Wnt/β-Catenin Signalling in Parathyroid Tumours

Full text

(1)Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 293. Wnt/β-Catenin Signalling in Parathyroid Tumours PEYMAN BJÖRKLUND. ACTA UNIVERSITATIS UPSALIENSIS UPPSALA 2007. ISSN 1651-6206 ISBN 978-91-554-7029-6 urn:nbn:se:uu:diva-8317.

(2)

(3)

(4)

(5)

(6)

(7)

(8)

(9)

(10) ! " # $% &'( ) *+ ,

(11) -. /

(12)

(13) 0

(14)

(15) "0. 1!2

(16) ). $%. 3

(17) 4567

(18)

(19) "

(20)

(21)

(22) ) / .

(23)

(24) .

(25)

(26)

(27)

(28) $&8. 98 . . :"1; &%#6&(6<6%$&69. ) * =)/- 0

(29) .

(30)

(31)

(32) 0

(33)

(34)

(35)

(36) ( >

(37)

(38) 0

(39) . :

(40)

(41) *=)/-

(42)

(43) .

(44)

(45)

(46)

(47)

(48)

(49) 0 . =)/

(50)

(51) . / 0

(52) 3

(53) 456

(54)

(55)

(56)

(57) 0

(58) .

(59) 56

(60)

(61) 0

(62)

(63)

(64) =)/

(65) =)/ 0 .

(66) ?

(67) *"8% -

(68) %.8> =)/ . /

(69)

(70) )7

(71) 0

(72)

(73) . ,@7 56

(74)

(75)

(76) 0

(77) .

(78)

(79) =)/

(80) =)/ .

(81) *=)/6(- 0

(82)

(83)

(84) 0 =)/. /

(85)

(86) 0 0

(87) %$ . "

(88)

(89)

(90)

(91) 56

(92)

(93) 0 .

(94)

(95)

(96) A;

(97) 56

(98)

(99)

(100)

(101) (

(102) ,@7

(103)

(104) 0 0

(105)

(106) . / 3

(107) BA) 0

(108) 0

(109)

(110)

(111)

(112) (<$

(113) . *BA)C-

(114) #9>

(115) (> =)/

(116) =)/ . "

(117)

(118) 56

(119)

(120)

(121)

(122) BA)C 0 .

(123) BA)C 0 D

(124)

(125)

(126)

(127)

(128)

(129) E6

(130)

(131) ,@7

(132) 0

(133)

(134) 0

(135)

(136)

(137) "7: . 3

(138) 8

(139)

(140) BA)C

(141)

(142)

(143)

(144) BA)C 0

(145)

(146)

(147)

(148) FF(.

(149)

(150) 56

(151)

(152)

(153)

(154)

(155) BA)C.

(156)

(157) 0 . BA)C

(158)

(159)

(160)

(161)

(162)

(163) . = 56

(164)

(165) ,

(166) =

(167)

(168) BA)

(169)

(170)

(171) !"#$ %

(172) % &$

(173) $ "$% % '()*+,* % G )

(174) 1!2

(175) $% :""; (9(69$9 :"1; &%#6&(6<6%$&69

(176) '

(177)

(178) ''' 6#8(% * '44

(179) . .4 H

(180) I

(181) '

(182)

(183) ''' 6#8(%-.

(184) To Lale Without your support I would have been somewhere else, somewhere much darker, somewhere much colder..

(185)

(186) List of papers. This thesis is based on the following papers, which will be referred to in the text by their roman numerals: I. II. III. IV. 1. Peyman Björklund, Göran Åkerström, and Gunnar Westin. Accumulation of nonphosphorylated -catenin and c-myc in primary and uremic secondary hyperparathyroid tumors. Journal of Clinical Endocrinology & Metabolism, 2007 Jan; 92(1):338-344. Peyman Björklund, Daniel Lindberg, Göran Åkerström, and Gunnar Westin. Stabilizing mutations of CTNNB1/catenin in parathyroid adenomas of Swedish patients. Submitted. Peyman Björklund, Göran Åkerström, and Gunnar Westin. Activated -catenin in the novel human parathyroid tumor cell line sHPT-1.1 Biochemical and Biophysical Research Communications, 2007 Jan 12; 352(2):532-536. Peyman Björklund, Göran Åkerström, and Gunnar Westin. An LRP5 receptor with internal deletion in hyperparathyroid tumors with implications for deregulated Wnt/-catenin signaling.1 PLoS Medicine 2007, in press.. Protected intellectual property; patent is filed (USA) No. WO2005048913.

(187)

(188) Contents. Introduction...................................................................................................11 The parathyroid glands.............................................................................11 Hyperparathyroidism (HPT).....................................................................12 Primary hyperparathyroidism (pHPT) .................................................12 Inherited forms of primary hyperparathyroidism ................................13 Lithium associated hyperparathyroidism.............................................13 Hyperparathyroidism secondary to uraemia (sHPT) ...........................13 Wnt-signalling pathways..........................................................................14 The canonical Wnt-signalling pathway: The two-state model ............14 -catenin (CTNNB1) ...........................................................................16 LRP5....................................................................................................17 Aims of the study ..........................................................................................20 Materials and Methods..................................................................................21 Summary of materials and methods .........................................................21 Tissue specimens .................................................................................21 Immunohistochemistry ........................................................................21 Western blotting ..................................................................................22 RNA isolation and cDNA synthesis ....................................................22 PCR......................................................................................................23 RT-PCR ...............................................................................................23 DNA sequencing..................................................................................24 Restriction enzyme digestion...............................................................25 CTNNB1 copy number analysis..........................................................25 Immunofluorescence............................................................................25 Transfection of siRNA.........................................................................26 Conditioned medium ...........................................................................26 Plasmid construction and transient transfection ..................................27 Immunoprecipitation............................................................................27 Luciferase reporter assay .....................................................................27 Cell growth determination and flow cytometry ...................................28 Chromatin immunoprecipitation..........................................................28 Mouse xenograft model .......................................................................28 Statistical analysis................................................................................29.

(189) Results and discussion ..................................................................................30 Paper I ......................................................................................................30 Paper II .....................................................................................................31 Paper III....................................................................................................32 Paper IV ...................................................................................................33 Concluding remarks ......................................................................................35 Acknowledgements.......................................................................................37 References.....................................................................................................39.

(190) Abbreviations. 1,25(OH)2D3 25(OH)2D3 Ala APC -Trcp Ca2+ CASR CBP CDK CDKN CKI DCAP DKK1 DMEM DNA FAP FCS FRAT1 Fzd GAPDH Gcm2 GSK3 HPT HRPT2 IHC JNK LEF1 LOH LRP Lys MEN1 Mesd mRNA NF-AT NF-B. 1,25-dihydroxyvitamin D3 (calcitriol) 25-dihydroxyvitamin D3 Alanine Adenomatous polyposis coli -transducin repeat containing protein 1 Ionised calcium Calcium sensing receptor CREB-binding protein Cyclin dependent kinase CDK inhibitor Casein kinase inhibitor Drosophila homolog of CAP Dickkopf-1 Dulbecco's modified Eagle's medium Deoxyribonucleic acid Familial adenomatous polyposis Foetal calf serum Frequently rearranged in advanced T-cell lymphomas 1 Frizzled Glyceraldehyde-3-phosphate dehydrogenase Glial cells missing homolog 2 Glycogen synthase kinase 3 Hyperparathyroidism Human hyperparathyroidism 2 (with jaw tumour) Immunohistochemistry c-jun N-terminal kinase Lymphoid enhancer-binding factor 1 Loss of heterozygosity Low-density lipoprotein receptor-related protein Lysine Multiple endocrine neoplasia type 1 Mesoderm development gene Messenger RNA Nuclear factor of activated T-cells Nuclear factor of kappa light polypeptide gene enhancer in B-cells.

