Selenocytotoxicity and redoxsystems
T
T
h
h
e
e
e
e
f
f
f
f
e
e
c
c
t
t
o
o
f
f
s
s
e
e
l
l
e
e
n
n
o
o
c
c
o
o
m
m
p
p
o
o
u
u
n
n
d
d
s
s
o
o
n
n
r
r
e
e
d
d
o
o
x
x
s
s
y
y
s
s
t
t
e
e
m
m
s
s
i
i
n
n
t
t
u
u
m
m
o
o
r
r
c
c
e
e
l
l
l
l
s
s
Marita
Marita Wallenberg
Master Thesis 2008
Supervisors: PhD Anna-Klara Rundlöf and PhD Aristi Fernandes Department of Laboratory Medicine, Division of pathology, Karolinska University Hospital, Huddinge
Examinator: Professor Carl Påhlsson, Mälardalens University, Eskilstuna
1.Abstracts
The Thioredoxin (Trx) and Glutaredoxin (Grx) system are two major antioxidant redoxsys-tems in the cells that prevent and respond to oxidative stress, which is a well known factor in aging and causing several diseases, like neurodegenerative disorders, diabetes and cancer. Oxidative stress also can be described as an imbalance between production of reactive oxygen species (ROS) and the cellular protection. Thioredoxin Reductase (TrxR), a selenoproteine located both in the cytosol and the mitochondria, functioning as an electron donor for Trx, and also its mithochondrial form (TrxR2) it can be an electron donor for Grx2.
Lately, several studies has been showing Selenite, a highly oxidized form of selenium, a well known essential tracemineral and antioxidant, to be a potential therapeutic drug in cancer treatment by inhibiting tumor growth and induce apoptosis in cytostatic drug-resistant malign cell-lines. Gold, and gold-containing drugs have a long history in medicine, and has been validated as potent TrxR inhibitors.
In this study we have combined Selenite and a Goldcompound in treatment of
Grx2-overexpressing HeLa cell-lines, and investigated the inhibiting effect on the Thioredoxin and Glutaredoxin system, and also how Grx2 would function without its electron donor, TrxR2. By using a quantitative polymerase chain reaction and for this, we have successfully opti-mized a TrxR2-primer, measured and compared the expression of mRNA levels of TrxR1, TrxR2, Grx2 and Grx2tot.We have also investigated the enzyme kinetics of Grx1 with seleno-cysteine, selenodiglutathione and selenomethylselenocystine, to see/ and found that they if they could be a substrate for Grx1.
2. Table of contents
1.
Abstracts
2. Table of contents3.
Abbreviation
4.
Introduction
4.1 Oxidative stress4.2.1 Thioredoxin and Glutaredoxin systems 4.2.2 Thioredoxin
4.2.3 Thioredoxin Reductase 4.3.1 The Glutaredoxin system 4.3.2 Glutaredoxin
4.4.1 Selenium 4.4.2 Selenoproteins
4.4.3 Selenite in cancer treatment 4.5.1 Gold in medicine
4.5.2 Gold (I) complexes and cancer
4.5.3 Gold compound and Thioredoxin Reductase
5
Aim
6
Material and methods
6.1.1 Cell lines 6.1.2 Cell culturing
6.2.1 Glutaredoxin activity
6.3.1 Treatment with gold compound and the Selenocompounds; Selenite, selenodi-glutathione, selenocysteine and selenomethylselenocysteine
6.3.2 RNA extraction 6.3.3 Quantification of RNA 6.3.4 cDNA synthesis 6.4 1 Optimizing RT-PCR for TrxR2 6.4.2 Quantitative real-time PCR (q-RT-PCR) 6.5.1 TrxR -activity (TR-assay) 6.6.1 Cell viability XTT 7 Results 7.1 Optimizing RT-PCR for TrxR2
7.2 Determination of the Glutaredoxin activity 7.3 Cytotoxicity of selenocompounds
7.4 Inhibition of TrxR with gold compound
8
Discussion
9
Future perspective
10
Acknowledgements
11
References
3. Abbreviations
cDNA Complementary deoxyribonucleic acid
DTNB (5, 5'-dithiobis-(2-nitrobenzoic acid) or Ellman's reagent EDTA Ethylenediamine tetra acetic acid
FBS Foetal bovine serum GR Glutathione Reductase Grx Glutaredoxin
GSH Glutathione
HEPES 4-(2-Hydroxyethyl)-1-piperazineethanesulfonic acid NADPH Nicotineamide dinukleotid phosphate reduced PBS Phosphate buffered saline
PCR Polymerase chain reaction
q-RT-PCR Quantitative reverse transcription polymerase chain reaction RNA Ribonucleic acid
RNS Reactive Nitrogen species ROS Reactive Oxygen Species Sec Selenocysteine
SeMet Selenomethionine
Tris Trishydroxymethylaminomethane Trx Thioredoxin
4. Introduction
4.1 Oxidative stress
Oxidative stress is well known to be a major factor in aging, and a cause to several diseases, such as neurodegenerative disorders, diabetes and cancer [1]. Oxidative stress is induced by environmental factors, for example radiation, medicals and drugs but also by basic cellular reactions or depletion of antioxidants. Oxidative stress can also be explained as an imbalance between the production of reactive oxygen species (ROS), also known as free radi-cals, and the cellular protection. During evolution, organisms have developed several mecha-nisms where ROS are used in normal cellular reactions, for example regulation of vascular tone (NO.), sensing of oxygen tension (O-2.) and oxidative stress responses for maintaining of
redox homeostasis [2,3]. For all type of aerobic form of life, oxygen is essential, but when incomplete reduction of oxygen occurs, a free radical can appear, which can lead to a produc-tion of reactive oxygen species and consequently, oxidative stress. ROS-producproduc-tion is often generated as a by-product from the cellular metabolism and mostly by leakage from the mito-chondria and the cellular respiratory chain reaction but also from enzymatic and nonezymatic reactions in other parts of the cell Increased levels of ROS, such as hydrogen peroxide (H2O2),
superoxide (O2·-) and hydroxyl radicals (·OH), creates oxidative stress which can lead to cel-lular damages by interaction between ROS and proteins, lipids or DNA and by this cause dis-orders in the cellular signalling systems [4,3]. As a part of the oxidative stress that ROS in-duces, it can cause structural modifications of proteins and lipids which may inactivate their function [5] and by chemical modification of DNA, induce errors of the genetic code [3]. In addition, ROS have several important functions in cells such as constituting intracellular sig-nalling molecules, so called second messengers, in different cellular pathways, for example in regulation of hormone levels, neurotransmission and gene expression [6,7].
