Adenylyl cyclases in glucose-induced cAMP signaling in insulin-secreting β-cells
Songxi Guo
Degree project in applied biotechnology, Master of science (2 years), 2010 Examensarbete i tillämpad bioteknik 30 hp till masterexamen, 2010
Biology Education Centre and Department of Medical Cell Biology, Uppsala University Supervisor: Anders Tengholm
Summary
Cyclic adenosine monophosphate (cAMP) is a second messenger important in many biological processes. cAMP is synthesised from ATP by a group of enzymes known as adenylyl cyclases (ACs), of which there are ten isoforms with distinct regulatory properties in mammalian cells. In pancreatic β-cells cAMP has a strong stimulatory action on insulin secretion. Recent studies in this laboratory have indicated that glucose stimulation causes pronounced oscillations of cAMP concentration beneath the β-cell plasma membrane contributing to pulsatile insulin release, but it is now known which AC isoforms mediate this effect. This project aimed to identify the expression profile and functional importance of ACs for glucose-induced cAMP formation in insulin-secreting cells. Real-time PCR analysis of the different ACs in MIN6 β-cells demonstrated that AC6 was the most abundant isoform, followed by AC9, AC1 and AC3. In contrast, AC8 was present in barely detectable amounts.
The functional effect of the ACs was evaluated by semi-quantitative measurements of sub-plasma membrane cAMP concentration in single, glucose-stimulated MIN6 β-cells after down-regulation of the expression of specific ACs with siRNA. Treatment with 100 nM siRNA against AC6, AC9 and AC8 for 24 h reduced the corresponding mRNA levels by
~50%, whereas the oligonucleotides directed against AC1 and AC3 was relatively inefficient.
cAMP measurements after 48 h siRNA treatment demonstrated that the control cell responded to an elevation of the glucose concentration from 3 to 20 mM with elevation and pronounced oscillations of cAMP. The cAMP response was reduced and the oscillatory pattern perturbed in cells treated with siRNA against AC6, AC9 and AC8. These results suggest that glucose stimulates cAMP formation in β-cells by activating several AC isoforms. The importance of the weakly expressed AC8 may be explained by the presence of functional cAMP microdomains near the mouth of Ca2+ channels.
Introduction
1. Stimulus-secretion coupling in pancreatic β-cells Glucose-induced insulin secretion
The rise of blood glucose level after a meal leads to quick entrance of sugar to the β-cells via GLUT transporters [1]. Glucose is then rapidly metabolized through glycolysis to pyruvate, which enters the mitochondria and is subsequently oxidized to generate adenosine triphosphate (ATP) [1, 2]. The resulting increase of the ATP/ADP ratio causes closure of ATP-regulated K+ (KATP) channels in the plasma membrane, which leads to membrane deplorization and opening of voltage-dependent Ca2+channels (VDCCs) [3], allowing Ca2+ to quickly enter the cell. The resulting elevation of [Ca2+]i triggers the exocytosis of insulin granules [3]. There are several types of VDCCs, and the L-type VDCC is the major type in human and rodent β-cells [4, 5]. The [Ca2+]i elevation often occurs as oscillations, and these oscillations are important for triggering pulsatile insulin release from the β-cells, which is crucial for regulation of blood glucose level and many other functions in the cell [6,7]. The oscillations in membrane potential and [Ca2+]i are probably secondary to inherent variations in cell metabolism, but the exact mechanisms are not completely understood [8,9].
Glucose can also amplify insulin secretion by a mechanism acting distal to the elevation of [Ca2+]i [10]. This effect was discovered by studying the effect of glucose on insulin secretion caused by elevated [Ca2+]i under conditions when the KATP-channels were either kept opened or closed. With neither further alternations in membrane potential nor increase in [Ca2+]i [11], a rise of the glucose level initiated extra insulin secretion from β-cells treated with the KATP-channel blocker tolbutamide [11]. Similar effects were observed when the KATP-channels were kept open by diazoxide under depolarizing conditions [12]. However, the mechanism behind this amplifying pathway is still not well understood and various factors have been proposed to be responsible, such as ATP/ADP ratio, GTP, cAMP, Ca2+/calmodulin-dependent protein kinase II and acyl-CoA [10].