(191) PBS PCNA PCP pHPT PKC PLC PTH ROCK RNA Ser sHPT Siah SOST TCF Thr VDR WB Wnt. Phosphate buffered saline Proliferating cell nuclear antigen Planar cell polarity Primary HPT Protein kinase C Phospholipase C Parathyroid hormone Rho-kinase Ribonucleic acid Serine Secondary HPT Seven in absentia homolog Sclerosteosis Transcription factor Threonine Vitamin D receptor Western blotting Wingless-type.

(192) Introduction. The parathyroid glands The parathyroid glands were discovered in Uppsala by Ivar Sandström (1). Usually there are four parathyroid glands, two superior and two inferior, located symmetrically, dorsal of the thyroid gland (2). The parathyroid glands are the unique producers of parathyroid hormone (PTH), which is a peptide hormone consisting of 84 amino acids (3). Blood calcium levels tightly regulate secretion of PTH. PTH binds to type I PTH receptors (4, 5), to initiate signal transduction in target tissues (most importantly bone and kidney), affecting vitamin D metabolism (6-9), with the ultimate aim to maintain a constant serum calcium level (10, 11). Vitamin D receptors (VDRs) are expressed in the parathyroids and mediate feed-back regulation on PTH secretion and mRNA expression, by circulating levels of active vitamin D, 1,25(OH)2D3, (9, 12-16). PTH secretion is inversely regulated by the extracellular Ca2+concentration in a dose-response manner, which can be described by a steep sigmoidal curve (10, 11). The extracellular Ca2+-concentration required to decrease the PTH secretion to 50% of maximum, is defined as the set-point, and corresponds to a physiological free Ca2+-concentration of 1.10-1.25 mM. (17). Calcium sensing in parathyroid glands is mediated by the calcium sensing receptor (CASR), a 120 kD cell surface receptor. Upon binding of extracellular Ca2+ it affects intracellular inositol phosphate levels and regulates PTH secretion and mRNA levels (18-20). CASR was cloned from bovine parathyroid cells and mapped to human chromosome 3 (21). Low-density lipoprotein receptor-related protein 2 (LRP2), even designated Megalin, is another cell surface receptor expressed in parathyroid cells (22), known to bind Ca2+ (23-25). Monoclonal antibodies against LRP2 inhibited increase of intracellular Ca2+-concentration in human parathyroid adenoma cells cultured in a high Ca2+ content medium (26-28). LRP2 was shown to be involved in 25(OH)2D3 uptake by endocytosis in kidney tubule cells (29). In addition, the vitamin D regulating enzymes 25(OH)2D3 1hydroxylase, 25(OH)2D3 24-hydroxylase and vitamin D3 25-hydroxylase were shown to be expressed in parathyroid cells, indicating a possibility of locally synthesised 1,25(OH)2D3 (30, 31).. 11.

(193) Hyperparathyroidism (HPT) HPT occurs as primary hyperparathyroidism (pHPT), most commonly sporadic and occasionally in inherited forms. HPT may also develop secondary to calcium and vitamin D deficiency in patients with renal disease and uraemia (sHPT). Parathyroidectomy is the considered therapy for the majority of patients.. Primary hyperparathyroidism (pHPT) pHPT is a common disease, affecting 1 % of the population, with a peak incidence between 50 and 60 years of age, and female predominance (3235). Prior neck irradiation is the cause of tumour development in a minority group of patients (36, 37). The disease is characterised by high serum calcium, associated with high serum PTH values. Patients may present with classical symptoms of bone disease, with reduction of bone mineral density, or a renal stone disorder, or vague symptoms of fatigue and psychiatric disorders (35). Cardiovascular disease, hypertension (38, 39), dyslipidemia (40) and insulin-resistance (41) are also associated with pHPT. Sporadic pHPT is caused by adenoma (~85 %), hyperplasia, or multiple adenomas (~15 %) (42). Parathyroid carcinoma is rare (<1 %) (43). Despite intense efforts, the molecular mechanism(s) of parathyroid tumourigenesis is largely unknown. Pericentromeric inversions of chromosome 11, positioning the PTH promoter in front of the CCND1/cyclin D1 gene has been shown in a small subset of parathyroid adenomas (44, 45). Increased expression of cyclin D1 protein was demonstrated in 20-60 % of parathyroid adenomas by unknown mechanisms (46-49). These data together with the evidence for development of HPT in transgenic mice overexpressing cyclin D1 in the parathyroid glands, implicated an important role for cyclin D1 in parathyroid tumourigenesis (50). Menin, the MEN1 gene product, is a 67 kD nuclear protein (51-54). Menin has many interacting partners, Smad3, NF-B, nm23, and Pem among others indicating a role for menin in cell differentiation and growth (55-58). MEN1 knockout mouse models developed parathyroid tumours (59). A subset of parathyroid adenomas (15 %) displayed bi-allelic inactivation of MEN1 (60-63). The MEN1 gene polymorphism D418D showed to be associated with sporadic pHPT (64). HRPT2/parafibromin was first identified as the gene mutated in the hyperparathyroidism-jaw tumour (HPT-JT) syndrome (65). Parafibromin is a nuclear protein (66-68) and was found associated to PAF1 and RNA polymerase II (69, 70). Parafibromin was also bound to –catenin and enhanced 12.

(194) its transcriptional activity (71). Furthermore, parafibromin regulated cyclin D1 expression (72), showed proapoptotic properties (73), and inhibited cancer cell growth by inducing G1 phase arrest (74). Loss of HRPT2 expression, but no mutations, have been reported in a subset of parathyroid adenomas (75, 76). Deregulated expression of VDR (77), 25(OH)2D3 1-hydroxylase, (31), CDKN2C/p18, CDKN1A/p21, 25(OH)2D3 24-hydroxylase CDKN1B/p27 (30) and Gcm2 (78) have also been reported in parathyroid tumours. Parathyroid carcinoma is very rare and lethal (43). Mutations in HRPT2/parafibromin, have been found in 66-100 % of analysed parathyroid carcinomas (79, 80). Loss of retinoblastoma (Rb) protein expression and LOH, corresponding to the RB gene, but without evidence for mutations (81), and p53 abnormalities (82) have also been described.. Inherited forms of primary hyperparathyroidism A small subset of all parathyroid tumours (~5 %) are manifestations of inherited syndromes; MEN1, MEN2A, familial hypocalciuric hypercalcaemia and hyperparathyroidism-jaw tumour syndrome. The mutated genes involved are MEN1(83), RET (84, 85), CASR (86) and HRPT2 (65), respectively.. Lithium associated hyperparathyroidism Lithium salt is commonly used in treatment of unipolar and bipolar disorders. Chronic treatment with lithium salt is associated with HPT (87-92). Lithium therapy can cause, more commonly, micronodular hyperplasia (93), in which adenoma may develop (88, 94). The prevalence of HPT among patients in long term lithium therapy has been estimated to be in the range of 2.7-10 % (87, 93).. Hyperparathyroidism secondary to uraemia (sHPT) Hyperparathyroidism secondary to uraemia is due to renal failure. The uremic kidney fails to respond to PTH which results in hyperphosphataemia, hypocalcaemia and reduced levels of 1,25(OH)2D3 produced in kidney (95). Hypocalcaemia leads to increased secretion of PTH and parathyroid cellular growth (96) while decreased levels of 1,25(OH)2D3 contributes to initiate parathyroid hyperplasia (15, 16), and in the end-stage of renal disease marked hypercalcaemia may develop. Little is known about genetics and the underlying molecular mechanisms involved in sHPT. Comparable to pHPT tumours, uremic hyperparathyroid tumours have shown decreased expression of p18, p21, p27, VDR, CASR, 13.

