of Id1 and Id2 when these genes were actively transcribed44. The effect of BMPs on the expression of Id genes was inhibited by YAP knockdown. Both BMPs
and YAP act as suppressors of neural differentiation45,46. YAP was showed to support the ability of BMPs to block neural lineage commitment through the activation of Id family members.
1.2.4.3 Lats/YAP/TEAD in early embryo
In the early embryo, the level of nuclear YAP seems to be one of the determinants of ICM and trophoblast cell fate43. After the 8-cell stage, levels of nuclear YAP
increased in the outside cells up to the 30-cell stage and remained constant thereafter, whereas nuclear YAP decreased in inside cells and YAP appeared to be excluded from the nucleus. In the inner cells, the YAP phosphorylation and cytoplasmic accumulation is induced by the Hippo signaling pathway component Lats. Tead4 activity is suppressed in inside cells by cell-to-cell contact and Lats-mediated inhibition of nuclear YAP localization43. In the outside cells, YAP nuclear
localization leads to Tead4 activation and promotes trophectoderm development. At the mid/late blastocyst stage, nuclear YAP is thus restricted to outside cells of the trophectoderm and was not detected in the ICM43.
1.3. Cell-cell contact and signal transduction in ES cell
The cell-to-cell contacts, which include cadherins and connexin, are involved in signal transduction in ES cells proliferation, self-renewal and differentiation. ES cells deficient in connexin-43 showed aberrant neuroectodermal specification and lineage commitment, highlighting the importance of cell-to-cell contact in determination of cell fate in differentiation47. E-cadherin knockout mES cells lose their cell-cell contact and result in undifferentiated phenotype in absence of LIF. The optimal medium for the maintenance of Ecad-/- ES cells in an undifferentiated state represents a
combination of Activin A, Nodal, which are essential for undifferentiated state maintainance, and FGF-2, which is required for cellular proliferation.
Activin/Nodal-dependent and LIF/BMP-dependent signaling pathways are
alternatively functional within ES cells, and the cell-cell contact mediated signal is important in the ES cell self-renewal48. There are two well known facts in ES cell culturing concerning the cell-to-cell contact. First, human ES cells are optimal to seed out in clumps consist of several dozen cells. The single cell seeds will lead to poor cell survival. This phenomenon indicates cell-cell contact mediated cell proliferation signal is important in hES cell proliferation. Second, when two mouse ES cell colonies attach to each other, the cells on the fringe will differentiate. The cell-cell contact has great impact on the ES cell differentiation.
2. Aim of the study
In this study, we have focused on Hippo pathway’s potential role in mES cell cell-to-cell contact. Previously, our group has identified cYes, YAP, TEAD2 to be important in self-renewal of ES cells as a pathway (Tamm et al, unpublished data). As YAP is the putative downstream activator in the Hippo pathway, it is very intriguing to identify the role of this pathway in ES cell self-renewal. Our previous finding
indicated that both the silencing and overexpression of YAP lead to ES cell differentiation, and it failed to establish a stable expressed YAP siRNA cell line.
These problems increase the difficulty for further research in Hippo pathway.
Moreover, YAP could also play a central role in ES cell cell-to-cell contact inhibition.
A possible cell-to-cell contact inhibition in stem cell cultures has not been well defined in previous publications. The aim with this study has been to further define whether there is cell-to-cell contact inhibition and a functioning Hippo pathway in mES cells like in other cell models, e.g. the NIH 3T3 cell line. In our study, mES cells were examined for cell density dependent variations in cell growth speed, cell cycle distribution. YAP S127 phosphorylation levels were examined by Western blot in lysates from cells grown at different densities. Further on we have studied the YAP cytoplasmic localization in confluent mES and NIH 3T3 cells by immunofluoresent staining or fractionized cell lysates by Western blot analysis. There are also ongoing experiments using transient transfections of mES cells with various YAP mutation construct, including constant activate, dominant negative and activate domain-less variants of YAP. The efficiency of these constructs is tested by a TEAD2-enhanced luciferase gene transcription reporter assay. By geneticin selection we can rapidly eliminate untransfected cells and follow the cells for a prolonged period of time. We will try to induce cell-to-cell inhibition in low cell density and reverse the inhibition in the high density by these YAP manipulations.
3. Material and Methods
3.1 Embryonic stem cell and NIH 3T3 culturing mES cells
The E14Tg2a.IV, a polyoma large T-constitutively expressing mouse embryonic stem cell line, was cultivated in the absence of feeder cells on 0.1% gelatin-coated (Sigma) cell culture plastic (Corning). Cells were maintained in Glasgow modified Eagle’s medium (GMEM, Sigma) supplemented with 5% fetal calf serum (Invitrogen), 5%
KnockOutTM Serum Replacement (Invitrogen), 2mM glutamine (Invitrogen), 1x Non Essential Amino Acids (Invitrogen), 1mM sodium pyruvate (Invitrogen), 0.1mM 2-mercaptoethanol (Sigma), and 1000U/ml LIF (Millipore). Cells were cultivated in a humidified atmosphere of 5% CO2 and 95% air at 37°C. Medium was changed every day and cells were split using 0.05% trypsin/EDTA (Invitrogen) every two days to prevent a too high confluency. For ES cell differentiation either grown in the absence of LIF, or in the absence of LIF and with the addition 100 nM retinoic acid (RA).
NIH 3T3
The NIH 3T3 cells were growing in Dulbecco's modified Eagle medium (Invitrogen) with 4.5 g/l glucose (Invitrogen), 4 mM L-glutamine (Invitrogen), 1.5 g/l sodium bicarbonate (Invitrogen) and 10% fetal bovine serum (FBS, Invitrogen).