Neuro-hormonal regulation of insulin secretion
β-cells respond not only to increased glucose levels, but also to hormones, such as glucagon and GLP-1, and neural factors, such as acetylcholine released from intrapancreatic nerve terminals and ATP released from nerves and β-cells. Acetylcholine and ATP bind to Gαq-coupled receptors that stimulate phospholipase C, which in turn degrades the membrane lipid PIP2 into IP3 and diacylglycerol [13]. IP3 releases Ca2+ from the ER while diacylglycerol activates protein kinase C, and both mechanisms promote secretion [14]. Glucagon is secreted from α-cells in the islets of Langerhans in response to hypoglycemia. Glucagon has actions opposing those of insulin in blood glucose regulation and triggers glucose release from the liver. GLP-1 and GIP are from intestinal L- and K-cells, respectively, in response to food intake [15, 16]. The three hormones bind to Gαs-coupled receptors [17-19] to activate adenylyl cyclase (AC) and production of cAMP. This leads to an amplification of insulin secretion. GLP-1 has been reported to enhance β-cell function also by other mechanisms, which has lead to a strong interest in the use of GLP-1 for the treatment of diabetes. [20].
2. cAMP signaling in β-cells
The ATP-derived nucleotide cAMP is recognized as a key intracellular second messenger and since its discovery in the 1950s [21] it has been identified to regulate e.g. exocytosis, gene expression, cell growth, survival and metabolism [22]. In pancreatic β-cells, cAMP mediates the amplifying effect on insulin secretion by glucose-dependent insulinotropic peptide (GIP), the incretin hormones GLP-1 and glucagon [23, 24]. Although early studies indicated that glucose stimulation results in a modest elevation of islet cAMP [25-28], which was ascribed to the rise of [Ca2+]i [29, 30], more recent studies with fluorescent biosensors in single MIN6 cells or primary mouse pancreatic β-cells have demonstrated that glucose stimulates pronounced cAMP formation [31, 32] in this cell type and that the changes of cAMP often occurred as oscillations [59]. These oscillations were indeed amplified by elevations of [Ca2+]i, but persisted in the absence of stimulated Ca2+ entry [59].
The increase in intracellular cAMP concentration magnifies both first and second phase insulin secretion through several mechanisms. For instance, elevation of cAMP launches a signaling cascade that regulates the activity of GLUT2, KATP-channels, L-type VDCCs and IP3 receptors. In addition, it activates ATP-production in mitochondria through the PKA-mediated phosphorylation of enzymes in the oxidative phosphorylation process [33], and promotes insulin granule transport and release by regulating proteins directly involved in exocytosis [34, 35-37]. An elevated cAMP concentration also has long-term impact on β-cell functions, such as by activating insulin production and gene transcription [38, 39]. The effects of cAMP are mediated mainly via two effector proteins, PKA and Exchange protein directly activated by cAMP (Epac)[40].
3. cAMP synthesis by adenylyl cyclases (ACs)
cAMP is formed from ATP in a reaction catalyzed by the adenylyl cyclase family of enzymes after activation of Gαs -coupled hormone receptors. Nine membrane bound isoforms (AC1-9) and one soluble isoform (AC10, also named sAC) have been discovered in mammalian cells.
The nine membrane-associated isoforms share a common 120-140 kDa structure with twelve transmembrane regions and two cytosolic regions which form the ATP-binding catalytic domain upon dimerization [41]. All the membrane bound ACs can be stimulated through G-protein- coupled-receptors and Gαs subunits, while the inhibitory G-protein Gαi negatively regulates AC1, AC3, AC5, AC6, AC8 and AC9. Besides, The Gβγ subunits of the G protein also have type specific effects upon different AC isoforms [41, 42]. Accordingly, AC1 and AC8 are inhibited, whereas AC2, AC4 and AC7 are stimulated by the Gβγ complexes [41].
Meanwhile, AC isoforms are also subject to regulation by Ca2+ [42]. AC1 and AC8 are activated by Ca2+/calmodulin, whereas AC3, AC5, AC6, and AC9 are inhibited through different ways. For instance, AC3 inhibition is mediated by Ca2+ through Ca2+/calmodulin dependent protein kinases II and IV but AC 9 is inhibited by the Ca2+ regulated phosphatase calcineurin [43], wheras AC5 and AC6 are inhibited by competition between Ca2+ and Mg2+
for a high-affinity metal-binding site in the catalytic domain [44]. AC8 is regulated by capacitative calcium entry [45]. Some AC isoforms are subject to regulation by protein kinases. For example, PKA mediated phosphorylation feedback-inhibits AC5/AC6 [23] and protein kinase C has been found to stimulate AC2, AC4 and AC7 [22]. In addition of the
type-specific regulations by G-proteins, Ca2+ and protein kinases, different AC isoforms also show distinct distribution in subcellular compartments. The Ca2+-sensitive ACs have primarily been detected in caveolae-containing lipid rafts in the plasma membrane, often co-localizing with other regulatory proteins, such as calmodulin and phosphodiesterases [60].