(195) 25-hydroxyvitamin D3 24-hydroxylase, vitamin D3 25-hydroxylase and increased expression of 25-hydroxyvitamin D3 1-hydroxylase (30, 31, 97101). LOH at 11q13 (MEN1), which is frequent in pHPT (30 %) was rare in sHPT (102-105). In addition to surgery, patients with sHPT could be treated with intestinal phosphate binders and vitamin D analogues. Calcimimetics (phenylalkalyn compounds) can be used to enhance sensitivity of CASR to extracellular calcium. (106).. Wnt-signalling pathways Wnt-signalling participates in embryogenesis, stem cell biology, and human cancer. At present there are 19 Wnt genes identified encoding unique ligands (107). Wnt-signalling has been classified in two major pathways, canonical and non-canonical. Wnts induce intracellular signalling in both pathways by binding to Frizzled receptors (108-112). Six Frizzled genes have been identified so far. The non-canonical pathway can be further divided in two different signal transduction pathways. The Wnt/PCP pathway, which affects planar cell polarity through rearrangements of the cytoskeleton involving JNK and ROCK, and the Wnt/Ca2+ pathway affecting NF-AT transcription activity, through calcineurin, PKC and PLC (113, 114). Involvement of noncanonical wnt-signalling pathways has been suggested in human breast cancer (115-117). In the canonical pathway, the Wnt co-receptors LRP5/6 are also required for signal induction (118, 119). Canonical Wnt-signalling involves activation of -catenin, the key effector of this pathway, which is a ubiquitously expressed multifunctional protein. -catenin links E-cadherin to the actin cytoskeleton and thus has an important function in cell-cell adhesion. In the nucleus, -catenin functions as a transcription cofactor regulating cell proliferation and differentiation (120).. The canonical Wnt-signalling pathway: The two-state model No Wnt ligand, no activation of -catenin -catenin is rapidly turned over by ubiquitination and degradation by the proteasome pathway under unstimulated conditions. This requires phosphorylation of -catenin by a “degradation complex” consisting of APC, Axin, GSK3, and CK1, followed by binding of -Trcp (121, 122). Mutations in components of the “degradation complex” lead to constitutive accumulation of -catenin in a number of cancers. APC mutations are 14.

(196) common in colorectal cancers (123). Axin1 mutations have been reported in hepatocellular carcinomas (124) while -Trcp mutations have been reported in prostate cancers (125). Activation by Wnt ligands Binding of certain Wnt ligands to Frizzled receptors and LRP5/6 coreceptors promotes specific phosphorylation of LRP5/6 and binding of Axin (126, 127). This results in blocking of GSK3 kinase activity and subsequent stabilisation of -catenin. Stabilised nonphosporylated (active) -catenin then enters the nucleus and binds to TCF/LEF DNA-binding transcription factors (128) at target genes to positively or negatively regulate transcription (Fig. 1). Currently more than 90 target genes have been identified (http://www.stanford.edu/~rnusse/wntwindow.html), including c-myc, cyclin D1, E-cadherin, TCF-1, Ret, LEF1, E-Trcp, c-Jun, Frat1, and retinoic acid receptor gamma. The c-myc protein plays a critical role in cell cycle progression, metabolism, inhibition of terminal differentiation, and in apoptosis. Elevated c-myc expression has been detected in benign lesions and a number of cancers, including among others melanoma, breast-, colon-, and cervical cancer (129, 130). A recent report points out c-myc as the exclusive and critical mediator of tumourigenetic effects of APC loss (131). Overexpression of c-myc can be related to an increased mRNA level, caused by stabilisation of c-myc RNA transcripts, c-myc gene amplification (129, 130) or E-catenin (132) overexpression. Augmented c-myc protein level could also be due to enhanced initiation of translation (133) or stabilisation of the protein through mutation at Thr-58, a mutational hot spot in lymphomas (134, 135). Lithium, which is known to activate the canonical Wnt-signalling pathway by stabilising E-catenin through inhibition of GSK-3, decreaed phosphorylation of c-myc Thr-58 (136).. 15.

(197) Figure 1. The canonical Wnt-signalling pathway; the two-state model. See text for description and references.. -catenin (CTNNB1) The ubiquitously expressed multi-functional protein and proto-oncogene E-catenin fulfils important functions in cell-cell adhesion by linking Ecadherin to the actin cytoskeleton, and in the canonical Wnt-signalling pathway by regulating cell proliferation and differentiation (137-139). E-catenin also plays an important role in interactions between cadherins and transmembrane proteins, such as the epidermal growth factor receptor (140). In the absence of growth or differentiation signals free cytoplasmic E-catenin is rapidly turned over, initiated by phosphorylation of its amino terminus (Ser-33, Ser-37, Thr-41, Ser-45). A multiprotein complex consisting of GSK-3E/APC/Axin and other components regulates this phosphorylation and promotes subsequent binding of E-Trcp, ubiquitination and degradation of E-catenin by the proteasome pathway (121, 122). In melanoma cells, mutations of the -catenin phosphorylation sites in exon 3 (Ser-33, Ser-37, Thr-41, Ser-45) resulted in stabilisation of the protein, cytoplasmic/nuclear accumulation and activation of transcription (141). Aberrant activation of the Wnt-signalling pathway, by stabilising E-catenin mutations in exon 3 was first described in sporadic colorectal cancers (142, 143) and melanomas (141) at a frequency of 6-10%. However the occurrence of -catenin mutation was lower in subsequent studies (144-147). 16.

(198) A recent study of 112 sporadic colorectal tumours failed to detect any mutations in -catenin (145), indicating a stochastic distribution of probability in analysed material. In addition, inappropriate activation of the Wnt pathway resulting from E-catenin mutations or E-catenin accumulation by other unknown mechanisms has recently been implicated in the development of breast cancer tumours (148), solid-pseudopapillary tumours of the pancreas (149, 150), human colonic aberrant crypt foci (151), hepatocellular carcinomas (152-154), oesophageal (155), gastric (156, 157), prostate (125, 158), gastrointestinal carcinoid tumors (159), cancer of ampulla of Vater (160), gallbladder carcinoma (161), and colon cancers (162-164). Interestingly, -catenin can also be modified by acetylation at residue Lys-49 by the CBP acetyltransferase. Lys-49 is frequently mutated in thyroid anaplastic carcinoma and mutation of this site has been shown to increase the ability of -catenin to augment c-myc gene transcription specifically (165). Cyclin D1, overexpressed in several types of cancer, has been identified as a target gene for the -catenin transactivation pathway. Presence of a functional TCF/LEF-binding site in the promoter region and a significant correlation of -catenin activity to cyclin D1 overexpression has been demonstrated in breast cancer, identifying cyclin D1 as a target gene for -catenin (166, 167). In addition, a dominant negative TCF factor expressed in colon cancer cells inhibited cyclin D1 expression but had no effect on cyclin D2, cyclin E, cdk2, cdk4 or cdk6 (168). Correlation between aberrant -catenin nuclear accumulation and cyclin D1 overexpression has been observed also in sporadic desmoid tumours (169-171). In a mouse model lacking APC, cyclin D1 showed not to be an immediate target which suggested that the delayed upregulation of cyclin D1 is rather a secondary event (172). Screening of a small molecule library in a cell-based system has identified hexachlorophene as a -catenin inhibitor, which enhances -catenin degradation through activation of Siah-1 (173). NSAIDS (non-steroidal anti-inflammatory drugs) have been shown to decrease -catenin nuclear levels and reduce multiple polyps formation in FAP patients (174).. LRP5 LRP5 was first cloned as an apolipoprotein E binding receptor in hepatocytes and adrenal cortex (175-177). The gene is highly conserved among different species (178) and is designated “arrow” in invertebrates (179). LRP5 was later associated to type 1 diabetes (180-182), and being essential in cholesterol metabolism and glucose-induced insulin secretion (183, 184). LRP5 was shortly thereafter identified as an essential component in Wntsignalling (119, 179). LRP5 functions as a coreceptor and binds Wnt ligands together with Frizzled receptors, with subsequent activation of the -catenin dependent Wnt17.