3.2 Immunofluoresent staining
Immunofluoresent staining was performed according to the standard procedure. The cells were grown on the glass covers (coated with 0.1% gelatin), rinsed with PBS twice, fixed with 4% Paraformaldehyde (Sigma), blocked for 1 h in 1% FBS in PBS with 0.1%
Triton-X (Sigma), and incubated in anti-YAP antibody (Santa Cruz, 1:200) over night at 4°C, then incubate in anti rabbit Alexa Fluor 488 (Invitrogen, 1:400). The nuclei were stained with Hoechst 33342 (Invotrogen), mounted using Fluromount
(Vectashield), and analyzed using fluorescent microscopy (Zeiss).
3.3 Quantitative real-time polymerase chain reaction (qPCR)
Total RNA was extracted from harvested cells using the Qiagen RNeasy Mini kit (Qiagen) according to the manufacturer’s protocol. The RNA concentration and quality was determined using Spectrophotometer (Genequant). First-strand cDNA was
synthesized using the SuperScriptII (Invitrogen) according to the manufacture’s protocol using 1μg RNA and 100 ng random primers. For quantitative amplification, samples were diluted 1:100 and subjected to 40 cycles of quantitative real-time PCR performed in 48-well PCR plates (Bio-Rad) in a Miniopticon Real-Time PCR
Detection System (Bio-Rad). Each PCR reaction contained 2μl cDNA, 6μl dH2O, 10μl SsoFast EvaGreen® Supermix (Bio-Rad) and 2μl 2mM target gene primers. Samples were loaded in duplicates, thoroughly mixed by vortexing, and spun down at 1500 rpm for 1 min before qPCR run. The samples were amplified using the following PCR conditions: 98°C for 1 min, 50 cycles of 95°C for 5 sec, 60°C for 10 sec. The average C(t) value for each gene was normalized against β-actin, calibrated against controls, and the comparative C(t) value (fold change) was calculated using the 2-ΔΔC(t)formula.
The following primers were bought from Invitrogen: Mob1 Forward:
ACCACCAGCACTTTGACTCC Reverse: GCCAACTCACGCCTATCAAT Mst2 Forward: TGGTCCCTTGGCATTACTTC Reverse: AATGTTGGTGGTGGGTTTGT Mst1 Forward: CTCCTACAGCACCCGTTTGT Reverse:
TGAGTTCTCCTCGTCGTCCT WW45 Forward: CAGAGGATGCCACAGAGTCA Reverse: TCCCTCTCATTGTCCAGTCC Lats2 Forward:
GTGTCCACAAGATGGGCTTT Reverse: Lats1 Forward:
TGACTGACTTTGGCTTGTGC Reverse: GAAGGATCTCCCCATTCGTT 3.4 Cytosol fractionation
Cytoplasmic fractionation was done with the SigmaTMCelLyticTMNuclear Extraction kit. Cells were harvested by scraping and centrifuged at 2100rpm for 5min. The cells were resuspended in hypotonic lysis buffer with protease inhibitory cocktails (Roche) and 1mM sodium orhovanadate (Sigma), incubated on ice for 15 minutes to swell, and vortexed vigorously for 10 sec with the adding of IGEOAL CA-630 to 0.6% final concertration. The cytoplamic supernatant was collected after centrifuge at 13000 rpm for 1 min.
3.5 Flow cytometry
Cells were harvested, centrifuged at 1000 rpm for 5 min, and washed with PBS. Cells were resuspened in ice-cold EtOH added slowly while vortexing. Then cells were
centrifuged as above, and resuspended in 500 μl PBS with 5 μg/μl propidiumiodide and 0.5 μg/μl RNAse A and subsequently incubated at RT on orbital shaker for 2 hours at RT and analysed using a FACScan.
3.6 Western blot
Cells were harvested 24h after seed outing wash the cell with PBS once and then spin down again. Then a lysis buffer with the addition of complete protease inhibitor cocktail (Roche) and 1mM sodium orthovanadate (Sigma) was used. Total protein concentration was measured using BCATMProtein Assay Kit to ensure equal loading.
The samples were mixed with Laemmli's loading buffer (2% SDS, 10% glycerol, 5%
2-mercaptoethanol, 0.002% bromphenol blue and 0.0625 M Tris-HCl), boiled for 5-10 min, and loaded to 10% SDS-PAGE at 120V, followed by electroblotting to PVDF transfer membrane (Millipore) 200V for 2 hours. Membranes were blocked for 1h with 5% bovine serum albumin (BSA, Roche) in TBST at RT and subsequently probed overnight with rabbit anti- YAP (1:1000, Abcam); rabbit anti-Serin127-Phrophrylation YAP (1:1000, Santa Cruz); and Rabbit anti- GAPDH (1:1000, Santa Cruz). The membranes were rinsed and incubated with a horseradish peroxidase-conjugated secondary antibody (1:5000, Abcam) and 5% milk. The membranes were subsequently rinsed and developed with ECL reagents for chemiluminescence (Thermo Scientific) and exposed to X-ray autoradiography films (Fujifilm).