Direct protein-protein interactions between ACs and L-type Ca2+-channels [46] and components involved in exocytosis [47] have also been reported. Recently, Ca2+
microdomains were identified to stimulate AC2 and AC8 at the plasma membrane [48].
Analyses of mRNA expression in β-cells have demonstrated different distributions of AC isoforms. In one study, AC5 and AC6 were found to be the most abundant AC isoforms in human Langerhans, while AC3, AC4 and AC6 were the most highly expressed in rat islets [49]. Another study suggested AC6 and AC8 as the most abundant isoforms in rat β-cells [50].
It was also discovered that the levels of AC8 are particularly high in β-cells from spontaneously diabetic GK-rats [51]. Although both Ca2+-inhibited and Ca2+-stimulated isoforms are expressed in β-cells, most functional studies indicate that calcium has a stimulatory effect on cAMP production [30, 50, 52].
While the in vitro Km of the transmembrane ACs is very low (100 µM), experimental data indicate that ATP might be an important AC regulator in intact cells, although the intracellular ATP concentration is in the millimolar range. Soluble AC (sAC) represents a distinct class of ACs that is insensitive to activation by G-proteins, but is regulated by bicarbonate, Ca2+ and millimolar concentrations of ATP [53]. It was originally believed that sAC only existed in sperm cells, but more recent studies have suggested that this isoform is expressed also in various somatic cell types [54]. A recent study shows the bicarbonate regulated sAC inside the mitochondria controlled ATP production through PKA mediated phosphorylation of mitochondrial respiratory chain proteins on AC expressing HeLa and COS-1 cells [55]. However, unpublished expression studies and pharmacological inhibition of the enzyme indicate that sAC is not involved in glucose-induced cAMP synthesis in β-cells (Tian & Tengholm, unpublished). It remains unknown which of the transmembrane AC isoforms that may mediate the cAMP synthesis stimulated by β-cell metabolism.
Aims
The aim of the presenty study was to identify the expression of different transmembrane AC isoforms and their functional role for glucose-induced cAMP synthesis in MIN6 β-cells.
Materials and methods
1. Cell culture, transfection and knock down with siRNA
Clonal MIN6 β-cells of passages 17-30 [56] were maintained in Dulbecco’s modified Eagle’s medium (DMEM) containing 25 mM glucose and supplemented with 2 mM L-glutamine, 70 µM β-mercaptoethanol, 100 U/mL penicillin, 100 µg/mL streptomycin, and 15 % fetal calf serum, at 37°C in a humidified atmosphere with 5% CO2. For imaging experiments, cells were seeded onto poly-L-lysine coated 25 mm glass coverslips and transfections were performed with 0.2-0.5 µg of plasmid and 0.5-1µg Lipofectamine™ 2000 in 100 µL Opti-MEM®-I per coverslip. Cells were then further cultured in DMEM for 24 hours to allow time for biosensors to express. For siRNA knock down experiments, 0.2 million MIN6 cells were transfected with 0.5 µg Lipofectamine 2000 and 100 nM siRNA against AC1(5’-guucaagacugugugcuautt-3’), AC3(5’-cauguaccggcacgagaautt-3’), AC6(5’-gugaauguuuccagucguatt-3’), AC8(5’-cuaugagaacgucaguauutt-3’), AC9(5’-caacuuggugccuuccguutt-3’), as well as GFP(gcaagcugacccugaaguucau) and Luciferase-GL3 (5’-cuuacgcugaguacuucgatt-3’) as control, 24 hours prior to real-time PCR analysis and 48 hours before the cAMP imaging. Each siRNA was stored in a 2 µM stock solution at -20 degrees, and the working concentration of 100 nM applied to the cells. We used both siRNA against green fluorescent protein (GFP) and lucifierase as control since neither of them is supposed to be expressed in mammalian cells.