(199) signalling pathway (185, 186). Phosphorylation of LRP5/6 by CK1 gamma and GSK-3 transduce activating signals (187), while CK1 epsilon phosphorylation has an inhibitory effect (188). Receptor phosphorylation leads to Axin binding and subsequent stabilisation of -catenin (189). LRP5 activity is inhibited by DKK1 through binding to kremen (190). Frat1 activates signalling through interaction with LRP5 (191), while binding of SOST (192), sclerostin (193) and Mesd (194) to LRP5, inhibits Wnt dependent activation. Axin and axin/arrow-binding protein DCAP play a major role in glucose-glycogen metabolism (195). LRP5 was shown to be involved in bone accrual and eye development (196-202). Polymorphisms in the LRP5 gene are associated with different bone characteristics (203-219), obesity phenotypes (220), hypercholesterolemia (221), spinal osteoarthritis (222) and circulating follicle stimulating hormone (223), but not vitamin D levels (224). Several sequence variants (225), haplotype structure and uneven recombination (226) in the LRP5 gene, and theoretical splice variants of LRP5 mRNA (227) have been reported. Autosomal dominant high-bone-mass trait, and other diseases with increased bone density, including endosteal hyperostosis, Van Buchem disease, autosomal dominant osteosclerosis, craniosynostosis, and osteopetrosis type I, have been shown to be caused by mutations in LRP5 (228-234). The common G171V mutation has been reported to disrupt the interaction with Mesd (235), SOST (236) and sclerostin (237), thereby reducing their inhibitory effects. These mutations even reduce affinity of LRP5 to and its inhibition by DKK1 (238). LRP5 -propeller 1 is important for DKK1 binding to LRP5 (234, 239). Other mutations are associated with primary osteoporosis (240, 241) and oropharyngeal skeletal disease (242), while mutations could not be shown in idiopathic osteoporosis (243). Haplotypes of LRP5 were found to be associated with osteoarthritis (244). Osteoporosis-pseudoglioma syndrome (245-248), autosomal dominant osteopetrosis type I (249), and familial exudative vitreoretinopathy (248, 250253) have been shown to be associated with mutations in LRP5. Increased expression of LRP5 have been reported in calcification of aortic valves (254) and in degenerative valve disease (255). Involvement of LRP5 has been suggested in B-cell neoplasia (256), and to be a novel marker for high-grade osteosarcoma (257). Blocking LRP5 receptor activity in osteosarcoma Saos-2 cells, modulated epithelial to mesenchymal transition and reduced metalloproteinase expression (258). LRP5 was shown to be overexpressed in pancreatic endocrine neoplasms (259) and ulcerative colitis-associated colorectal cancer (260). LRP5 was shown to be necessary for Wnt1-induced mammary tumourigenesis (261). PTH treatment of rat osteoblastic osteosarcoma cells (UMR 106) has resulted in decreased expression of LRP5 and DKK1 (262), while 18.

(200) 1,25(173)2D3 was reported to be a positive regulator of LRP5 in mice (263266).. 19.

(201) Aims of the study. The specific aims of the study were: x to analyse Wnt/-catenin signalling status in parathyroid tumours x to establish a parathyroid tumour cell line x to determine the role of an internally deleted Wnt coreceptor LRP5. 20.

(202) Materials and Methods. Summary of materials and methods. Tissue specimens (Paper I - IV) Parathyroid adenomas (n=184) and hyperplastic parathyroid glands (n=20) from patients with pHPT and sHPT respectively, were acquired from patients diagnosed and operated on in the clinical routine at the Department of Surgery, Uppsala University Hospital. Informed consent and approval of ethical committee were achieved. Each patient contributed with one tumour. Normal parathyroid tissue (n=8) was obtained from glands inadvertently removed in conjunction with thyroid surgery where auto-transplantation was not required, or as normal parathyroid gland biopsies in patients subjected to parathyroidectomy. All tissues were intraoperatively snap frozen and cryosections were used in the analyses.. Immunohistochemistry (Paper I & II) Aceton fixed cryosections (6 μm) were blocked with 0,3 % H2O2 in PBS to inhibit endogenous peroxidase activity. Sections were then blocked with avidin-biotin blocking kit (Vector Laboratories, Inc., Burlingame, CA) and normal horse or goat serum. Immunostaining was performed using an antiE-catenin goat polyclonal antibody (Santa Cruz Biotechnology INC., Santa Cruz, USA, # sc-1496). Control sections included use of primary antiserum preincubated with an excess of immunising peptide (Santa Cruz, # sc1496P). Specimens were also stained with a mouse monoclonal antiE-catenin antibody (m1; Santa Cruz, # sc-7963) and some specimens with an anti-active-E-catenin (Upstate, Lake Placid, USA, # 05-665) mouse monoclonal antibody (267) and a mouse anti-E-catenin antibody (m2; BD Biosciences, Palo Alto, California, USA, # 610153). A rabbit polyclonal c-myc 21.

(203) antibody (Santa Cruz, # sc-789) was used and control sections included use of primary antiserum preincubated with an excess of immunising peptide (Santa Cruz, # sc-789P). Sections were scored by their weak, medium or strong staining intensity. Two independent investigators made evaluations. Paraffin-embedded specimens were deparaffinised and subjected to antigen retrieval in 10 mM sodium citrate (pH 6.0) for 15 minutes in a microwave oven and thereafter stained for E-catenin, c-myc or PCNA (Santa Cruz, # sc-56) as above.. Western blotting (Paper I - IV) Protein extracts for Western blotting were prepared from 6-20 consecutive 6 μm thick frozen tissue sections and from cultured cells in Cytobuster Protein Extract Reagent (Novagen Inc., Madison, Wisconsin, USA) or in a cytosolic protein extract (268) and both supplemented with Complete protease inhibitor cocktail (Roche Diagnostics GmbH, Penzberg, Germany). The anti-active (non-phosphorylated) E-catenin (267) mouse monoclonal antibody (Upstate, Lake Placid, USA, # 05-665), the anti-APC mouse monoclonal antibody with the epitope mapping to the N-terminus of APC (Santa Cruz Biotechnology INC., # sc-9998), anti-LRP5 goat polyclonal antibody (Santa Cruz Biotechnology INC., # sc-21390), anti-V5-HRP antibody (Invitrogen Corporation), and anti-actin goat polyclonal antibody or anti-tubulin rabbit polyclonal antibody (Santa Cruz Biotechnology INC.) were used. After incubation with the appropriate secondary antibodies, bands were visualised using the enhanced chemiluminescence system (GE Healthcare Europe GmbH, Uppsala, Sweden).. RNA isolation and cDNA synthesis (Paper I - IV) Total RNA was extracted with TriZol Reagent (Gibco BRL, Life Technologies Inc., Gaithersburg, USA) according to the manufacturer’s instructions and the RNA was subsequently treated with RQ1 DNase I (Promega Corp., Madison, USA) and proteinase K. Alternatively, DNA-free RNA was prepared using the Nucleospin RNA II kit (Macherey-Nagel GmbH & Co. KG, Düren, Germany). Successful DNase-treatments were established by PCR analysis of all RNA preparations.. 22.