3.7 Cell growth curves
The cells were harvested and kept in medium, then centrifuged or diluted to 2-8105 cell/ml (average 20-80 cells in 16 grids area, 0.04 mm2) suspension solution and put in counting chambers (MARIENFELD Bürker 0.100mm×0.04mm2), each sample was accounted in at least 9 (16 girds area). Cells in clumps were less than 10% total cell number. Each sample was cultured in duplicate. The total cell number=total volume of cell suspension × average cell number in 16 grids area ×104(cell/ml). Two kind of plastic plate were used, whose cell growth area 9.5 cm2 and 55.5cm2 for each well. Cell density=total cell number/cell growth area. Doubling time=Time2-1/ log2(Cell Number2/Cell Number1)
3.8 Transfection procedures
Our expression constructs of choice were introduced into the mES cells by transfection with LipofectamineTM 2000 (Invitrogen) according to the manufacture
recommendations. Then 24h post-split LipofectamineTM 2000 and OPTI- MEM® I Reduced Serum Medium (Invitrogen) were mixed with YAP constructs or empty vector control (final concentration 3- 5μg DNA/well). The mixture was mixed by flicking and incubated in room temperature (RT) for 30 min before being added to the cells. Cells were incubated at 37oC for 4h, then twice volume regular ES cell medium with serum was added.
3.9 Luciferase reporter assay
Transfections were performed in 24-well plates with 300ng reporter construct
(pCAGGs-GTIIC,) and euqal amounts of our expression constructs (3-5μg) per well.
For each experiment the same amount of DNA was added to each well. 24-48 h post-transfection cells were lysed in wells using 150μl lysis buffer (10mM Tris-HCl pH 8.0, 1mM EDTA pH 8.0, 150mM NaCl, 0.65% NP40, 0.4mM PMSF and 1mM DTT) for 20 min at 4oC. 50μl cell lysates were transferred to 96-well plates with 100μl luciferase buffer (10mM MgCl2, 100mM KH2PO4 pH 7.8 and 5.5mM ATP).
Samples were assayed for luciferase activity using a Wallac VICTOR 1420 Multilabel Counter (Perkin Elmer) adding 50μl luciferin working solution (100mM KH2PO4 pH 7.8 and 1mM luciferin automatically. The results were normalized against total
protein concentration measured with BCA™ Protein Assay Kit (PIERCE). Values shown are the means of at least three independent experiments run in triplicates.
4. Results
4.l. The Hippo core components are expressed in mES cells and are regulated during the differentiation process.
Our group has identified that cYes, YAP, Tead2 function as a pathway involved in the regulation of self-renewal of ES cells (Tamm et al, unpublished data). Previous results of other groups have also showed that YAP and TAZ are critical in ES cells
maintenance. However, it still remains unclear whether function of YAP and TAZ in ES cells also are a part of a functioning Hippo signaling pathway. In this study we have tried to identify the occurrence and function of an operational Hippo signaling pathway in mES cells. To start, we wanted to identify the expression of the six Hippo pathway core components, since we already had identified the expression of YAP and TEAD2, in our model cell systems: Mst1/2, Mob1, Lats1/2 and WW45(Figure 3A).
We could confirm the expression of all six components in both the mES cell line E14/T and the fibolast cell line NIH-3T3 on mRNA level by RT-PCR. We then assessed the differences between expression levels in the fast growing ES cells compared to their slow-growing differentiated counterparts by quantitive RT-PCR.
We let the cells differentiate under to two conditions; LIF withdrawal and under the induction of RA (100nM). Interestingly, we could see that Mst1 was downregulated about 3 fold under induction of RA after three days and stay on the same level from 4 to 6 days(Figure 3B). WW45 was downregulated about 1.5 fold under induction of RA after three days, and the downregulation increased to 2.5 fold after 6 days (Figure 3B). Lats2 is upregulated about 5 fold under induction of RA after 3 days, and the upregulation decrease to about 3 folds after 6 days (Figure 3B) . The downregulation of Mst1 and WW45 may indicate a lower demand for Hippo pathways mediated cell-to-cell inhibition in differentiated cells, since they have gone through the most rapid growth stage and more of them are kept in quiescent state.
4.2. YAP is not localized to the cytosol in confluent mES cells.
As mentioned in the introduction YAP is a transcription coactivator acting in the cell nucleus, and upon Hippo pathway signaling it is serine phosphorylated and
subsequently retained in the cytosol by binding to factors such as 14-3-3. To possibly
detect the presence of a functioning Hippo pathway induced by cell-to-cell contact in mES cells, we seeded the E14/T cells at various densities and examined YAP
localization. As a positive control we did similar experiments on the NIH 3T3 cells, and concurrent to previous studies30, YAP was predominantly localized in the nuclei at lower cell densities but was translocated to the cytoplasm at higher densities (Figure 4). In addition, in the human breast epithelial cell line MCF10A, which grow in cell colonies just like the mES cells, YAP is preferentially localized to the nuclei in cells at the edge but display cytoplasmic localization in cells toward the center30. However, we could not discern a similar phenomenon in the mES cells (Figure 4). In cell aggregates of the ES cell line EB5 study, a suppressed nuclear YAP localization was shown in the inside cells43, there is no obvious difference between the E14/T cells at the edge and the cells in the center of the colonies. Interestingly, when examining the phosphorylation levels at YAP ser127 in various cell culture densities by Western blotting we could see that both the NIH 3T3 and E14/T had higher levels of ser127 phosphorylation in the cultures with high cell densities (data not shown). Although previous studies claim there to be a correlation between YAP ser127 phosphorylation and the YAP cytoplasmic localization, this does not seem to apply to our mES model system. Additionally, we have performed Western blot analysis of nuclear and cytoplasmic fractions of samples from the various cell densities and we could not detect the presumed increase in cytoplasmic YAP levels in the E14/T cells that should be present at higher cell densities and a functioning Hippo pathway (data not shown).