2. Real-time PCR
The efficiency of siRNA-mediated knock-down was verified with real-time PCR. Total mRNA was isolated from MIN6 cells using RNeasy Plus mini kit (Qiagen GmbH, Hilden, Germany) and subsequently reverse-transcribed with SuperScript™ III First-Strand synthesis system for RT-PCR (Invitrogen) using random primers. The real-time PCR was performed using SYBR® Green JumpStart Taq ReadyMix™ (Sigma-Aldrich) and a LightCycler® Real-Time PCR System (Roche) with the following primers and protocols (table 1):
AC-1, sense-ctctactaccagtcctactc, antisense- cttatagaagtccttgtccat;
AC-3, sense-tgaggagagcatcaacaacg, antisense-tggtgtgactcctgaagctg;
AC-5, sense-aacgactccacctatgacaa, antisense-aatgactccagccactacag;
AC-6, sense-tatgccgctatcttcctgct, antisense-tggcagagatgaacacaagc;
AC-8, sense-gtcaggaaggacaacacctc, antisense-tgtaggtggcgaagagtgta;
AC-9, sense-catacagaaggcaccgatag, antisense-ccgaacaggtcattgagtag;
β-actin, sense-gttacaggaagtccctcacc, antisense-ggagaccaaagccttcatac.
A 10 µl reaction system was used for real-time PCR, with 0.5 µL primers (both sense and antisense, final concentration 0.5µM), 5µL Taq ReadyMix™ and around 1 to 2 µg/µl templates. The amount of each PCR product was first normalized to that of β-actin and then expressed in relation to the most abundant products. For siRNA experiments, expression levels are given relative to control according to the formula: fold change = 2ΔΔCt, where
ΔΔCt = [Ct(AC siRNA)- Ct(β-actin)]-[Ct(control siRNA)-Ct(β-actin control)].
Table1 Protocols for real-time PCR Number of
cycles
Temperature(°C) Incubation Time (s)
Temp.
Transition Rate (°C/s)
Denaturation 1 94 30 20
94 10 20
Annealing Temp(1) 10 20
Amplification 35
72 10 20
95 0 20
60 20 20
Melting Temperature Analysis 1 95 0 0.1 Cooling 40 30 20
Note: Annealing temperature for primers is gene-specific: AC1=52°C, AC3=53°C, AC5=52°C, AC6=53°C, AC8=53°C, AC9=53°C, β-actin=58°C
3. Single-cell cAMP measurements with total internal reflection fluorescence microscopy The plasma membrane concentration of cAMP ([cAMP]pm) was measured in real-time using total internal reflection fluorescence (TIRF) microscopy and a translocation biosensor based on a CFP-tagged and membrane anchored regulatory subunit of PKA (ΔRII-CFPCAAX) and a YFP-tagged PKA catalytic subunit (PKA-Cα-YFP) (Figure 1). Because of the high affinity interaction between the catalytic and regulatory subunits under basal conditions, the engineered PKA holoenzyme was located to the plasma membrane. When [cAMP]pm
increases, the Cα-YFP dissociates from the regulatory subunit and distributes to the cytoplasm.
With TIRF microscopy this translocation is demonstrated as a selective loss of YFP fluorescence while the fluorescent intensity of CFP remains the same (Figure 2).
Figure 1 Structure of the translocation biosensors. Reproduced from Dyachok et al Nature, 2006[61]
The biosensor consists of two parts. First, a PKA regulatory RIIβ subunit with 80 amino acid residues deleted in the NH2 terminus and fused to CFP extended with a COOH-terminal polybasic region and a CAAX motif. Second, the full length PKA catalytic Cα subunit fused to YFP. Sequences of the linkers and the polybasic region with the CAAX motif are shown in single letter code.
Figure 2 Principle for single-cell measurements of [cAMP]pm using the translocation biosensor.
When [cAMP]pm is low, Cα-YFP is bound to ΔRII-CFP-CAAX at the plasma membrane, but released to the cytoplasm when [cAMP]pm increases (upper panel). When detected with TIRF microscopy the release of Cα-YFP from the membrane upon increase of [cAMP]pm is detected as the loss of fluorescence, while the fluorescence from the membrane anchored ΔRII-CFP-CAAX remains unchanged (middle panel). Changes in [cAMP]pm are presented as the CFP/YFP fluorescence ratio (lower panel).