4.2.1 Thioredoxin and Glutaredoxin system
There are several mechanisms in the cells for upholding the redox homeostasis in the cell and protect it against oxidative stress. The major mechanism is when elevated ROS levels mediate redox sensitive signal cascades that induce expression of genes for antioxidative enzymes [2]. The Thioredoxin and Glutaredoxin system are two major antioxidant redoxsystems in the cells that prevent and respond to oxidative stress. The Thioredoxin system, which is shown below in figure 1, comprises of NADPH as the electron donor for Thioredoxin Reductase (TrxR) which then transfers electrons to Thioredoxin (Trx) that in the end reduces oxidised disulfide bridges in proteins [8].
Figure 1. The thioredoxin system
4.2.2 Thioredoxin
Trx is a small (10-12kDa) ubiquitously multifunctional redox active disulfide reductase protein, which in all organisms has a highly conserved active site, comprising the –Cys-Gly- Pro-Cys residue, which enables Trx to reduce intracellular disulfides in proteins [9].Trx is involved in the regulation of several important cellular responses, like inhibition of apoptosis, by binding to apoptosis signal-regulating kinase1, reducing ribonucleotide reductase, re-doxregulation of transcription factors, involvement in hormone regulation and cytokine function. Furthermore, Trx assist implantation of the cytotrophoblast and establishment of pregnancy, protect from hyperoxia at birth and in the CNS secreted from gliacells for promot-ing neuronal at ischemia/reperfusion [10]. Increased levels of Trx1 has been found in many human cancers, most likely in direct response to oxidative stress [11]. It is also discovered in several diseases, for example viral diseases like Epstein-Barr (EBV) and HIV, but also in myocardial diseases [12]. At present time, three isomers of Trx have been identified; Trx1 as the most studied and localized in the cytosol, Trx2 present in the mitochondria and containing a 60 amino acid N-terminal translocation signal [13] and SpTrx only found in spermatozoa [14]. These isomers can also be found as different isoforms [15].
4.2.3 Thioredoxin Reductase
Mammalian Thioredoxin Reductase is a FAD containing selenoprotein, with two identical subunits of 58 kDa, with a highly conserved active site-Gly-Cys-Sec-Gly- containing a se-lenocysteine (Sec). TrxR is involved in many cellular functions, for example DNA synthesis, regulation of apoptosis and selenium metabolism [16].Unlike procaryotic TrxR, which lacks the Sec residues in its active site, human TrxR has a very broad substrate specificity and re-duces not only Trx, but also other protein disulfides, as well as low molecular weight com-pounds, such as different selenocompounds [17] and hydroperoxides [18]. Furthermore TrxR regenerates antioxidants like ascorbic acid (Vitamin C) [19] lipoic acid [20], Vitamin E and ubiquinone [21].
Like Trx, TrxR has isomers with the same locations as Trx, with TrxR1 located in the cyto-sol, TrxR2 in the mitochondria, and the third named TGR (thioredoxin and glutathione reduc-tase), mainly expressed in testis. TGR is also able to reduce oxidised glutathione (GSSG). This unusual substrate specificity is achieved by an evolutionary conserved fusion of the TrxR and a glutaredoxin domain [22]. Recent studies has discovered that TrxR1 is expressed as at least 21 different mRNA transcript variants [23], which indicates complex regulatory function [24]. TrxR is upregulated in several diseases, like autoimmune and infectious dis-eases, but also in cancer [8]. Many scientific articles report high expression of Trx and TrxR in many different tumors. Some suggest that high levels of Trx might be linked to resistance in chemotherapies; while others indicate that high Trx and TrxR may induce apoptosis. Also, new data suggest TrxR to bee essential in carcinogenic development of invasive cancer. Due to this, both Trx and TrxR are considered with big interest, as target for chemotherapy [8]. 4.3.1 The glutaredoxin system
The glutaredoxin system, seen in figure 2 below, function by electrons that are transferred from NADPH, to glutathione reductase (GR), to glutathione (GSH) and
finally to glutaredoxin (Grx) which catalyze the reduction of disulfide bonds in a variety of proteins and nonprotein substrates [25].
Figure 2. General mechanism of the glutaredoxin system 4.3.2 Glutaredoxin
Glutaredoxins are small 12kDa ubiquitous redox proteins, present in almost all organisms, enabling reduction of disulfide bonds by utilizing two redox active cysteines in its conserved active site –Cys-Pro-Tyr-Cys- [26].
Today, there are two known isomers of Glutaredoxin in human, Grx1 and Grx2, which differs in size, cellular location and catalytic properties. Grx1 is mainly found in the cytosol, while Grx2 contains a mitochondrial localization signal, which is cleaved off after transport into the mitochondria [27]. Grx2 has the unique ability to be reduced from both GSH and by TrxR, indicating the importance of a functional Grx2 [28]. Furthermore, Grx2 contains a Ser instead of Pro in its active site. Grx can reduce disulfides in proteins, like Trx, by a dithiol mechanism. However by a unique monothiol mechanism, illustrated in figure 3, also de-scribed as Glutathionylation, Grx together with GSH, also reduces mixed disulfides [25]. This mechanism appears by formation of an intermediate of GSH and a monothiol, forming R-S-SG(-H). The reducing reaction is then performed when Grx interact with the GSH, and not the protein-substrate, due to the glutaredoxin affinity for GSH. This results a Grx-S-SH mixed intermediate, which releases the not bound part of GSH. Finally a second GSH gener-ates a glutathione disulfide (GSSG), and GR reduces the (GSSG) to GSH.
Figure 3. Monothiol mechanism of glutaredoxin.
Grx are important in several cellular processes, like DNA synthesis, sulphur assimilation, defence against oxidative stress, apoptosis, cellular differentiation, regulation of transcription factor binding activity and redox regulation [29]. Results has also shown that over expression of Grx2 inhibit cytocrome C release and prevent cells to enter apoptosis [30].