4.3. Cell cycle distrubution is slightly affected by cell density in mES cells.
To detect a possible halt in proliferation, e.g. a difference in cell cycle distribution or an arrest at a certain phase, we ethanol-fixed and stained E14/T cells from various cell densities with the DNA-stain propidium iodide and analyzed the cell cycle by flow cytometry. In our previous results we could see slight increase in the proportion of G1/G0-phase cells and slight reduction in G2/M-phase cells in the most confluent cells, comparing the least confluent cells (Figure 5A). This could be an effect due to the cell-to-cell contact. The proportion of S-phase and was quite similar in all samples (Figure 5B). To further analyze proliferation we labeled the newly synthesized DNA with EdU, which can be incorporated into the newly synthesized DNA of replicating cells during the S phase of the cell cycle as a substitute to thymidine. Our analysis showed that in the NIH 3T3 cells the EdU positive population decreased from about 60% to 40% at our highest cell density (Figure 6A, C). In contrast, there was no such reduction in the mES cells even though the huge colonies of the mES had a markedly higher density then the NIH 3T3 cells (Figure 6B).
4.4. Cell-to-cell contact cell proliferation inhibition occurs at much later stages in mES than in the NIH 3T3 cells.
Although there was no change in cell cycle distribution as cell densities were increased in the mES cells, we continued to examine the cell expansion speed at different cell densities to further elucidate the presence or lack of a functioning Hippo pathway in mES cell. We seeded both the mES cells and NIH 3T3 cells at low, middle
and high densities. For mES cells, the middle and high densities did not show a big difference in proliferation speed the first or second day after seeding, and after that they reached almost full confluence compared to their growth space. Interestingly, the cells grown at the lowest density showed a slower proliferation rate compared to the other two densities, which might be explained by a decrease of the growth factors that are secreted by mES cells into the medium and is needed for normal mES growth (Figure 7). However at the second day they grew at a similar rate as the highest density-seeded cells. In contrast, the control experiments in the NIH 3T3 cells showed the fastest growth rate in the low and middle density-seeded cells both days after seeding, while at the highest density the growth speed was markedly decreased (Figure 7). Finally, the inhibition of growth rate occurred in much later stage in mES than the NIH-3T3 cells, and is for these cells more likely to be caused by the lack of growth space.
4.5. YAP manipulation could affect the promoter activity in both positive and negative way.
We have recently received several YAP mutant constructs as a kind gift from Dr.
Sasaki at the Riken Center for Developmental Biology in Japan. To elucidate whether these constructs could be used in our experiments we transfected both the E14/T and the NIH 3T3 cells with the constructs together with a reporter construct expressing the firefly luciferase gene driven by the human chorionic somatomammotropin promoter with multiple copies of the TEAD-binding GTIIC (GGAATG) enhanson, after which luciferase activities could be measured. So far we have transformed, propagated and isolated three different YAP constructs; wild-type YAP (YAP full), YAP-S112A where the serine 112 (equivalent to serine 127 in human YAP) was converted to alanine thus inhibiting the cytoplasmic retention due to phosphorylation at this site, and a dominant negative YAP fusion mutant where the transcriptional activation domain of YAP was replaced with the Drosophila Engrailed repression domain (YAP dn) (Figure 8A). Our preliminary data show that over-expression of the wild type YAP increases the activity of TEAD enhanced transcriptional activity 3.4 times compared to its endogenous levels in NIH 3T3 cells (Figure 8B). YAP S112A, which is supposed to be insensitive to Hippo signaling, further increased the TEAD
enhanced transcriptional activity by 40% compared to the wild type YAP full (Figure 8B). The dominant negative mutant reduces the promoter activity to levels lower than those seen at endogenous levels of YAP (Figure 8B). We obtained similar results in both cell lines and could thus conclude that the constructs work as intended in our model systems, and can be used for further experiments.
5. Discussion
5.1. Hippo pathway in mES cell fate determination
Our group has previously shown that YAP is important for mES cell maintenance (Tamm et al, unpublished data). Moreover, the Hippo signaling pathway components Lats2, YAP and TEAD4 have been shown to be essential in distinguishing
trophectoderm from the inner cell mass (ICM) of pre-implantation embryos in mice43. Our qPCR results show that in contrast to the other members of the Hippo pathway, Lats1/2 are either unaffected (Lats1) or slightly upregulated (Lats2) upon early differentiation. It has been hypothesized that the positional information in embryos leads to Lats2 activity and a trophectoderm cell fate for certain specific cells43. In mES cells Lats2 could be important as a differentiation switch for more cell types, although this remains an open question. The reduction of Lats2 between 3 days and 6 days of differentiation might indicate its requirement for the initiation of the
differentiation process, and the expression is therefore reduced after a certain
differentiation stage. Our results may also indicate that Lats2 rather than Lats1 is the major functional homolog in mES cells. Since we do not observe a functioning Hippo pathway when it comes to cell-to-cell induction of growth arrest, the roles of other the Hippo components in mES cells, such as Mst1, WW45 and Mob1 still remains a mystery.