TIRF microscopy allows selective visualization of the plasma membrane and the cytoplasm within ∼100 nm from the interface between the glass coverslip and the adhering cell membrane [57,58]. The evanescent wave setup used in this study was built around an E600FN upright microscope (Nikon, Kanagawa, Japan). A helium-cadmium laser provided 442nm light for excitation of CFP, and the 514nm line of an argon laser was used to excite YFP. The output from the lasers was controlled by a filter wheel equipped with an electronic shutter. The merged beam was homogenized and expanded by a rotating light-shaping diffuser and refocused through a modified quartz dove prism at an angle of 70 degrees to achieve total internal reflection. Fluorescence light was collected through a 40x 0.8-NA water immersion objective and detected with a Hamamatsu Orca ER camera under MetaFluor software control. Emission wavelengths were selected with interference filters (485/25nm for CFP and 560/540nm for YFP) mounted in a filter wheel. Images were acquired every 5 seconds using exposure times in the 50-200 ms range. To minimize exposure to the potentially harmful excitation light, the beam was blocked with a shutter between image captures. Before experiments MIN-6 cells were transferred to a buffer containing 125 mM NaCl, 4.8 mM KCl, 1.3 mM CaCl2, 1.2 mM MgCl2 and 25 mM HEPES supplemented with 0.1 % BSA and 3 mM glucose and with pH adjusted to 7.40 with NaOH and incubated for 30 min at 37°C. After incubation the coverslips with the attached cells were mounted as
exchangeable bottoms of an open 50-µL chamber and superfused with buffer at a rate of 0.3 mL/min.
Results
1. Real-time PCR of AC isoforms in MIN6 cells
Real-time PCR analysis of the relative mRNA expression levels of ACs showed that AC6 was most highly expressed, followed by AC9 and AC1. AC3 and AC5 were considerably less expressed and AC8 only detected after >30 cycles (Table1 and Figure 3). Amplified products were controlled for length by ethidium bromide staining after electrophoresis on 1% agarose (Figure 4).
Table 1 Crossing point values (Ct) for different AC isoforms Isofrom AC1 AC3 AC5 AC6 AC8 AC9 β-actin Ct 22.80 25.31 29.26 20.18 30.67 20.87 20.72
Figure 3 Expression of different AC isoforms in MIN-6 cells
Figure 4 Agarose gel electrophoresis of amplified PCR products showing the expected length of ~150 bp.
2. siRNA knock down
Next, AC expression was modulated by application of siRNA. The efficiency of knock down was examined by isolating total RNA from MIN6 cells after 24 hours of siRNA treatment.
Real-time PCR was subsequently performed using the same reaction conditions as above, and
the mRNA level expressed in relation to the control group treated with siRNA against GFP and luciferase. Figure 5 shows the averages of two independent experiments. Each of AC3, AC6, AC8 and AC9 was down-regulated by about 50%, whereas siRNA against AC1 hardly affected the mRNA level of AC1.
A AC1 level in siRNA against AC1 treated MIN-6 cells B AC3 level in siRNA against AC38 treated MIN-6 cells
C AC6 level in siRNA against AC68 treated MIN-6 cells D AC8 level in siRNA against AC8 treated MIN-6 cells
E.AC9 level in siRNA against AC9 treated MIN-6 cells
Figure 5 Real-time PCR analysis of AC expression in MIN6 β-cells treated with AC isoform-specific siRNA. Expression level for each AC after treatment with the corresponding siRNA or control siRNA
against luciferase (LUC) or GFP is shown in relation to the GFP control.
3. Role of different ACs for glucose-induced cAMP synthesis in MIN6 cells
The functional role of different ACs in glucose-induced cAMP synthesis was examined by siRNA knock-down and real-time monitoring of cAMP concentration changes in MIN6 cells following glucose stimulation. MIN6 cells were treated with siRNA against either of AC6, AC8 and AC9 with siRNA against luciferase as control. The reason to pick these three AC isoforms to start with was that AC6 and AC9 was highly expressed and were most efficiently down-regulated. AC8 was barely detectable, but on the other hand, this isoform has previously been suggested to be important in β-cells [50]. In control cells, elevation of the glucose concentration from 3 to 20 mM triggered after a few minutes delay an increase of the cAMP concentration with pronounced oscillations (Figure 6).
Figure 6 cAMP oscillations triggered by elevation of the glucose concentration from 3 to 20 mM in a single MIN-6 cells expressing a fluorescent cAMP translocation reporter and treated with control siRNA against luciferase. Representative of 12 recordings.
Preliminary experiments indicate that whereas the glucose-induced response was only slightly inhibited in cells treated with siRNA against AC6 and AC9, it was virtually abolished in cells treated with siRNA against AC8 (Figures 7 to 9).
Figure 7 Glucose-induced cAMP response in MIN-6 cells treated with siRNA against AC6. Representative of 8 recordings.
Figure 8 Glucose-induced cAMP response was markedly inhibited in MIN-6 cells treated with siRNA against AC8. Representative of 10 recordings.