4.4.1 Selenium
The trace mineral selenium (Se) was discovered in 1817 by Jöns Jacob Berzelius. Selenium has atom number 34 according to the periodic table, and has similar properties as sulphur. Selenium is well known as an essential trace mineral, for both animals and plants at low doses- and an everyday intake is important for the human health. Selenium is primarily known as an antioxidant, with anti-inflammatory and antiviral properties [31] in the range o f 10-100nM, (see figure 4) but at higher concentrations it become a prooxidant and reaches more toxic levels. [32]. It has been well established that selenium supplementation also can act as a cancer preventive agent [33].
Figure 4. Physiological properties of selenium in relation to concentration
4.4.2 Selenoproteins
The most occurring form of selenium in the body is in the amino acid Selenocysteine (Sec) which is essential for the activity in many selenoproteins and is integrated in their active sites[10]. Today, there is about 25 known selenoproteins, among these the essential Thiore-doxin Reductase (TrxR). However, many selenoproteins function are still unknown [1] . Sec has been identified as the 21amino acid, and as the analogue to cysteine [34].
The mechanism for Selenocysteine incorporation is a very specific, unique and evolutionary conserved process. Selenocysteine is encoded by the same codon as for stop-signal –UGA, placed in the selenoproteins ORF and has its own tRNA.
0.1 1.0 10
00,0 ,01.
nc. (Se, µM g conc. (Se, µM)
Growth inhibition Acute toxicity
Prevention Death
Depletion
Antioxidant
Prooxidant
Oxidant
0,01 0,1 1,0 10 c. (Se, µM)
Figure 5. Selenium metabolism
4.4.3 Selenite and cancer-treatment
There has been several studies lately showing that selenium in form of selenite, is a potential therapeutic drug in cancer treatment by inhibiting growth of tumour cells. It has also
been shown that selenite inhibit growth, and induce apoptosis in cytostatic-resistant malignant cell-lines, while benign cells remain unaffected[35, 36]. It has for instance been that drug-resistant human lung cancer cells are 3-4 fold more sensitive to selenium cytotoxicity, than the drug-sensitive lung-cancer cells [37]. Cancer cells are sensitive to selenium already at prooxidant concentrations.
4.5 Goldcompound 4.5.1 Gold in medicine
Medical and therapeutic importance of gold has been recognized thousands of years ago, but its rational use in medicine begun only in the early 1920s. It was initiated with the finding of the bacteriologist Robert Koch that K[Au(CN)2] could kill the bacteria that cause
tuberculosis. However, because of the serious side effects associated with K[Au(CN)2], it was
replace with the less toxic Au(I) thiolate complexes. French physician Jacque Forestier then introduced these complexes for treatment of rheumatoid arthritis, a condition which he believed was related to tuberculosis [38].
For many decades, Au(I) thiolate complexes were considered as a drug of choice for rheumatoid arthritis treatments. The toxic side effects observed with these compounds
encouraged the search for new less toxic gold complexes. With this intent many new gold (I) phosphine complexes were developed and among them, auranofin with the best result.
4.5.2 Gold (I) complexes and cancer
In the past years, a number of studies have shown that auranofin presented an in vitro activity similar to that of cisplatin [39, 40]. Encouraged by these data, a series of gold(I) coordination complexes, including auranofin analogs, were evaluated for in vitro cytotoxic potency against different tumour cell lines and in vivo anti-tumour activity against P388 leukemia in mice [40]. Auranofin and a number of its analogs showed potent cytotoxic activity both in vitro and
in vivo, and among them, phosphine coordinated gold(I) thiosugar complexes appeared to be
the most potent. However, these complexes were found to be completely inactive against solid tumors.
4.5.3 Gold and thioredoxin Reductase
Gold-containing drugs have been validated as potent TrxR inhibitors. Among them, Aurano-fin, which is very effective and acts at nanomolar levels. Studies with isolated purified cytoplasmic and mitochondrial thioredoxin reductase (TrxR) suggest a mechanism of action for Auranofin that involves the inhibition of TrxR by binding of Au(I) to the selenocysteine residue at the active site of the enzyme and inhibiting thioredoxin reductase in near
stoichiometric amounts with a formal Ki of 4 nM.
However, the high affinity of auranofin towards protein thiols has limited its anti-tumour activity in vivo, with modest activity demonstrated in only one mouse tumour model.
It was with the aim of reducing the reactivity with thiols, to obtain a broader spectrum of anti- tumour activity, that leads to early investigations of Au (I) complexes with different ligand [41].
Figure 6. The molecular structure of the goldcompound used in this study.
5. Aim
The aim of this study was to study the enzyme kinetics of Grx1 with different selenocompounds and see if they possible could be a substrate for Grx1.
We also aimed to look at the goldcompound inhibiting effect on Trx system and by this study the Grx-system, and how Grx2 function without its electron donor, TrxR2, in cancer cells.
6. Materials and methods
6.1.1 Cell lines
The gold compound experiment was performed on the well-known ovarian-cancer cell line HeLa. Cells used in this study were wild-type HeLa, stably transfected with a mocplasmid expressing the Green Fluorescent protein, HeLa-mGrx2-gfp, transfected to overexpress the mitochondrial Grx2 and HeLa-tGrx2-gfp, transfected to over express the truncated form of Grx2, lacking the mitochondrial localization signal, and therefore found in the cytosol. Using these celllines was due to the knowledge that cells over expressing Grx2 seems to be less sus-ceptible to apoptosis according to Mari Enoksson et al. [30].
6.1.2 Cell culturing
Cell lines was grown in 75cm2 cell culture flasks from Sarstedt in RPMI 1460+Glutamax-1 medium, with supplementation of 10% Foetal Bovine Serum (FBS) and
Penicillin-Streptomycin (PEST), 100 Units/mL of penicillin and 100µg/mL of streptomycin.
The flasks were incubated in a Forma Scientific; water-jacketed incubator, in 37 o C with 5% CO2 atmospheric content. The medium was changed when needed, and the cells were split,
when the flasks were confluent. The products used for culturing cells were all from Gibco Invitrogen.