(204) Reverse transcription of purified RNA was performed with random hexamer primers using the First-Strand cDNA Synthesis kit (GE Healthcare Europe GmbH, Uppsala, Sweden) according to the manufacturer’s instructions. Normal tissue cDNA or RNA were purchased from BD Biosciences Clontech, Palo Alto, California, USA and Ambion Inc., Austin, Texas, USA.. PCR (Paper I, II & IV) DNA was prepared by standard procedures including proteinase K treatment and phenol extraction. The PCR primers used are listed in Table 1. Table 1. Sequence LRP5, forward LRP5, nested forward LRP5, reverse -catenin exon 3, forward -catenin exon 3, nested forward -catenin exon 3, reverse MYC promoter, forward MYC promoter, reverse. CTT CAC CAG CAG AGC CGC CAT CCA CAG GGA TCT CCC TCG AGA CCA ATA ACA ACG CCG GGA TCA TCC GAC TGA TG TGA TGG AGT TGG ACA TGG CC GGA ACC AGA CAG AAA AGC GG CTC ATA CAG GAC TTG GGA GG. ACG TGG CAA TGC GTT GCT GGG ACA CAG AGA ACG CAC TGC GCG. RT-PCR (Paper I, III & IV) cDNA was prepared as described above. mRNA-specific PCR primers and labeled probe (5'FAM-sequence-3'TAMRA) are listed in Table 2. Primers for WNT1 were as described before (269). For 28S rRNA, the Ribosomal RNA Control Reagents (VIC probe) was used (Applied Biosystems, Foster City, California, USA). PCR reactions were performed on ABI PRISM® 7700 Sequence Detection System (Applied Biosystems, Foster City, California, USA) or MyiQ Single-Color Real-Time PCR Detection System (Bio-Rad Laboratories, Inc., Hercules, California, USA), using the TaqMan PCR core Reagent Kit (Applied Biosystems, Foster City, California, USA). Each cDNA sample was analysed in triplicate. Standard curves for the expressed genes were estab23.

(205) lished by amplifying a purified PCR fragment covering the sites for probes and primers. Table 2. Sequence -catenin, forward -catenin, reverse -catenin, probe c-myc, forward c-myc, reverse c-myc, probe GAPDH, forward GAPDH, reverse GAPDH, probe cyclin D1, forward cyclin D1, reverse cyclin D1, probe LRP5wt, forward LRP5wt, reverse LRP5wt, probe LRP5tot, forward LRP5tot, reverse LRP5tot, probe Wnt3, forward Wnt3, reverse. AGC CTG TTC CCC TGA GGG TAT TTG GAC TTG GGA GGT ATC CAC ATC CTC TGG CTA CTC AAG CTG ATT TGA TGG AAG ACT CCA GCG CCT TCT CTC CGT TGG GCT GTG AGG AGG TTT GCT GTG AGC GAC TCT GAG GAG GAA CAA GAA GAA GGT GAA GGT CGG AGT C GAA GAT GGT GAT GGG ATT TC CAA GCT TCC CGT TCT CAG CC TTC CTC TCC AAA ATG CCA GAG GCG GAG CAC TCT GGA GAG GAA GCG TGT GAG GCG GCC ACA GAT GTG AAG TTC ATT TCC CCT GAA GAC CAT CAG CCG CG CCC GCT CCT GAC CCA GCA TG TCC CAC CAA GGG CTA CAT CTA CTG ATC GAC TGT ATC CCC GGG GC CAC CAC GCG CTG GCA CAC AA CGG ACT GTG ACG CCA TCT GCC TGC GGC TGT GAC TCG CAT CAT AA CAG CAG GTC TTC ACC TCA CA. DNA sequencing (Paper I - III) DNA from tissue specimens were prepared by standard procedures including proteinase K treatment and phenol extraction. Blood DNA was prepared using the Wizard Genomic DNA Purification Kit (Promega Corp.). DNA was amplified by nested PCR with primers for exon 3 of -catenin (Table 1). (Paper IV) For LRP5, cDNA was amplified by primary or nested PCR using mRNAspecific primers spanning positions 1992-2932 of LRP5 (Table 1). Two LRP5wt and six randomly chosen truncated LRP5 cDNA fragments from parathyroid tumours, as well as from sHPT-1 cells, were cloned into pCRIITOPO (Invitrogen Corporation). Both strands of PCR fragments were se-. 24.

(206) quenced on ABI 373A using the ABI Prism Dye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems).. Restriction enzyme digestion (Paper II) CTNNB1 exon 3 PCR fragments were purified using the GFX PCR DNA and Gel Band Purification Kit (GE Healthcare Europe GmbH, Uppsala, Sweden) and cleaved with Xma I or Nla III according to instructions by the manufacturer (New England Biolabs, Inc.,Beverly, MA). Products were analysed by agarose gel electrophoresis.. CTNNB1 copy number analysis (Paper II) Tumour and blood DNA were marked with fluorescence dye and hybridised to the GeneChip® Human Mapping 500K Array Set according to the manufacturers instructions, and analysed by GeneChip® Genotyping Analysis Software (GTYPE) using Chromosome Copy Number Analysis Tool (CNAT, Affymetrix, Inc. Santa Clara, California, USA).. Immunofluorescence (Paper III) Fluorescent immunostaining was done on sHPT-1 cells grown on glass cover slips. Cells were fixed in 4 % paraformaldehyde for 10 minutes and thereafter incubated in ice-cold 70% ethanol for 20 minutes. After three washes in PBS, the cells were incubated with an antibody specific for PTH (Santa Cruz Biotechnology INC., # sc-9678), and thereafter with FITC-labeled secondary antibody. The cover slips were mounted in Vectashield mounting medium for fluorescence with DAPI (Vector Laboratories, Inc., Burlingame, CA, USA), and examined in a fluorescence microscope (Leica DMRB, Leica Mikroskopie und Systeme GmbH, Wetzlar, Germany).. 25.

(207) Transfection of siRNA (Paper III & IV) sHPT-1 parathyroid tumour cells were transfected in at least triplicates at 2x105 cells/35 mm dish with jetSI-ENDO according to the manufacturer’s recommendations (Poly-Plus-Transfection SAS, Illkirch, France). Control non-silencing siRNA (Qiagen Operon, Cologne, Germany) and si-catenin (SMARTpool CTNNB1, Dharmacon, Inc., Lafayette, Colorado, USA) were used. siRNAs used in paper IV are listed in Table 3. Transfection efficiency was determined by transfection of fluorescent (Alexa Fluor 555) labelled siRNA (Qiagen Operon). Virtually all cells showed fluorescence as visualised by a fluorescence microscope (Leica DMRB, Leica Mikroskopie und Systeme GmbH, Wetzlar, Germany). HeLa cells were transfected in the same manner, with a transfection efficiency of approximately 90 %. Table 3. Sequence siLRP5666-809 siLRP5wt siLRP5tot, stealth control siLRP5tot, stealth. TAACAACGACCUCACCAUUdTdT AAUGGUGAGGUCGUUGUUAdTdT CAACCACAUCUACUGGACAdTdT UUCCAGUAGAUGUGGUUGdTdT CCUGCAUGGACUGAGGAACGUCAAA UUUGACGUUCCUCAGUCCAUGCAGG CCUGGUAGUCAAGGAUGCACCGAAA UUUCGGUGCAUCCUUGACUACCAGG. Conditioned medium (Paper IV) Conditioned medium was produced in HEK293T cells transiently transfected for 24 hours with pCIN4/Wnt1 (kind gift of Dr. R. Kemler), pLNC Wnt3HA (kind gift of Dr. J. Kitajewski), PON-Wnt-3a (kind gift of Dr. B. Williams) or pCS2/Dkk1 (kind gift of Dr. S.Y. Sokol) using Fugene 6 (Roche Diagnostics GmbH, Mannheim, Germany).. 26.