Figure 9 Glucose-induced cAMP response in MIN6 cells treated with siRNA against AC9. Representative of 8 recordings.
The normalized initial response after high glucose treatment was shown in Figure 10.
Figure 10 Normalization of initial response after 20mM glucose treatment.
Curves were first normalized against basal level and then the columns were generated by calculating the area of the first five minutes under the normalized oscillation curves. ***: P<0.001 for the differences from control.
Discussion
In the present study the expression level and functional importance of different ACs were investigated in MIN6 β-cells. AC6, AC9 and AC1 were found to by most highly expressed.
The expression pattern seems to vary between different types of insulin secreting cell and islet preparations. For instance, AC5 and AC6 were found to be the most plentiful AC isoforms in human islets of Langerhans [49], AC3 was most highly expressed in rat islets and AC6 and AC8 were the dominant types in rat β-cells [50]. It is important to perform expression and functional analyses in the same preparation. The MIN6 cells permitted simultaneous transfection with siRNA and a cAMP translocation biosensor to analyze the importance of particular AC isoforms for generation of glucose-induced cAMP oscillations.
From the figures comparing AC levels in AC-siRNA-treated and control-siRNA-treated cells we can see that the knock-down efficiency is about 50% for AC3, AC6, AC8 and AC9, whereas downregulation of AC1 did not work very well. It is interesting to find that although both GFP and luciferase are not present in MIN-6 cells, the level of AC in cells treated with siRNA against these proteins shows a slight decrease (~5%) in cells treated with siRNA against the control genes. The mechanism behind this decline is not clear, but probably reflect non-specific suppression of transcription in response to double-stranded RNA.
Experimentss should be conducted to verify that each siRNA specifically downregulates one isoform of AC. Apart from analysis of mRNA expression, experiments aimed to restore function by reintroducing the downregulated AC isoform can be performed. It will then be important to use AC cDNA from a species with a different sequence or with a mutation in the targeted sequence to excape the downregulation.
As previously reported [59], elevation of the glucose concentration triggered pronounced cAMP oscillations in the MIN6 cells. The amplitude of the oscillations seemed to be reduced in both AC6- and AC9-deficient cells, indicating that these two isoforms may be involved to mediate the stimulatory effect of glucose metabolism on cAMP synthesis. Since the efficiency of siRNA knock down was partial it is not surprising that the functional effect was only modest. More experiments are required to verify this finding. The observation that the cAMP oscillations were completely inhibited in cells treated with siRNA against AC8 was surprising, given the extremely low expression levels of this enzyme. Since the efficiency of the PCR was not properly verified, it is possible that we have underestimated the expression level of this isoform. It has been proposed that AC8 is colocalized in the close vicinity of plasma membrane Ca2+ channels and that the enzyme specifically reacts to the Ca2+ entering through the channels [45]. With such a specific subcellular localization, it may be sufficient with a small amount of protein to exert a pronounced functional effect.
Previous studies have indicated that Ca2+ amplifies glucose-induced cAMP signals, but that the cAMP oscillations are not directly reflecting the changes in [Ca2+]i [59]. It is therefore likely that glucose-induced production involves ACs both stimulated by Ca2+ and those which are not. The present study indicates that this is indeed the case. The detailed function of the abundant AC6, which is inhibited by Ca2+ remains to be established.
Conclusion
1. Several AC isoforms, including AC1, AC3, AC5, AC6, AC8 and AC9, are present in MIN-6 cells, with AC6, AC9 and AC1 being the top three most abundant isoforms.
2. Glucose-induced cAMP formation most likely involves several AC isoforms, some of which are stimulated by Ca2+ and some of which are not.
Future work
In order to substantiate the above conclusions, a determination of the efficiency of the PCR reactions and the specificity of siRNA-mediated down regulation are important. Functional analyses of a larger number of cells are also required to confirm the findings. Using the same methodology, the importance of other AC isoforms will also be evaluated.
Acknowledgements
I would like to show my great appreciation to my supervisor Dr. Anders Tengholm for giving me the opportunity to carry out this thesis work, for his patience, support and encouragement, for so much I have learnt from him, from bench tricks to enthusiasm to science.
Thanks to all the members in the lab: Tian, for being my lab orientation instructor; Jia, for making so many coverslips for me; Olfo, for answering my questions in both lab work and Swedish studies; Anne, for helping me with microscope, Ing-Marie, for helping me with molecular biology in the lab, Oleg, for sharing the biosensor with me, Helene, for always so kind and smile on your face.