6.2.1 Glutaredoxin activity
By using a spectrophotometer (Ultrospec 4350 pro) the consumption of NADPH in a in vitro Glutaredoxin-system was determined when reducing three organic selenocompounds, with a modification of the HED-assay (Åslund, Holmgren) A fresh mix containing 1 mM GSH, 40mg/mL NADPH, 2mM EDTA pH 7,5, 0,1 mg/mL BSA and
0,008OD yGR in 100 mM Tris pH 8,0 were prepared. The reaction was measured by adding 500µL of the mix to a 1 mL cuvettes plus 1µM human Grx1 to the sample-cuvette. After starting the measuring and when the reaction was stabilised, we added selected selenocom-pound with different concentration between 2,5 µM -10µM and the measuring continued im-mediately. The consumption of NADPH was determined from the decreasing spectra in ab-sorbance of 340 nm for 5 minutes. For background activity-determination, a measure without hGrx1 was performed in the same way. To get the activity-result, the background-activity was subtracted.
6.3.1 Treatment with the Goldcompound [Au(tu)(Pet3)](Cl) (C7H19AuClN2PS
MW:426,697) and the Selenocompounds; Selenite, selenodiglutathione, selenocysteine and selenomethylselenocysteine
Cells growing in 75 cm2-cultureflasks were treated when they reached 70-80% confluence,
with concentration 0,5 µM, 2,5µM and 5,0µM of the goldcomplex, freshly dissolved in DMSO, for 24 h.
6.3.1 RNA-extraction
The cells were harvested by aspiring the medium, and rinsed with PBS. For releasing the cells from the flasks, they were treated with trypsin (0,05 % Trypsin-EDTA, Gibco Invitrogen). The flasks were incubated for a couple of minutes in 37oC and then the trypsin was inacti-vated by adding serum-containing medium. Then, the cells where transferred to 15 mL falcon tubes and spun down to a pellet for 5 min at 300 x g. The cells were lysed and the RNA was purified according to the manufactures instructions by using RNeasy plus Mini kit from Qiagen. The RNA were then stored in -80oC.
6.3.2 Quantification of RNA
Quantification of the extracted RNA was done by using Quant-iT RiboGreen, RNA Assay kit, containing RiboGreen RNA Quantification reagent and Ribosomal RNA Standard, from Mo-lecular probes, and with the high range protocol from moMo-lecular probes. Briefly, a
standard curve of the Ribosomal RNA was prepared to bee used for determining the concen-tration of the extracted RNA, which was diluted three times (e.g.1:100, 1:1000, 1:10 000). The standard curve and the diluted samples were added in double-samples to an ELISA- plate, and RiboGreen then added to every well. The absorbance was measured on Spectra Max Gemini (Molecular Device) software: Soft Max, with excitation wave length: 480nm and emission wave length: 520 nm.
6.3.3 cDNA synthesis
To obtain a cDNA, a reverse transcriptase-reaction was performed according to the Omni-script® RT kit (208), from Qiagen. For each cDNA, 2µg of the extracted RNA was used and 0,1 µg/µL dT primers. Briefly, a volume containing 2µg of extracted RNA was mixed on ice, with Master Mix, containing RT-buffer, dNTP-mix, RNase Out RTO and oligo dT, add-ing DEPC-water to a final volume of 20µl.The cDNA synthesis was performed at 37oC on a heating block for 60 minutes. The cDNA was then stored in -20oC.
6.4.2 Optimizing RT-PCR for TrxR2
For optimizing Primers for TrxR2, a q-PCR was preformed with the forward and reverse primer in different combination and concentration to obtain the optimum primer concentra-tion. The 9 combinations are shown in Table 1 below.
Table I.
TrxR2-Primer in different concentrations for optimization of the RT-PCR.
Combination Forward Reverse
1 50 nM 50 nM 2 50 nM 300 nM 3 50 nM 900 nM 4 300 nM 50 nM 5 300 nM 300 nM 6 300 nM 900 nM 7 900 nM 50 nM 8 900 nM 300 nM 9 900 nM 900 nM
PCR-program that was used: 95 o C for 2 min, 40 cycles of 95 o C for 15 s and then 60 o C for 30s. After that, 80 cycles of 55 oC to determine melt point of the product and last 25 oC and hold.
6.4.2 Quantitative real-time PCR (qRT-PCR)
To determine the expression of our genes of interest, TrxR1[23], TrxR2, Grx2a and Grx2Tot, a q-PCR (Bio-Rad, Hercules) with program iCycler was used, together with Platinum SYBR Green kit ( Invitrogen)( Fluorescein Calibration Dye, 1 mM i DMSO + Supermix, BIO-RAD). 10 ng cDNA was used per reaction together with primers for selected genes, and Actin prim-ers for reference. Each reaction was made in triplets and 25 µL/ reaction. PCR-program: 95 o C for 2 min, 40 cycles of 95 o C for 15 s and then 60 o C for 30s. After that, 80 cycles of 55 o C to determine melt point of the product and last 25 oC and hold.
6.5.1 TrxR -activity (TR-assay)
Ellman's reagent (5, 5'-dithiobis-(2-nitrobenzoic acid) or DTNB) is a chemical used for measuring the amount of thiols. DTNB reacts with a thiol group to release 2-nitro-5-
mercaptobenzoic acid (TNB), which has a strong yellow color in water at neutral and alkaline pH. This reaction is rapid and stoichiometric, with the addition of one mole of thiol releasing one mole of TNB. Measuring the absorbance of TNB is done by a spectrophotometer at 412 nm [42]. By harvesting cells, the TrxR1 enzyme activity was measured according to Holm-gren and Björnstedt [43]. 50 µg of protein, prepared from the sample, was incubated in glass vials in a mix containing 6mM EDTA, 80 mM HEPES, 2 mg/ml insulin and 0,9mg/ml NADPH at 37oC for 20 min in a final volume of 120 µl. Double samples were made, and be-fore the incubation, 10 µM Trx1 was added, to one of them. The reaction was then stopped by adding 500 µl of a mixture containing 0, 4 mg/ml DTNB and 6 M guanidine-HCL in 0,2M Tris-HCL, pH 8, 0. The samples were pipetted to a 96-well plate, made of quarts glass, and the absorbance at 412nm was read within 20 min on a Spectra Max Gemini (Molecular De-vice) soft ware: Soft Max. The final activity was obtained by subtracting the absorbance from the sample without Trx1, from the absorbance with Trx1.