(208) Plasmid construction and transient transfection (Paper IV) Expression plasmid LRP5666-809 was constructed by replacing the Xho I/Kpn I fragment of pcDNA3.1/LRP5 and pcDNA3.1/V5-His/LRP5 (expressing tagged LRP5) with an Xho I/Kpn I digested PCR fragment harbouring the deletion 666-809. Cells were transfected using either jetPEI (PolyPlus-Transfection SAS, Illkirch, France) or Fugene 6 (Roche Diagnostics GmbH, Mannheim, Germany), according to the manufacturers recommendations.. Immunoprecipitation (Paper IV) For immunoprecipitations, cultured cells or 10 consecutive 6 μm thick frozen tumour tissue sections were resuspended in 300 μl buffer (50 mM Tris pH 8.0, 150 mM Nacl, 0.5 % NP-40, 50 mM NaF, 1mM EDTA, supplemented with Complete protease inhibitor cocktail), kept on ice for 20 minutes, and centrifuged for 20 seconds at 14000 rpm. After addition of 20 μl anti-LRP5 goat polyclonal antibody (Santa Cruz Biotechnology INC., # sc21390) the lysate was incubated overnight at 4º with gentle agitation. 50 μl of Protein G PLUS-Agarose (sc-2002, Santa Cruz Biotechnology) was then added to the lysate and further incubated for 6 hours. After five washes and centrifugation, the sample was boiled in 40 μl of Laemmli sample buffer for 10 minutes and 10-20 μl was subjected to Western blotting analysis.. Luciferase reporter assay (Paper III & IV) sHPT-1 cells were transfected in triplicates with the FOPFLASH or TOPFLASH TCF (132) luciferase reporter plasmids (Upstate, Lake Placid, USA) along with a CMV-lacZ (E-galactosidase) internal transfection control plasmid (270) using jetPEI (Poly-Plus-Transfection SAS). Cells were harvested 24 hours after transfection. Luminometric determination of luciferase activity (Promega Corp., Madison, USA) and E-galactosidase activity (BD Biosciences Clontech, Palo Alto, California, USA), were performed on a Lumat LB9507 (EG&G Berthold, Bad Wildbad, Germany), as described by the manufacturers. In some experiments, TOPFLASH was transfected and transfection of siRNA to the same culture was done after 24 hours. Cells were harvested 96 hours later. 27.

(209) Cell growth determination and flow cytometry (Paper III & IV) Cells (2x105) were distributed onto 35-mm dishes in DMEM/10 % foetal bovine serum and subsequently harvested at the indicated time points. The number of viable cells was determined by using the NucleoCounter (ChemoMetec A/S, Allerod, Denmark). Cells were collected at 84 hours after siRNA transfection and incubated with FITC-labeled annexin V to assess phosphatidylserine externalisation as a marker for apoptosis. Propidium iodide was added to distinguish tumour cells that had lost membrane integrity. Cells were analysed by flow cytometry on a Becton Dickinson FACS Calibur flow cytometer (BD Biosciences, San Jose, California, USA).. Chromatin immunoprecipitation (Paper IV) Chromatin immunoprecipitation of transfected cells was performed using a protocol from Upstate, but with immunoprecipitation conditions as described (271).The anti-active-E-catenin mouse monoclonal antibody (267)was used (Upstate, Lake Placid, USA, # 05-665) and MYC promoter DNA, containing TCF-4 binding site 2 (132) was PCR amplified in the linear range by primers listed in Table 1.. Mouse xenograft model (Paper IV) Two to three week old female Fox Chase severe combined immunodeficient mice (SCID) were used (Taconic, Denmark). The mice were anesthetized with isoflurane (Forene; Abbott, Abbott Park, IL, USA) during the manipulations. One flank or both flanks of each animal were injected subcutaneously (total 200 l) with sHPT-1 cells together (1:1) with BD Matrigel Matrix (BD Biosciences Clontech, Palo Alto, California, USA), after transfection of 106 cells for 24 hours. The animals were monitored every day and sacrificed after 8-9 weeks. The animal experiments were approved by the Uppsala University board of animal experimentation and were performed according to the United Kingdom Coordinating Committee on Cancer Research guidelines for the welfare of animals in experimental neoplasia (272).. 28.

(210) Statistical analysis (Paper I - IV) Unpaired t test was used for all statistical analyses. All data were calculated with Statistica 6 (StatSoft, Tulsa, OK, USA). Values are presented as arithmetrical mean ± SEM. A p value of < 0.05 was considered significant.. 29.

(211) Results and discussion. Paper I Accumulation of nonphosphorylated -catenin and c-myc in primary and uremic secondary hyperparathyroid tumours We have performed immunohistochemistry (IHC) on six normal parathyroid glands and 47 (37+10) parathyroid tumours. While normal parathyroid tissues displayed weak but distinct membranous -catenin staining, all tumours showed medium or high expression of -catenin, which was predominantly cytoplasmic/nuclear. These results were verified by using two previously utilised (273, 274) antibodies, both mouse monoclonals, but directed to different epitops of the -catenin protein. Repeated IHC and Western blotting (WB) analysis using a fourth antibody, specific to nonphosphorylated -catenin (267) showed that the nonphosphorylated active form of -catenin was accumulated. These results strongly suggest that activation of the Wnt-signalling pathway, by accumulation of -catenin, is a major aberration in HPT tumours. We have determined expression level of tumour -catenin mRNA and could not find any significant difference when comparing with normal parathyroid tissues, suggesting that overexpression of the protein was not due to increased transcription, mRNA stability or gene amplification. Direct sequencing of CTNNB1 exon 3 (mutation hot spot) revealed a stabilising mutation (Ser37Ala) in 15 % (3/20) of pHPT tumours, which appeared to be homozygous (see also paper II). This mutation has been found in many different tumour types. The mutant protein is resistant to phosphorylation by GSK-3 at Ser-37 and thus resistant to subsequent ubiquitination and proteasomal degradation. This results in increased half-life with accumulation of the mutant protein and sustained transcriptional activity. APC mutations are common in colorectal cancers (~ 80 %). Most mutations result in loss or truncation of the protein (275). A wide variety of different sizes (30-140 kD) of the truncated APC protein have been reported (276). We have examined the status of APC by WB analysis and found no evidence of truncated proteins. c-myc is a known proto-oncogene and a -catenin target gene. Quantitative RT-PCR and IHC showed that c-myc was overexpressed in a large fraction of the analysed parathyroid tumours. Immunostainings of c-myc and 30.

(212) PCNA, a proliferation marker, overlapped in some parts, and it seems likely that c-myc overexpression contributes to enlargement and hyperactivation of the parathyroid glands. Even though the exact mechanism(s) underlying -catenin protein accumulation in most parathyroid tumours remained unclear, the results presented indicate an important role for Wnt/-catenin signalling in parathyroid tumourigenesis, and suggest that -catenin may be a novel therapeutic target for HPT.. Paper II Stabilising mutations of CTNNB1/-catenin in parathyroid adenomas of Swedish patients To determine the mutation frequency of -catenin exon 3 in a larger number of tumours, DNA from 104 parathyroid adenomas were PCR amplified and directly sequenced. The same missense mutation as described before (paper I), Ser37Ala, was found in 6 out of the 104 tumours (5.8 %). Taken the previous result into account, a total of 9 out of 124 (7.3 %) tumours displayed the -catenin stabilising mutation Ser37Ala. Constitutional DNA (blood) was available from 4 patients, and all displayed wild type Ser37. Aberrant accumulation of -catenin was confirmed by IHC in all of the analysed tumours. No obvious differences between expression levels of catenin protein in tumours harbouring S37A mutation compared to those expressing wild type -catenin could be detected by this method. However, WB analysis revealed a slightly higher expression level of -catenin protein in tumours harbouring Ser37Ala mutation compared to those expressing wild type -catenin. No particular clinical characteristics, including age, sex, serum calcium level, serum PTH level or gland weight related to presence of the S37A mutation. All 9 mutations appeared to be homozygous by DNA sequencing and analytical restriction enzyme digestions. PCR amplified fragments were used for the analyses and PCR reactions could in theory favour the mutant allele(s). Unbiased PCR reactions were, however, confirmed by performing PCR amplification in a 1:1 mixture of constitutional DNA and Ser37Ala mutant tumour DNA, and by subsequent analytical restriction enzyme digestions. In order to resolve the issue of zygocity for the mutation, the -catenin gene copy number was determined for 4 tumour DNAs with the corresponding constitutional DNAs by hybridisation to the GeneChip Human Mapping 500K Array, and subsequent gene copy number analysis based on comparison of informative single nucleotide polymorphisms in and around the catenin gene. Both -catenin alleles were present in all 8 samples. Thus, taking also the DNA sequencing results into account the Ser37Ala mutation 31.