5.2. Yap localization in mES cells
Although we could detect a higher level of YAP phosphorylation at ser127 in the mES cultures with high cell densities, we failed to detect a shift in YAP localization from the nucleus to the cytosol in these cells. At this stage we can only speculate, but there might be further modifications to YAP that reduces its binding to 14-3-3, or that 14-3-3 is not expressed in mES cell and thus rendering the cells unable to retain YAP, serine phosphorylated or not, in the cytsol. Dr. Sasaki and co-workers have previously shown that YAP was detected mainly in the cytoplasm of some of the internal cells of the mES cell line EB5 cell aggregates, whereas YAP was detected in the nucleus and cytoplasm of outer cells of aggregates43. They claimed that this was due to cell-to-cell contact activation of the Hippo pathway, with the subsequent translocation of YAP from the nuclei to the cytosol. Conversely, we made a different observation in our cell model, in which the YAP distribution in nuclear and cytoplasm is homogenous in the E14/T cell colonies and independent of the colony size as well as the position in colony. However, in the NIH 3T3, which frequently has been shown to have a functioning Hippo pathway and cell-to-cell contact-induced inhibition of cell proliferation, we could clearly see a YAP translocation in cells grown in high
densities. This variation seen in mES cells may be explained by different cell culture conditions and cell line differences, but remains to be elucidated.
5.3. Weak or total lack of cell-to-cell contact inhibition of mES cell proliferation Our results showed that the cell cycle distribution is slightly affected by the cell density in mES cells. It means in confluent ES cells, no apparent halt at various cell cycle checkpoints could be observed and no slowing down of the cell proliferation could be perceived. Similar results were obtained when looking at the EdU
incorporation in newly synthesized DNA of dividing cells. While we could see about 30% reduction in EdU positive cells at higher cell densities of NIH 3T3 cells, no such reduction could be seen in the E14/T cells. Moreover, when looking at the doubling times for these cell lines at various cell densities, inhibition of growth speed by
cell-to-cell contact occurred in much later stage in mES than the NIH-3T3 cells. This experiments show that the mES cells are less affected or even not affected at all by the cell-to-cell contact inhibition of high growth confluence. One question that needs to be addressed is whether the small decline in growth speed in mES cells is due at all to Hippo pathway activation or just the lack of growth space. Our results might also indicate a general difference between stem cells and more differentiated cells. The higher malignancy of cancer cells may also be due to a lower cell-to-cell contact inhibition sensitivity or a disfunctioning Hippo pathway.
5.4. The role of TEADs in cell-to-cell contact inhibition of mES cell proliferation.
Studies have shown that YAP mediates the Hippo signaling induced cell growth reduction by co-working with the TEAD family of transcription factors49. What is interesting is that although we do not detect a strong cell-to-cell contact proliferation inhibition in the mES cells, transcriptional profiling of stem cells have revealed an enrichment of both YAP and TEAD2 in ES cells42. This raises the question whether YAP and TEAD actually function as in other cell cultures to control the cell
proliferation and cell cycle, or has a more specific role in stem cells. This would mean that even though there is YAP cytoplasmic localization in the confluent mES cells, it is not sure that a reduced TEAD activation would mediate cell-to-cell contact
inhibition. Embryonic stem cells might not share the same target gene profile with the more differentiated cell, e.g. NIH-3T3 cells. Some genes that are important for
controlling cell cycle and cell proliferation should be always switch on state in mES cells beyond the controlling of transcriptional factors, e.g. TEAD. As the ES cells differentiated, there might be some epigenetic modification and change the always switch on state to an inducible switch on state. At the same time the growth speed is decreasing from the stem cell to the differentiated cells.
5.5. Src cell density dependent kinase activity and YAP tyrosine phosphorylation.
It has previously been shown Src kinase activity increases with increasing cell density50, and other Src kinase family members, as for example cYes, might undergo similar changes. Up to now, the possible role of a cYes mediated tyrosine
phosphorylation of YAP remains to be further dissected. Preliminary results in our group show that cYes induces activation of TEAD2 activity, which can be inhibited by YAP RNA interference. The exact biochemical mechanism of YAP activation by cYes remains an open question, but is so far believed to be due to tyrosine
phosphorylation. In conclution, the Hippo pathway does not control cell-to-cell
contact inhibition of mES cell proliferation, and the activation YAP regulated by both, and at least, Lats and cYes, while its function still remains an unanswered question.
6. Future work
The Lats2 knockout mES cell line is commercially available, which indicats that it is not required for the mES cell proliferation and self-renewal. We are greatly interested whether this Lats2 knockout mES cell line undergoes some differentiation defects. An other important question is whether these defects could be overcome by enhanced cYes signal or other signaling pathway. Furthermore, TEAD-enhanced luciferase gene transcription reporter assay will be applied to test TEAD activities at different mES cell densities, which might give an indication whether YAP/TEAD activity is affected by cell-to-cell contact. If there is a correlation in mES cells between cell densities, nuclear localization of YAP and TEAD transcriptional activity, the TEAD reporter should show high activity at low cell density and a reduced activity levels with an increase in cell density. If TEAD activity is not reduced with the increase of the cell density, our result that the YAP is not translocated to cytoplasm in the confluent mES cells will be further strengthened.
Lentivirally transduced stable YAP shRNA mES cell lines have been generated, which exhibited 80% YAP knockdown44. These cell lines provide more knockdown choices rather than transient transfection to do more experiments. It is more
convincing and convenient to produce this kind of cells with an E14/T background. It would be intriguing to test whether this YAP shRNA mES cell lines could produce an artificial cell-to-cell contact inhibition. If reduction in nuclear YAP leads to
cell-to-cell contact inhibition in mES cells as in the NIH 3T3 cells, this YAP
knockdown should lead to a reduction of the growth speed in the mES. If the assumed inhibition happens in the YAP knockdown mES cells, it may indicate the possible occurrence of a functional Hippo pathway with a flaw upstream of the YAP.