6.5.2 Cell viability
The growth inhibitory effect toward tumour cell lines was evaluated by means of XTT-based colorimetric assay Cell Proliferation Kit II (Roche) following the method as described by Roche (2004). Briefly, 3·103 cells/well were seeded in 96-well micro plates in medium (100 µL) and then incubated at 37 °C in a 5% carbon dioxide atmosphere. After 24 h, the medium was removed and replaced with a fresh one containing the compound, ranged from 10 µM to 1 mM freshly dissolves in DMSO. Triplicate cultures were established for each treatment. After 3, 12, 24 and 48 h, each well was treated with 50µL of a 0, 3 mg/mL XTT labelling mixture. After 4 h of incubation, at 37oC, the absorbance of each well was measured at 490 nm, with a reference wavelength at 650 nm, using a micro plate reader Spectra Max 250 from Molecular Device. Mean absorbance for each drug dose was expressed as a percentage of the control untreated well absorbance and plotted versus drug concentration. IC50 values represent the drug concentrations that reduced the mean absorbance at 570 nm to
7. Results
7.1 Optimizing RT-PCR for TrxR2
To optimize the RT-PCR for TrxR2, primers to match TrxR2 were designed
by using Beacon Designer 2.0. By pasting the mRNA sequence of the gene, in a software we received suggestions of several primer-sequences together with their calculated
thermodynamic properties and possible dimerization, according to the primers GC-content. The primers, shown below in Table 2, were then ordered from Invitrogen.
Table II.
Suggested primers, used to optimize the RT-PCR for TrxR2.
The primers were tested in different concentrations in order to find the best primer-couple at optimal concentration. According to the received Ct-value from the PCR-reaction,
describing in which PCR-cycle detectable quantity of product has been reached; the best primer-couple and concentrations were selected. After analyse of received CT-value, the B-couple with 300 nM of both forward and reverse, were assed as the optimal primers. In addi-tion, melt-curve from the reaction was analysed (figure 7), showing that only one product has been produced.
Figure 7. Melt-curve for the selected B-primer-couple of TrxR2, showing a single product
with a melting point of 91,5o C
Finally, the efficiency of the selected B-primer-couple was tested in their optimum concentra-tion, by using a cDNA in 6 different concentrations. The goal was to reach around 85% (+/- 5%) efficiency for the primers, to be able to use the comparative CT method and the formel 2 -∆∆CT.
Primer Sequence Position
TrxR2FwdA GCCCTAGCTGCCCCAGAAG 5
TrxR2RevA CCGGAAGCGCCCTCCTAATC 81
TrxR2 FwdB TCAGAAGATCCTGGTGGACTCC 1047
Standard Curve Graph for SYBR-490
Figure 8. Results of the efficiency of the optimized primers.
7.2 Determination of the Glutaredoxin activity
To investigate if the selenocompounds could act as a substrate for Glutaredoxin, an assay was performed with the selenocompounds as possible substrates. Results from the assay and the glutaredoxin activity (figure 9), proved that they all can act as a substrate to glutaredoxin. It also showed that selenodiglutathione and selenocystine has similar activity in the lower Con-centrations, but in higher concentration, selenocysteine causes more activity. Detection of background activity was performed in all concentrations without glutaredoxin, and subtracted from the first reaction.
Glutaredoxin-activity 0 0,1 0,2 0,3 0,4 0,5 0,6 0,7 0,8 0,9 2,5µM 5,0µM 7,5µM 10,0µM A 3 4 0 n m / m in Selenodiglutathione Selenocystine Selenomethylselenocysteine
Figure 9. Glutaredoxin-activity and NADPH-consumption, while reducing the different
7.3 Cytotoxicity of selenocompounds
In addition to the glutaredoxin-activity, cytotoxicity of the selenocompounds was determined with XTT. Cell proliferation assays are widely used in study of growth factors, cytokines and media components, for screening of cytotoxic substances and lymphocyte activation. XTT was developed to measure cell proliferation in reaction to different growth factors, cytokines and nutrient components. It is suitable to measure cytotoxicity of substances as growth in-hibitors. The assay is based on the ability of metabolic active cells to reduce the tetrazolium salt XTT to orange coloured compounds of formazan. The dye formed is water-soluble and can be measured at given wavelength with a spectrophotometer. The intensity of the dye is proportional to the number of metabolic active cells.
The cells were treated for different time point (3, 6, 24 and 48 h) with increasing concentra-tions, range from 1 µM to 10 µM, of tested compound. The result showed different patterns of the three HeLa cell-lines, and that HeLa-cells overexpressing mGrx2 were more resistant to the selenocompounds, especially to selenodiglutathione. It also showed that the truncated form, tGrx2 were instead much more sensitive to selenodiglutathione. In contrast, the IC50
with selenomethylselenocystine were not reached for any of the cells, indicating that it has no toxic effect at all. Most toxic for all the cell lines were selenite.
Table III.
IC50 values -test by XTT.
. (S.D: standard deviation, N.D: IC50 non detectable because not reached).
7.4 Goldcompound experiment
By treating the Grx2-overexpressing HeLa cell-lines with 0,5 µM of the gold compound for 24 h, we investigated the inhibiting effect on the Trx-system and Grx-system, and how Grx2 would possibly function without its electron donor, TrxR2. The choice of concentration of the goldcompound was set after performing IC50-study where the cells were treated with
increas-ing concentrations of the goldcompound and 4 time-points; 3,6,24 and 48 h (figure 10). The primers that were used are presented in table III, with sequences and used concentrations. The three HeLa cells lines were harvested and RNA extracted both from treated and untreated flasks, the untreated as a control of their normal levels of gene-expression. The mRNA levels were then determined with a qRT-PCR.
Selenocompound HeLa HeLa mGrx HeLa tGrx
Selenite 19.39 + 0.97 31.34 + 2.23 21.05 + 1.56 SeCystine 287.2 + 1.24 267.2 + 3.45 201.7 + 2.14 Se-di GSH 81.01 + 1.43 135.19 + 5.34 23.39 + 3.12
Table IV.