(213) was homozygous in the 4 tumours, rather than hemizygous with one mutant and one deleted -catenin allele. In contrast to our results, -catenin exon 3 mutations were not reported in parathyroid tumours in a small study of Japanese patients (n=24), or in a study of 97 American patients (277). Large variations of -catenin mutation frequency (1 %-60 %) have been reported also in colorectal cancers (141147), and may be attributed to stochastic distribution of probability or other unknown causes. The results further emphasise an important role for dysregulated Wntsignalling, by aberrant accumulation of -catenin, in parathyroid tumour formation.. Paper III Activated -catenin in the novel human parathyroid tumour cell line sHPT-1 Here we reported establishment of the first human parathyroid cell line (sHPT-1). Parathyroid tumour cells were prepared from a hyperplasic gland removed at operation of a patient with sHPT. Cells were counted and suspended in growth medium (DMEM containing 10 % FCS, glutamine, streptomycin, and penicillin) at a concentration of less than one cell/100 μl. Cell suspensions of 100 μl were cultured in 96-well microplates for 45 days, with occasional medium exchange. After 45 days, six colonies were observed and removed for further cultivation in 35 mm plates. One out of the six colonies proliferated and survived after cultivation in growth medium supplemented with 10 mM lithium chloride. After four passages, lithium chloride was withdrawn and was not used further. The cells grew with a doubling time of approximately 72 hours. The sHPT-1 cells showed expression of PTH protein and mRNA, the hallmark of parathyroid cells. -catenin was not stabilised by mutation, but the presence of nonphosphorylated active -catenin was demonstrated by WB analysis and by a catenin transcription assay (a FOPFLASH/TOPFLASH luciferase activity ratio of 6). The promoter of the luciferase reporter TOPFLASH contains four TCF/ -catenin binding sites and FOPFLASH mutated sites (132). We could achieve a very high siRNA transfection efficiency (~ 100 %), as determined by tranfection and visualisation of a fluorescence tagged siRNA. Downregulation of -catenin expression by transfected siRNA was confirmed both at the mRNA and protein level, and resulted in reduced expression of the -catenin target genes cyclin D1 and c-myc, inhibition of cellular growth, and induction of cell death. -catenin seemed to be necessary for growth and survival of sHPT-1 cells. 32.

(214) Lack of a parathyroid cell line has been a major limitation for in vitro experiments in this field. The sHPT-1 cell line can be a useful tool for development of screening and therapeutical strategies. Altogether, these results support -catenin as a possible therapeutic target in HPT.. Paper IV An LRP5 receptor with internal deletion in hyperparathyroid tumours with implications for deregulated Wnt/-catenin signalling LRP5, a cell surface receptor, is essential for canonical Wnt-signal transduction. Here we analysed expression of LRP5 in 37 pHPT and 20 sHPT tumours, and an internally deleted LRP5 receptor (LRP5) was discovered to be expressed in 86 % of the pHPT tumours and in all sHPT tumours. Six normal parathyroid glands and a panel of 17 different normal tissues expressed only the wild type LRP5 mRNA. We confirmed expression of a shorter LRP5 protein by WB analysis. Stabilising mutation of -catenin and expression of LRP5 was mutually exclusive. Sequencing of exon/intron junctions and splicing branch points revealed no abnormalities, and no deletion was detected by Southern blot analysis of genomic DNA. The deletion in LRP5 was flanked by imperfect direct repeat sequences with putative cryptic donor and acceptor splice sites which most likely have been employed in an aberrant splicing event. Transfection of two different siRNAs against LRP5 to sHPT-1 cells resulted in a decreased nonphosphorylated active -catenin level, -catenin transcription activity and cell growth. siRNA against wild type LRP5 showed no significant effects. siRNA against LRP5 induced cell death of sHPT-1 parathyroid cells, but not of HeLa cells. Effect of LRP5 on -catenin target gene c-myc expression was investigated. Transient expression of LRP5 in HEK293T cells increased binding of -catenin to the c-myc promoter and c-myc expression, while siRNA against LRP5 resulted in significant decrease of c-myc expression in sHPT1 cells. Furthermore, we found that the Wnt3 ligand but not Wnt1 was expressed in parathyroid tumour cells. Wnt3 conditioned growth medium strongly activated TOPFLASH transcription in the presence of LRP5, both in cotransfected sHPT-1 and HEK293T cells. Previous studies have shown importance of several amino acid residues, located in the deleted part of LRP5, for inhibition by the canonical Wntsignalling antagonist DKK1 (234). Indeed, we found that wild type LRP5 but not LRP5-induced transcription was inhibited by DKK1. In a xenograft SCID mouse model, siRNAs against LRP5 inhibited tumour growth in concordance with the in vitro results. 33.

(215) Our results implicate a fundamental role of LRP5 in activating Wnt/ -catenin signalling in parathyroid tumour cells. The internally deleted LRP5 receptor could be an attractive target for the development of anti-tumour drugs.. 34.

(216) Concluding remarks. Our finding of E-catenin protein overexpression in all analysed parathyroid adenomas and secondary hyperplastic glands strongly suggests activation of the Wnt-signalling pathway as a major aberration common to these tumours (paper I & II). The cyclin D1 oncogene, a E-catenin/TCF/LEF target gene in other cell types (166, 167), has been shown previously to be overexpressed at the protein level in 20 %-60 % of parathyroid tumours from pHPT and sHPT patients (46-48), by unknown mechanisms. Aberrant E-catenin overexpression could explain an augmented cyclin D1 expression level in some adenomas. Involvement of c-myc has been described in many cancers. An apparent overexpression of the c-myc protein was observed in 79 % of the parathyroid tumours (paper I). For the majority of tumours, this can be related to an increased mRNA level, possibly caused by the E-catenin overexpression. We could not find any c-myc stabilising mutation (Unpublished results) in the hot spot mutation site (134, 135). For tumours with a c-myc mRNA expression within the normal range, augmented protein level could be due also to enhanced initiation of translation (133). Lithium, an activator of the canonical Wnt-signalling pathway, stabilises c-myc by decreasing the phosphorylation rate (136). Therefore, it is tempting to speculate that expression of c-myc may not only be regulated by the Wnt pathway at the transcription level through E-catenin (132), but also at the protein level by decreased turn-over rate (278, 279). Intriguingly, long-term lithium therapy used for treatment of bipolar affective disorders is associated with development of mild HPT in approximately 6 % of patients. Both in vitro and in vivo lithium treatment results in increased secretion of PTH for the same calcium concentration (87, 90, 91, 280). We suggest that lithium therapy in these patients may activate the canonical Wnt-signalling pathway in the parathyroid cells resulting in an increased set point and a higher PTH release, by an unknown mechanism. Only 9 out of 124 parathyroid tumours displayed E-catenin stabilising mutation, explaining the observed aberrant accumulation of E-catenin (paper I & II). Thus, we expanded our investigation to other components of the Wnt-signalling pathway (paper I & IV). Only full-length APC protein could be detected (paper I). An internally deleted LRP5 receptor was found to be expressed in a large fraction of parathyroid adenomas and all analysed secondary hyperplasic 35.

(217) parathyroid glands (paper IV). The short LRP5 receptor was required for accumulation of E-catenin as demonstrated in the established human parathyroid tumour cell line sHPT-1 (paper III & IV). The internally deleted LRP5 receptor appears as a potential therapeutic target in treatment of parathyroid tumours.. 36.