Transfection of mES cells with YAP dn should have similar impact on the mES cell saturation density and growth speed, while the wild-type YAP and YAP S112A should lead to higher saturation density and growth speed than the normal ES cells.
However, the problem needed to be solved is to keep the level of these YAP manipulations within the range that is enough to maintain mES cell self-renewal.
Another important question to address is whether the binding between the YAP and 14-3-3 is the cause of the lack of cell-to-cell contact inhibition of mES cell
proliferation. Immunoprecipitation with YAP could be used to detect whether there is other protein involved to block the binding or if there are some modifications in 14-3-3 which lead to a reduction of affinity. PLA technology for protein detection could also be used to detect the binding efficiency between YAP and 14-3-3 in different cells and different densities.
Other control cell lines besides NIH-3T3 cells should be used to do the experiments, e.g. the MCF10A cells mentioned above. Even though cell-to-cell contact inhibition is well defined in NIH-3T3 cell, there are still demands for comparisons between other control cell lines with mES cells. MCF10A is also growing in colonies just as the mES cells. Their cell-to-cell contact condition could be more similar to mES cells in the same cell densities.
Further experiments in this study will include the analysis of various members of the cell cycle regulation, e.g. cyclins and CDKs, using both immunocytochemical staining and Western blot analysis. These tests might tell us to the differences how the cell cycle is regulated differently in various cell types and cell densities. Finally, it will be of great interest to test whether the lack cell-to-cell contact inhibition in mES cells can also translate to hES cells.
7. Acknowledgements
I would like to thank Dr. Cecilia Annerén and my main supervisor Dr. Christoffer Tamm for offering me this wonderful opportunity to do this challenging project.
This half year-work has been the best lab training in my life and the best memory in Sweden, which improves my knowledge in stem cell biology and lab skills. I would like to thank Dr. Cecilia for her kind help in analysis of the result and suggestions in experiment. I am sorry for billions of Dr. Christoffer’s brain cells killed by my thesis writing and mistakes in lab. I would like thank Dr.Christoffer inspiring guidance and patience in the lab and the thesis writing. Further on I would like to thank Hanna for helping me in the lab and all the joyful time in office. I would also like to thank Dr Jimmy Larsson for his jokes, funny chat and impressive dissertation party.
A special thanks also to Bo for assistance with all my problems and questions.
Finally I would like to thank Dr. Li Jinpin, Anna, Johan and all people in D9:4 that have been always supportive. Thank you.
8.Reference
1.Evans, M.J., and M.H. Kaufman. 1981. Establishment in culture of pluripotential cells from mouse embryos. Nature. 292:154-6.
2.Thomson, J.A., J. Itskovitz-Eldor, S.S. Shapiro, M.A. Waknitz, J.J. Swiergiel, V.S.Marshall, and J.M. Jones. 1998. Embryonic stem cell lines derived from human blastocysts. Science. 282:1145-7.
3.Bradley, A., M. Evans, M.H. Kaufman, and E. Robertson. 1984. Formation of germ-line chimaeras from embryo-derived teratocarcinoma cell lines. Nature.
309:255-6.
4.Thomas, K. R. and M. R. Capecchi 1987. Site-directed mutagenesis by gene targeting in mouse embryo-derived stem cells. Cell 51:503-512.
5.Williams, R.L., D.J. Hilton, S. Pease, T.A. Willson, C.L. Stewart, D.P. Gearing, E.F.
Wagner, D. Metcalf, N.A. Nicola, and N.M. Gough. 1988. Myeloid leukaemia inhibitory factor maintains the developmental potential of embryonic stem cells.
Nature. 336:684-7.
6.Anneren, C. 2008. Tyrosine kinase signalling in embryonic stem cells. Clin Sci (Lond). 115:43-55.
7.Matsuda T, Nakamura T, Nakao K, Arai T, Katsuki M, Heike T, Yokota T. 1999.
STAT3 activation is sufficient tomaintain an undifferentiated state of mouse embryonic stem cells. EMBO J 18:4261–4269.
8.Liu N,Lu M,Tian X, Han Z 2007.Molecular mechanisms involved in self-renewal and pluripotency of embryonic stem cells. J. Cell. Physiol. 211: 279–286, 2007.
9.Sato N, Meijer L, Skaltsounis L, Greengard P, Brivanlou AH. 2004. Maintenance of pluripotency in human and mouse embryonic stem cells through activation of Wnt signaling by a pharmacological GSK-3- specific inhibitor. Nat Med 10:55–63.
10.Hao J, Li TG, Qi X, ZhaoDF, Zhao GQ. 2006. WNT/beta-catenin pathway up-regulates Stat3 and converges on LIF to prevent differentiation of mouse embryonic stem cells. Dev Biol 290:81–91.
11.Ying QL, Nichols J, Chambers I, Smith A. 2003. BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self-renewal in
collaboration with STAT3. Cell 115:281–292.
12.Xu RH, Chen X, Li DS, Li R, Addicks GC, Glennon C, Zwaka TP, Thomson JA.
2002. BMP4 initiates human embryonic stem cell differentiation to trophoblast. Nat Biotechnol 20:1261–1264.
13.Beattie GM, Lopez AD, Bucay N, Hinton A, Firpo MT, King CC, Hayek A. 2005.
Activin A maintains pluripotency of human embryonic stem cells in the absence of feeder layers. Stem Cells 23:489–495.
14.James D, Levine AJ, Besser D, Hemmati-Brivan lou A. 2005.