Primer sequences used for the qPCR in the goldcompound experiment
Figure 10. Cytotoxicity-test of goldcompound by XTT.
Cells (3·104/mL) were treated for different time point (3, 6, 24 and 48 h) with increasing concentrations (range
from 3, 25 to 50 µM) of tested compound. IC50 values (expressed as µM)were calculated by probit analysis(P
05, χ2 test).
Primers Sequence Concentration
Β- actin Fwd ACCTGACTGACTACCTCATGAAGA 300 nM
Β-actin Rev GCGACGTAGCACAGCTTCTC 300 nM
TrxR2 Fwd TCAGAAGATCCTGGTGGACTCC 300 nM
TrxR2 Rev TCGTGGGAACATTGTCGTAGTC 300 nM
TrxR1 tot Fwd GCCCTGCAAGACTCTCGAAATTA 300 nM
TrxR1 tot Rev GCCCATAAGCATTCTCATAGACGA 300 nM
Grx2a Fwd GGACGCGGCTGGTTTGG 900 nM
Grx2a Rev CCGCAGCTCCCGCAGC 300 nM
Grx2tot Fwd AAATGACTGGTGAAAGAACTGTTCC 900 nM
Grx2tot Rev GAACTAGTGGGAGCAATTTTCCTTC 300 nM
Cytotoxicity 0 10 20 30 40 50 60 70 80 90 100 3 h 6 h 24 h 48 h IC 5 0 HeLa HeLa mGrx2 HeLa tGrx2
Figure 11. Expression of mRNA obtained by qRT-PCR after treatment with 0, 5 µM
goldcompound for 24 h.
8. Discussion
The knowledge that oxidative stress can lead to cellular damages by interaction between ROS and proteins, lipids, DNA and cause disorders in the cellular signalling system for gene expression, is well established [3]. Oxidative stress is also well known to be the major factor in aging, and a cause to several diseases, as neurodegenerative disorders, diabetes and cancer [4]. There are several intracellular mechanisms for upholding the redox homeostasis and pro-tect cells against oxidative stress. The two major antioxidant redoxsystems are the Thiore-doxin and GlutareThiore-doxin systems [44]. Many scientific articles report high expression of Thio-redoxin, Thioredoxin Reductase and Glutaredoxin in several tumour cells [5]. Some suggest that this might be linked to resistance in chemotherapies; while others indicating that high levels may induce apoptosis. Also, new data suggest that TrxR, which is a selenoprotein, is essential in carcinogenic development of invasive cancer. Due to this, both Trx and TrxR are considered with big interest, as target for chemotherapy but also in finding potent thioredoxin inhibitors [8]. Lately, gold-containing drugs have been validated as potent TrxR inhibitors. [45].
Selenium, a well-known trace mineral and essential in human health and primarily known as an antioxidant in the range of 10 –100 nM, also well established that supplementation of it can work as a cancer preventive treatment [33]. Lately studies has showed that selenium in form of selenite is a potential therapeutic drug in cancer treatment, by inhibiting growth of tumour cells and induces apoptosis in cytostatic drug-resistant malign cell-lines, while benign cell-lines stay unaffected.It has been suggested that the mechanism behind the toxicity is due to when selenocompounds causing oxidative stress and ROS –production, is due to when they interact with reduced GSH, and induces apoptosis [46].
The aim of this study was to investigate the enzyme kinetics of Grx1 with three Selenocom-pounds; selenocystine, selenodiglutathione, selenomethylselenocystine and possible see if
mRNA
0 0,5 1 1,5 2 2,5 3 3,54 4,5 5Hela untr Hela0,5 Hela
mGrx2 untr Hela mGrx2 0,5 Hela tGrx2 untr Hela tGrx2 0,5 TR1 TR2 Grx2a Grx2tot
they could be a substrate for Grx1. It is of importance to understand the cytotoxic mechanisms of selenocompounds. Apart from that, all these were substrates for Grx1. We also proved that selenodiglutathione and selenocystine has similar activity in the lower concentrations, but in higher concentration, selenocysteine causes more activity and consumption of NADPH with Glutaredoxin. In the initial experiments that were made, we also tested selenite as a substrate, but due to its high reactivity with GSH, leading to high background activity and consequently consumption of NADPH, made it impossible to draw any conclusions of what was measured. Probably the selenite by its high oxidative state, consumed all NADPH by it self and, suggest-ing, it started to redox cycle.
By treating the three HeLa cell lines with the selenocompounds for different time point (3, 6, 24 and 48 h) and with increasing concentrations, range from 1 µM to 10 µM, we saw that the different patterns of the three HeLa cell-lines, where the HeLa-cell line over expressing mGrx2 were more resistant to all selenocompounds, especially to selenodiglutathione, com-pared to the other cells. This indicates the role of Grx2 in the mitochondria, as a redoxprotein, protecting the cell of oxidative stress. In addition, tGrx2, over expressing the truncated form, instead was much more sensitive, and especially to selenodiglutathione confirms this further. As suspected, selenite was the most toxic selenocompound to all of the cell lines and after that, selenodiglutathione. In contrast, the IC50 with selenomethylselenocystine were not
reached for any of the cells, indicating that it has no toxic affect at all in these cells, probably due to lack of p-lyase
We also aimed to look at the gold compound inhibiting effect on Trx system and by this study the Grx-system, and how Grx2 would function without its electron donor, TrxR2, in cancer cells. For this, we first successfully optimized a qRT-PCR for Thioredoxin Reductase2, primers to match TrxR2 gene. After performing IC50-study where the cells were treated with
increasing concentrations of the goldcompound and 4 time-points, we choose to treat the cells with 0, 5µM of the gold compound for 24 h, for not risking the cells to go into apoptosis. Here we noted a different trend in the resistance to the goldcompound, compared to the se-lenocompounds. The HeLa cell with the truncated form of Grx2 was more resistant compared to the HeLa cell with the mitochondrial Grx2, which indicating an inhibiting effect of the TrxR2, and perhaps inability of Grx2 to reduce its environment. In addition the truncated form, seems to tolerate much higher concentrations. The normal HeLa cells seemed more re-sistant too.