Thanks to STINT foundation for financial support during my master study.
Thanks to my family for their rigid support and deep love. Thanks to my friend for their help and delicious food.
References
1. De Vos, A., H. Heimberg, E. Quartier, P. Huypens, L. Bouwens, D. Pipeleers, and F.
Schuit, J Clin Invest 96:2489-95, 1995.
2. Matschinsky, F. M. (1990) Diabetes 39(6), 647-652
3. Ashcroft, F.M. and P. Rorsman, Prog Biophys Mol Biol 54:87-143, 1989.
4. Yang, S.N. and P.O. Berggren, Endocr Rev 27:621-76, 2006.
5. Schulla, V., E. Renstrom, R. Feil, S. Feil, I. Franklin, A. Gjinovci, X.J. Jing, D. Laux, I.
Lundquist, M.A. Magnuson, S.Obermuller, C.S. Olofsson, A. Salehi, A. Wendt, N.
Klugbauer, C.B. Wollheim, P. Rorsman, and F. Hofmann, Embo J 22:3844-54, 2003.
6. Tengholm, A. and E. Gylfe, Mol Cell Endocrinol, 2008.
7. Tornheim, K.C., Diabetes 46:1375-80, 1997.
8. Henquin, J.C., Diabetes 39:1457-60, 1990.
9. Kennedy, R.T., L.M. Kauri, G.M. Dahlgren, and S.K. Jung, Diabetes 51 Suppl 1:S152- 61, 2002
10. Henquin, J.C., Diabetes 49: 1751-60, 2000
11. Sato, Y., M. Anello, and J.C. Hequin, Endocrinology 140:2252-7, 1999
12. Gembal, M., Gilon, P., and Henquin, J. C. Journal of Clinical Investigation 89(4), 1288-1295,1992
13. Berridge, M.J., P. Lipp, and M.D. Bootman, Nat Rev Mol Cell Biol 1:11-21, 2000.
14. Zawalich, W.S. and K.C. Zawalich, Am J Physiol 271:E409-16, 1996.
15. Tseng,C.C., L.A. Jarboe, and M.M. Wolfe, Am J Physiol 266:G887-91, 1994.
16. Reimann, F. and F.M. Gribble, Diabetes 51:2757-63, 2002.
17. Thorens, B., Proc Natl Acad Sci U S A 89:8641-5, 1992.
18. Gromada, J., I. Franklin, and C.B. Wollheim, Endocr Rev 28:84-116, 2007.
19. Baggio, L.L. and D.J. Drucker, Gastroenterology 132:2131-57, 2007.
20. Ahrén, B., Bioessays 20:642-51, 1998.
21. Sutherland, E.W. and T.W. Rall, J Biol Chem 232:1077-91, 1958.
22. Beavo, J.A. and L.L. Brunton, Nat Rev Mol Cell Biol 3:710-8, 2002.
23. Gromada, J., Brock, B., Schmitz, O., and Rorsman, P. (2004) Basic Clin Pharmacol Toxicol 95(6), 252-262
24. Holz, G. G., W. M. Kuhtreiber, and J.F. Habener, Nature 361, 362- 5, 1993
25. Charles, M.A., R. Fanska, F.G. Schmid, P.H. Forsham, and G.M. Grodsky, Science 179:569-71, 1973.
26. Grill, V. and E. Cerasi, FEBS Lett 33:311-4, 1973.
27. Hellman, B., L.Å. Idahl, Å. Lernmark, and I.B. Täljedal, Proc Natl Acad Sci U S A71:3405-9, 1974.
28. Sharp, G.W., Diabetologia 16:287-96, 1979.
29. Charles, M.A., J. Lawecki, R. Pictet, and G.M. Grodsky, J Biol Chem 250:6134-40, 1975.
30. Valverde, I., A. Vandermeers, R. Anjaneyulu, and W.J. Malaisse, Science 206:225-7, 1979.
31. Landa, L.R., Jr., M.Harbeck, K. Kaihara, O. Chepurny, K. Kitiphongspattana, O. Graf, V.O. Nikolaev, M.J. Lohse, G.G. Holz, and M.W. Roe, J Biol Chem 280: 31294-302, 2005.
32. Kim, J. W., Roberts, C. D., Berg, S. A., Caicedo, A., Roper, S. D., and Chaudhari, N.
PLoS One 3(5), e2127, 2008.