TGFbeta/activin/nodal signaling is necessary for the maintenance of pluripotency in human embryonic stem cells. Development 132:1273–1282.
15. Nichols, J., B. Zevnik, K. Anastassiadis, H. Niwa, D. Klewe-Nebenius, I.
Chambers, H. Scholer, and A. Smith. 1998. Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell. 95:379-91.
16. Pesce, M., and H.R. Scholer. 2001. Oct-4: gatekeeper in the beginnings of mammalian development. Stem Cells. 19:271-8.
17. Niwa, H., Miyazaki, J. & Smith, A. G. 2000. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 24, 372–376
18. Yamanaka S. 2008. Pluripotency and nuclear reprogramming. Philos Trans R Soc Lond B Biol Sci. 27;363(1500):2079-87.
19.Lewitzky M, Yamanaka S. 2007. Reprogramming somatic cells towards pluripotency by defined factors. Curr Opin Biotechnol. 18(5):467-73.
20. Chambers, I., D. Colby, M. Robertson, J. Nichols, S. Lee, S. Tweedie, and A.
Smith.2003. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell. 113:643-55.
21. Mitsui, K., Y. Tokuzawa, H. Itoh, K. Segawa, M. Murakami, K. Takahashi, M.
Maruyama, M. Maeda, and S. Yamanaka. 2003. The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell.
113:631-42.
22. ShiW,Wang H, Pan G, Geng Y, Guo Y, Pei D. 2006. Regulation of the pluripotency marker rex-1 by nanog and sox2. J Biol Chem 281:23319–23325.
23. Takahashi K, Yamanaka S. 2006. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126: 663—676 24. Yu J, Vodyanik M, Smuga-Otto K, Frane J, Antosiewicz-Bourget J, Frane J, Tian S, Nie J, Jonsdottir GA, Ruotti V, Stewart R, Slukvin II, Thomson JA. 2007."Induced pluripotent stem cell lines derived from human somatic cells." Science 318
1917-1920.
25. Kang L, Wang J, Zhang Y, Kou Z, Gao S. 2009. iPS cells can support full-term development of tetraploid blastocyst-complemented embryos. Cell Stem Cell.
5(2):135-8
26. Hanna, J, M Wernig, S Markoulaki, et al. 2007. Treatment of sickle cell anemia mouse model with iPS cells generated from autologous skin.
Science, 318: 1920—1923
27. Xu D, Alipio Z, Fink L M, et al. 2009. Phenotypic correction of murine hemophilia A using an iPS cell-based therapy. Proc Natl Acad Sci USA 106:
808—813
28. Zhao B, Lei QY, Guan KL. 2008. The Hippo-YAP pathway: new connections between regulation of organ size and cancer. Curr Opin Cell Biol. 20(6):638-46.
29. Vassilev A, Kaneko KJ, Shu H, Zhao Y, De Pamphilis ML 2001. TEAD/
TEF transcription factors utilize the activation domain of YAP65, a
Src/Yes-associated protein localized in the cytoplasm. Genes Dev 15:1229-1241.
30. Zhao B, Wei X, Li W, Udan RS, Yang Q, Kim J, Xie J, Ikenoue T, Yu J, Li L, Zheng P, Ye K, Chinnaiyan A, Halder G, Lai ZC, Guan KL. 2007. Inactivation of YAP oncoprotein by the Hippo pathway is involved in cell contact inhibition and tissue growth control. Genes Dev. 21(21):2747-61.
31.Chan EH, Nousiainen M, Chalamalasetty RB, Schafer A, Nigg EA, Sillje HH.
2005. The Ste20-like kinase Mst2 activates the human large tumor suppressor kinase Lats1. Oncogene 24:2076-2086.
32. Callus BA, Verhagen AM, Vaux DL 2006 Association of mammalian sterile twenty kinases, Mst1 and Mst2, with hSalvador via Cterminal coiled-coil domains, leads to its stabilization and phosphorylation. FEBS J273:4264-4276.
33. Praskova M, Xia F, Avruch J. 2008. MOBKL1A/MOBKL1B phosphorylation by MST1 and MST2 inhibits cell proliferation. Curr Biol 18:311-321.
34.Edgar BA 2006. From cell structure to transcription: Hippo forges a new path. Cell 124:267-273
35.Dong J, Feldmann G, Huang J, Wu S, Zhang N, Comerford SA, Gayyed MF, Anders RA, Maitra A, Pan D. 2007. Elucidation of a universal size-control mechanism in Drosophila and mammals. Cell 130:1120-1133
36. Sawada A, Kiyonari H, Ukita K, Nishioka N, Imuta Y, Sasaki H. 2008. Redundant roles of Tead1 and Tead2 in notochord development and the regulation of cell
proliferation and survival. Mol Cell Biol 28:3177-3189
37.Eagle, H. and Levine, E.M. 1967. Growth regulatory effects of cellular interaction.
Nature 213: 1102–1106.
38. Ota M, Sasaki H. 2008. Mammalian Tead proteins regulate cell proliferation and contact inhibition as transcriptional mediators of Hippo signaling. Development.
135(24):4059-69
39. Overholtzer M, Zhang J, Smolen GA, Muir B, Li W, Sgroi DC, Deng CX, Brugge JS, Haber DA. 2006. Transforming properties of YAP, a candidate oncogene on the chromosome 11q22 amplicon. Proc Natl Acad Sci U S A 103:12405-12410.