When measuring the expression of mRNA of TrxR1 TrxR2, Grx2a and Grx2Tot, obtained by qRT-PCR showed the same pattern when comparing the cell-lines, like in the previous ex-periments. No over -all patterns between the three cell lines could be seen, but instead the differences between the HeLa mGrx2 cells and HeLa tGrx2 cells were clear. The normal HeLa cells reacted on the treatment with the goldcompound by an up regulation of TrxR1, down regulation of TrxR2 and up regulation of Grx2 (both 2a and 2Tot). The HeLa mGrx2 up regulated TrxR1, TrxR2 and Grx2. The HeLa tGrx2 cells on the other hand reacted on the treatment by down regulation of all the genes, except for TrxR2, with a slightly increase of it. All experiment needs to be repeated to confirm this findings, but our data over all supports previous findings showing the protective effect of Grx2 against apoptosis and protection against oxidative stress.
9. Future perspective
Further studies with the goldcompound in other concentrations to obtain the optimal concentration to inhibit TrxR2.
Further studies with the inhibiting concentration of gold together with the selenocom-pounds to see if it might sensitise cells.
10.
Acknowledgements
Of all my heart;
I would like to thank my supervisors Anna-Klara Rundlöf and Aristi Fernandes for all en-couragement and help with this project, and for letting me stay in this research group!
Thank you to Mikael Björnstedt who runs this research group with big enthusiasm in an inter-esting and important field.
Thank you to Eric Olm and Marcus Selenius for all laboratory assistance, discussions and good times.
Thank you to Valentina Gandin from University of Padua, Italy, for excellent collaboration and help with the gold-experiment and all discussions and good times too.
I would also like to thank my examinator professor Carl Påhlsson for every course that I’ve have had the big pleasure to have him as a tutor, and making every lesson exiting! Thanks for all wonderful stories about your friends!
Last, but not least, thank you Linda Andersson for all support and good times and laughs in the lab, support and work during our study-time, and most of all, being a good friend.
11. References
[1] Papp LV, Lu J, Holmgren A, Khanna KK. From selenium to selenoproteins: synthesis, identity, and their role in human health. Antioxid Redox Signal. 2007 Jul;9(7):775-806.
[2] Droge W. Free radicals in the physiological control of cell function. Physiol Rev. 2002 Jan;82(1):47-95.
[3] Nordberg J, Arnér ES. Reactive oxygen species, antioxidants, and the mammal-ian thioredoxin system. Free Radic Biol Med. 2001 Dec 1;31(11):1287-312.
[4] Upham BL, Wagner JG. Toxicant-induced oxidative stress in cancer. Toxicol Sci. 2001 Nov;64(1):1-3.
[5] Allen RG, Tresini M. Oxidative stress and gene regulation. Free Radic Biol Med. 2000 Feb 1;28(3):463-99.
[6] Dalton TP, Shertzer HG, Puga A. Regulation of gene expression by reactive oxygen. Annu Rev Pharmacol Toxicol. 1999;39:67-101.
[7] Griendling KK, Sorescu D, Lassegue B, Ushio-Fukai M. Modulation of protein kinase activity and gene expression by reactive oxygen species and their role in vascular physiology and pathophysiology. Arterioscler Thromb Vasc Biol. 2000 Oct;20(10):2175-83. [8] Gromer S, Urig S, Becker K. The thioredoxin system--from science to clinic. Med Res Rev. 2004 Jan;24(1):40-89.
[9] Holmgren A. Thioredoxin and glutaredoxin systems. The Journal of biological chemistry. 1989 Aug 25;264(24):13963-6.
[10] Arnér ES, Holmgren A. Physiological functions of thioredoxin and thioredoxin reductase. Eur J Biochem. 2000 Oct;267(20):6102-9.
[11] Arner ES, Holmgren A. The thioredoxin system in cancer. Semin Cancer Biol. 2006 Dec;16(6):420-6.
[12] Nimata M, Kishimoto C, Shioji K, Ishizaki K, Kitaguchi S, Hashimoto T, et al. Upregulation of redox-regulating protein, thioredoxin, in endomyocardial biopsy samples of patients with myocarditis and cardiomyopathies. Mol Cell Biochem. 2003 Jun;248(1-2):193-6.
[13] Spyrou G, Enmark E, Miranda-Vizuete A, Gustafsson J. Cloning and expression of a novel mammalian thioredoxin. The Journal of biological chemistry. 1997 Jan
31;272(5):2936-41.
[14] Miranda-Vizuete A, Ljung J, Damdimopoulos AE, Gustafsson JA, Oko R, Pelto-Huikko M, et al. Characterization of Sptrx, a novel member of the thioredoxin family specifically expressed in human spermatozoa. The Journal of biological chemistry. 2001 Aug 24;276(34):31567-74.
[15] Pekkari K, Avila-Carino J, Bengtsson A, Gurunath R, Scheynius A, Holmgren A. Truncated thioredoxin (Trx80) induces production of interleukin-12 and enhances CD14 expression in human monocytes. Blood. 2001 May 15;97(10):3184-90.
[16] Fritz-Wolf K, Urig S, Becker K. The structure of human thioredoxin reductase 1 provides insights into C-terminal rearrangements during catalysis. J Mol Biol. 2007 Jun 29;370(1):116-27.
[17] Björnstedt M, Kumar S, Holmgren A. Selenodiglutathione is a highly efficient oxidant of reduced thioredoxin and a substrate for mammalian thioredoxin reductase. The Journal of biological chemistry. 1992 Apr 25;267(12):8030-4.
[18] Björnstedt M, Hamberg M, Kumar S, Xue J, Holmgren A. Human thioredoxin reductase directly reduces lipid hydroperoxides by NADPH and selenocystine strongly stimu-lates the reaction via catalytically generated selenols. The Journal of biological chemistry. 1995 May 19;270(20):11761-4.
[19] May JM, Mendiratta S, Hill KE, Burk RF. Reduction of dehydroascorbate to ascorbate by the selenoenzyme thioredoxin reductase. The Journal of biological chemistry. 1997 Sep 5;272(36):22607-10.