33. Pagliarini, D. J., and Dixon, J. E. Trends Biochem Sci 31(1), 26-34,2006
34. Dyachok, O., and Gylfe, E. Journal of Biological Chemistry 279(44), 45455- 61, 2004.
35. Kang, G., Joseph, J. W., Chepurny, O. G., Monaco, M., Wheeler, M. B., Bos, J. L., Schwede, F., Genieser, H. G., and Holz, G. G. Journal of Biological Chemistry 278(10), 8279-85, 2003.
36. Renstrom, E., Eliasson, L., and Rorsman, P. Journal of Physiology 502(Pt1), 105-18, 1997.
37. Doyle, M. E., and Egan, J. M. Pharmacol Rev 55(1), 105-31, 2003.
38. Doyle, M. E., and Egan, J. M. Pharmacol Ther 113(3), 546-93, 2007.
39. Doyle, M. E., and Egan, J. M. Recent Prog Horm Res 56, 377-99, 2001.
40. Aumo L, Rusten M, Mellgren G, Bakke M, Lewis AE., Endocrinology. 151(5), 2151-61, 2010.
41. Cooper, D.M., Biochem J 375:517-29, 2003.
42. Willoughby, D., and Cooper, D. M. Physiol Rev 87(3), 965-1010, 2007.
43. Paterson, J. M., Smith, S. M., Simpson, J., Grace, O. C., Sosunov, A. A., Bell, J. E., and Antoni, F. A. J Neurochem 75(4), 1358-67, 2000.
44. Guillou, J. L., Nakata, H., and Cooper, D. M. J Biol Chem 274(50), 35539- 45, 1999.
45. Pagano, M., Clynes, M.A., Masada, N., Ciruela, A., Ayling, L.J., Wachten, S., and Cooper, D.M., Am J Physiol Cell Physiol, 296(3): C607- 19, 2009
46. Davare, M. A., Avdonin, V., Hall, D. D., Peden, E. M., Burette, A., Weinberg, R. J., Horne, M. C., Hoshi, T., and Hell, J. W. Science 293(5527), 98-101, 2001
47. Chou, J. L., Huang, C. L., Lai, H. L., Hung, A. C., Chien, C. L., Kao, Y. Y., and Chern, Y.
J Biol Chem 279(44), 46271-9, 2004.
48. Willoughby, D., Wachten, S., Masada, N., and Cooper, D. M. J Cell Sci 123(Pt 1), 107-17.
49. Leech, C.A., M.A. Castonguay, and J.F. Habener, Biochem Biophys Res Commun 254:703-6, 1999.
50. Delmeire, D., D. Flamez, S.A. Hinke, J.J. Cali, D. Pipeleers, and F. Schuit, Diabetologia 46:1383-93, 2003.
51. Guenifi, A., G.M. Portela-Gomes, L. Grimelius, S. Efendic, and S.M. Abdel-Halim, Histochem Cell Biol 113:81-9, 2000.
52. Tian, Y. and S.G. Laychock, Diabetes 50:2505-13, 2001.
53. Wuttke, M. S., Buck, J., and Levin, L. R. Jop 2(4 Suppl), 154- 8, 2001.
54. Ramos, L. S., Zippin, J. H., Kamenetsky, M., Buck, J., and Levin, L. R. J Gen Physiol 132(3), 329-38, 2008.
55. Acin-Perez, R., Salazar, E., Kamenetsky, M., Buck, J., Levin, L. R., and Manfredi, G. Cell Metab 9(3), 265- 76, 2009.
56. Miyazaki, J., Araki, K., Yamato, E., Ikegami, H., Asano, T., Shibasaki, Y., Oka, Y., and Yamamura, K. Endocrinology 127(1), 126- 32, 1990.
57. Steyer, J. A., and Almers, W. Nature Reviews Molecular Cell Biology 2(4), 268-75, 2001.
58. Axelrod, D. Traffic 2(11), 764-74, 2001.
59. Dyachok, O., Idevall-Hagren, O., Sagetorp. J, Tian, G., Wuttke, A., Arrieumerlou, C.,
Akusjarvi, G., Gylfe,E. and Tengholm, A. , Cell Metabolism 8, 26-37,2008.
60. Crossthwaite, A.J., Seebacher, T., Masada, N., Ciruela, A., Dufraux, K., Schultz, J.E, and Cooper. D.M. J Biol Chem 280(8), 6380-91, 2005.
61. Dyachok, O., Isakov, Y., Sagetorp, J., and Tengholm, A Nature 439,349-52,2006.