40. Zender L, Spector MS, Xue W, Flemming P, Cordon-Cardo C, Silke J, Fan ST, Luk JM, Wigler M, Hannon GJ et al. 2006. Identification and validation of oncogenes in liver cancer using an integrative oncogenomic approach. Cell 125:1253-1267.
41. Varelas X, Sakuma R, Samavarchi-Tehrani P, Peerani R, Rao BM,
Dembowy J, Yaffe MB, Zandstra PW, Wrana JL 2008 TAZ controls Smad
nucleocytoplasmic shuttling and regulates human embryonic stem-cell self-renewal.
Nat Cell Biol 10:837-848.
42. Ramalho-Santos, M., S. Yoon, Y. Matsuzaki, R.C. Mulligan, and D.A. Melton.
2002."Stemness": transcriptional profiling of embryonic and adult stem cells. Science.
298:597-600.
43.Nishioka N, Inoue K, Adachi K, Kiyonari H, Ota M, Ralston A, Yabuta N,
Hirahara S, Stephenson RO, Ogonuki N, Makita R, Kurihara H, Morin-Kensicki EM, Nojima H, Rossant J, Nakao K, Niwa H, Sasaki H. 2009. The Hippo signaling
pathway components Lats and Yap pattern Tead4 activity to distinguish mouse trophectoderm from inner cell mass. Dev Cell. 16(3):398-410.
44.Alarcón C, Zaromytidou AI, Xi Q, Gao S, Yu J, Fujisawa S, Barlas A, Miller AN, Manova-Todorova K, Macias MJ, Sapkota G, Pan D, Massagué J. 2009. Nuclear CDKs drive Smad transcriptional activation and turnover in BMP and TGF-beta pathways. Cell. 13;139(4):757-69.
45. Cao, X., Pfaff, S.L., and Gage, F.H. 2008. YAP regulates neural progenitor cell number via the TEA domain transcription factor. Genes Dev. 22, 3320–3334.
46. Varga, A.C., and Wrana, J.L. 2005. The disparate role of BMP in stem cellbiology.
Oncogene 24, 5713–5721.
47. Parekkadan B, Berdichevsky Y, Irimia D, Leeder A, Yarmush G, Toner M, Levine JB, Yarmush ML. 2008.Cell-cell interaction modulates neuroectodermal specification of embryonic stem cells. Neurosci Lett. 438(2):190-5.
48.Soncin F, Mohamet L, Eckardt D, Ritson S, Eastham AM, Bobola N, Russell A, Davies S, Kemler R, Merry CL, Ward CM. 2009. Abrogation of E-cadherin-mediated cell-cell contact in mouse embryonic stem cells results in reversible LIF-independent self-renewal. Stem Cells. 27(9):2069-80.
49. Zhao, B., Q.Y. Lei, and K.L. Guan. 2009. Harness the power: new insights into the inhibition of YAP/Yorkie. Dev Cell. 16:321-2.
50. Batt DB, Roberts TM. 1998.Cell density modulates protein-tyrosine phosphorylation. J Biol Chem. 6; 273(6):3408-14.
9. Figures
Lats1 Lats2 Mst1 Mst2 Mob1 WW45 A
B
Figure 3. Hippo components present in mES cells and are regulated during the differentiation
(A) RT-PCR analysis of Mst1,Mst2,Lats1,Lats2,Mob1,WW45 in mES cells (B) Expression levels in the mES cells (LIF) compared to the differentiated
counterparts by quantitive RT-PCR. mES cells differentiate under to two
conditions; LIF withdrawal(noLIF) and under the induction of RA(RA) in 3 days and 6 days.
A
NIH 3T3
E14/T
Figure 4. Subcellular distribution of YAP localization in E14/T and NIH 3T3 cell line at different densities (A)YAP is localized to the nuclei in both E14/T and NIH 3T3 cells at low density.(1:40) .YAP is not localized to the cytosol in confluent mES cells(1:1), while it is localized to the cytosol in confluent NIH 3T3 cells
A 1:1 1:2 1:4
1:8 1:16 1:32
RatioofcellinSPhase(%)
B
Figure 5. Cell cycle distrubution is slightly affected by cell density in mES cells.
E14/T cells from various cell densities stained with the DNA-stain propidium iodide and analyzed the cell cycle by flow cytometry. (A)Different population inmES cells at various densities(1:1 is the highest density, 1:32 is the lowest density). P4 indicates the cells in G0/G1-phase; P3 indicates the cells in S-phase; P5 indicates the cells in G2/M phase. There is a larger Go/G1-phase cell population in 1:1 and 1:2. (B).Ratio of S phase is similar in different densities.
Figure 6. Cell density has little effect on replicating cell population in mES cells.
Incorporation of EdU(30 min pulse) in NIH 3T3(top) and E14/T cells(middle) at different densities(1:1 is the highest density, 1:32 is the lowest density). (bottom)NIH 3T3 – EdU positive cell population is dicreasing in higher densities.
Figure 7. Cell proliferation inhibition occurs at much later stages in mES than in the NIH 3T3 cells. Doubling time of NIH 3T3 and E14/T cells at different densities are indicated. The proliferation rate in the NIH 3T3 cells decrease much faster than E14/T from the first to second day.
Figure 8. YAP manipulation could affect the promoter activity in both positive and negative way. (A) Schematic representation of structures of YAP proteins38. (B) TEAD2-enhanced luciferase gene transcription reporter assay on E14/T and NIH 3T3 cells transfected with empty vector, YAP full, YAP S112A and YAP dn. YAP dn reduce TEAD activity, while as YAP S112A and YAP full increase TEAD activity.