[20] Arnér ES, Nordberg J, Holmgren A. Efficient reduction of lipoamide and lipoic acid by mammalian thioredoxin reductase. Biochemical and biophysical research communica-tions. 1996 Aug 5;225(1):268-74.
[21] Xia L, Nordman T, Olsson JM, Damdimopoulos A, Björkhem-Bergman L, Nal-varte I, et al. The mammalian cytosolic selenoenzyme thioredoxin reductase reduces
ubiquinone. A novel mechanism for defense against oxidative stress. The Journal of biologi-cal chemistry. 2003 Jan 24;278(4):2141-6.
[22] Sun QA, Kirnarsky L, Sherman S, Gladyshev VN. Selenoprotein oxidoreductase with specificity for thioredoxin and glutathione systems. Proc Natl Acad Sci U S A. 2001 Mar 27;98(7):3673-8.
[23] Rundlöf AK, Fernandes AP, Selenius M, Babic M, Shariatgorji M, Nilsonne G, et al. Quantification of alternative mRNA species and identification of thioredoxin reductase 1 isoforms in human tumor cells. Differentiation. 2007 Feb;75(2):123-32.
[24] Arnér ES. Recombinant expression of mammalian selenocysteine-containing thioredoxin reductase and other selenoproteins in Escherichia coli. Methods Enzymol. 2002;347:226-35.
[25] Fernandes AP, Holmgren A. Glutaredoxins: glutathione-dependent redox en-zymes with functions far beyond a simple thioredoxin backup system. Antioxid Redox Signal. 2004 Feb;6(1):63-74.
[26] Holmgren A, Morgan FJ. Enzyme reduction of disulfide bonds by thioredoxin. The reactivity of disulfide bonds in human choriogonadotropin and its subunits. Eur J Bio-chem. 1976 Nov 15;70(2):377-83.
[27] Lundberg M, Johansson C, Chandra J, Enoksson M, Jacobsson G, Ljung J, et al. Cloning and expression of a novel human glutaredoxin (Grx2) with mitochondrial and nuclear isoforms. The Journal of biological chemistry. 2001 Jul 13;276(28):26269-75.
[28] Johansson C, Lillig CH, Holmgren A. Human mitochondrial glutaredoxin re-duces S-glutathionylated proteins with high affinity accepting electrons from either glu-tathione or thioredoxin reductase. The Journal of biological chemistry. 2004 Feb 27;279(9):7537-43.
[29] Hashemy SI, Johansson C, Berndt C, Lillig CH, Holmgren A. Oxidation and S-nitrosylation of cysteines in human cytosolic and mitochondrial glutaredoxins: effects on structure and activity. The Journal of biological chemistry. 2007 May 11;282(19):14428-36. [30] Enoksson M, Fernandes AP, Prast S, Lillig CH, Holmgren A, Orrenius S. Over-expression of glutaredoxin 2 attenuates apoptosis by preventing cytochrome c release. Bio-chemical and biophysical research communications. 2005 Feb 18;327(3):774-9.
[31] Rayman MP. The importance of selenium to human health. Lancet. 2000 Jul 15;356(9225):233-41.
[32] Björkhem-Bergman L, Torndal UB, Eken S, Nystrom C, Capitanio A, Larsen EH, et al. Selenium prevents tumor development in a rat model for chemical carcinogenesis. Carcinogenesis. 2005 Jan;26(1):125-31.
[33] Clark LC, Combs GF, Jr., Turnbull BW, Slate EH, Chalker DK, Chow J, et al. Effects of selenium supplementation for cancer prevention in patients with carcinoma of the skin. A randomized controlled trial. Nutritional Prevention of Cancer Study Group. Jama. 1996 Dec 25;276(24):1957-63.
[35] Nilsonne G, Sun X, Nyström C, Rundlöf AK, Fernandes AP, Björnstedt M, et al. Selenite induces apoptosis in sarcomatoid malignant mesothelioma cells through oxidative stress. Free Radic Biol Med. 2006 Sep 15;41(6):874-85.
[36] Jonsson-Videsater K, Bjorkhem-Bergman L, Hossain A, Soderberg A, Eriksson LC, Paul C, et al. Selenite-induced apoptosis in doxorubicin-resistant cells and effects on the thioredoxin system. Biochemical pharmacology. 2004 Feb 1;67(3):513-22.
[37] Björkhem-Bergman L, Jönsson K, Eriksson LC, Olsson JM, Lehmann S, Paul C, et al. Drug-resistant human lung cancer cells are more sensitive to selenium cytotoxicity. Ef-fects on thioredoxin reductase and glutathione reductase. Biochemical pharmacology. 2002 May 15;63(10):1875-84.
[38] Messori L, Marcon G. Gold complexes in the treatment of rheumatoid arthritis. Met Ions Biol Syst. 2004;41:279-304.
[39] Simon TM, Kunishima DH, Vibert GJ, Lorber A. Inhibitory effects of a new oral gold compound on HeLa cells. Cancer. 1979 Dec;44(6):1965.
[40] Mirabelli CK, Sung CM, Zimmerman JP, Hill DT, Mong S, Crooke ST. Interac-tions of gold coordination complexes with DNA. Biochemical pharmacology. 1986 May 1;35(9):1427-33.
[41] Tiekink ER. Gold derivatives for the treatment of cancer. Critical reviews in oncology/hematology. 2002 Jun;42(3):225-48.
[42] Ellman GL. Tissue sulfhydryl groups. Archives of biochemistry and biophysics. 1959 May;82(1):70-7.
[43] Holmgren A, Björnstedt M. Thioredoxin and thioredoxin reductase. Methods Enzymol. 1995;252:199-208.
[44] Holmgren A. Thioredoxin and glutaredoxin: small multi-functional redox pro-teins with active-site disulphide bonds. Biochemical Society transactions. 1988 Apr;16(2):95-6.
[45] Nano JL, Czerucka D, Menguy F, Rampal P. Effect of selenium on the growth of three human colon cancer cell lines. Biological trace element research. 1989
Apr-May;20(1-2):31-43.
[46] Zhao R, Domann FE, Zhong W. Apoptosis induced by selenomethionine and methioninase is superoxide mediated and p53 dependent in human prostate cancer cells. Mol Cancer Ther. 2006 Dec;5(12):3275-84.