(218) Acknowledgements. This thesis work was carried out at the department of Surgical Sciences, Uppsala University. This work was in part founded by Swedish Cancer Society, The Swedish Research Council and Lions Fund for Cancer Research. Even though, words cannot express the deep gratitude that I am feeling towards my supervisors, professors Gunnar Westin and Göran Åkerström, I would like to try. Thank you for everything you have done for me (it would take pages to mention it all). I could have never wished for more expertise, dedication, commitment, support and encouragement than what I received from you. I will always feel honoured to call myself a former student of yours and I hope someday I can prove myself worthy of your efforts. I would also like to take this opportunity and thank: Mrs. Birgitta Bondeson and Mr. Peter Lillhager for excellent technical inputs. Ms. Iva Kulhanek for gathering patient journals. Dr. Per Hellman, Dr. Mohammad Alimohammadi, Dr. Daniel Lindberg, Ms. Jessica Svedlund, Ms. Tijana Krajisnik, Dr. Tobias Larsson, Dr. Kenko Cupisti and Dr. Ulrika Segersten; for being good friends, discussion partners and co-writers. Mohammad and Daniel, thank you for proof reading this script. Professor Olle Kämpe and Ms. Åsa Hallgren for a productive and rewarding collaboration. Present and former members of the endocrine surgery group, especially Dr. Ola Hessman, Dr. Tobias Carling, Dr. Peter Stålberg, Dr. Pamela Buchwald, Ms. Johanna Sandgren, Ms. Katarina Edfeldt, Ms. Sana Asif and all others, for contributing to make this group what it is today; the best of its kind. Professor Ulf Pettersson, vice chancellor, Professor Kjell Öberg, dean of the Medical Faculty, Professor Lars Wiklund, head of Department of Surgical Sciences and Professor Britt Skogseid, for showing interest in my work, for your support and for sharing your visions. I’m especially grateful to Professor Pettersson for his invaluable advices on enhancement of my very first manuscript, Professor Öberg for his sponsorship of my AACR abstracts since the start of this project, professor Wiklund for being chair of the disser37.

(219) tation and Professor Skogseid for her valuable advices while being the chair of my midtime control. Drs. Annica Jacobson, Jan Saras, Thomas Lind, Janet Cunningham, Apostolos Tsolakis, Cécile Martijn and Margareta Halin-Lejonklou for discussions, advises, ideas and gossips. My friends at MDR and DN, Stefan Kunkel, Mehdi Motallebipour, Elin Blom, Térèse Johansson, Ole Forsberg, Johan Olerud, Mattias Wiggberg and Per Löwdin. I admire your commitment, being involved in others problems helped me to appreciate my own situation even more. Finally, I would like to thank my family: My mum, Sara, for your love, for believing in me, supporting me, comforting me, and bringing me back to earth whenever it was necessary. HH Alavia (my own madar joon) for your love and support from the very first beginning and till today. My brother and sisters and their families; Lale, Safa, Jasmine, Mehrdad, Sara, Adrian and Arvid, for your love and support. Jas: thank you for revising parts of this script. David, the apple of my eye, for always bringing joys to my life. Martina for making me feel loved and special, thank you for your patience and support, basselved my precious.. I love you all.. Thank You. 38.

(220) References. 1. 2. 3.. 4.. 5.. 6.. 7. 8.. 9.. Sandström, I. (1879-1880). On a new gland in man and several mammals-glandulae parathyroideae. Upsala Läkarföreningens Förh 15:441-471. Åkerström, G., Malmaeus, J., and Bergström, R. 1984. Surgical anatomy of human parathyroid glands. Surgery 95:14-21. Kronenberg, H.M., Igarashi, T., Freeman, M.W., Okazaki, T., Brand, S.J., Wiren, K.M., and Potts, J.T., Jr. 1986. Structure and expression of the human parathyroid hormone gene. Recent Prog Horm Res 42:641-663. Abou-Samra, A.B., Juppner, H., Force, T., Freeman, M.W., Kong, X.F., Schipani, E., Urena, P., Richards, J., Bonventre, J.V., Potts, J.T., Jr., et al. 1992. Expression cloning of a common receptor for parathyroid hormone and parathyroid hormone-related peptide from rat osteoblast-like cells: a single receptor stimulates intracellular accumulation of both cAMP and inositol trisphosphates and increases intracellular free calcium. Proc Natl Acad Sci U S A 89:2732-2736. Juppner, H., Abou-Samra, A.B., Freeman, M., Kong, X.F., Schipani, E., Richards, J., Kolakowski, L.F., Jr., Hock, J., Potts, J.T., Jr., Kronenberg, H.M., et al. 1991. A G protein-linked receptor for parathyroid hormone and parathyroid hormone-related peptide. Science 254:1024-1026. Garabedian, M., Tanaka, Y., Holick, M.F., and Deluca, H.F. 1974. Response of intestinal calcium transport and bone calcium mobilization to 1,25-dihydroxyvitamin D3 in thyroparathyroidectomized rats. Endocrinology 94:1022-1027. Yamamoto, M., Kawanobe, Y., Takahashi, H., Shimazawa, E., Kimura, S., and Ogata, E. 1984. Vitamin D deficiency and renal calcium transport in the rat. J Clin Invest 74:507-513. Murayama, A., Takeyama, K., Kitanaka, S., Kodera, Y., Kawaguchi, Y., Hosoya, T., and Kato, S. 1999. Positive and negative regulations of the renal 25-hydroxyvitamin D3 1alpha-hydroxylase gene by parathyroid hormone, calcitonin, and 1alpha,25(OH)2D3 in intact animals. Endocrinology 140:2224-2231. Murayama, A., Takeyama, K., Kitanaka, S., Kodera, Y., Hosoya, T., and Kato, S. 1998. The promoter of the human 25-hydroxyvitamin D3 1 alpha-hydroxylase gene confers positive and negative responsiveness to PTH, calcitonin, and 1 alpha,25(OH)2D3. Biochem Biophys Res Commun 249:11-16.. 39.

(221) 10.. 11. 12.. 13. 14. 15. 16.. 17. 18.. 19.. 20.. 21.. 22.. 40. Brent, G.A., LeBoff, M.S., Seely, E.W., Conlin, P.R., and Brown, E.M. 1988. Relationship between the concentration and rate of change of calcium and serum intact parathyroid hormone levels in normal humans. J Clin Endocrinol Metab 67:944-950. Mayer, G.P., and Hurst, J.G. 1978. Sigmoidal relationship between parathyroid hormone secretion rate and plasma calcium concentration in calves. Endocrinology 102:1036-1042. Demay, M.B., Kiernan, M.S., DeLuca, H.F., and Kronenberg, H.M. 1992. Sequences in the human parathyroid hormone gene that bind the 1,25-dihydroxyvitamin D3 receptor and mediate transcriptional repression in response to 1,25-dihydroxyvitamin D3. Proc Natl Acad Sci U S A 89:8097-8101. Okazaki, T., Zajac, J.D., Igarashi, T., Ogata, E., and Kronenberg, H.M. 1991. Negative regulatory elements in the human parathyroid hormone gene. J Biol Chem 266:21903-21910. Okazaki, T., Igarashi, T., and Kronenberg, H.M. 1988. 5'-flanking region of the parathyroid hormone gene mediates negative regulation by 1,25-(OH)2 vitamin D3. J Biol Chem 263:2203-2208. Szabo, A., Merke, J., Beier, E., Mall, G., and Ritz, E. 1989. 1,25(OH)2 vitamin D3 inhibits parathyroid cell proliferation in experimental uremia. Kidney Int 35:1049-1056. Nygren, P., Larsson, R., Johansson, H., Ljunghall, S., Rastad, J., and Åkerström, G. 1988. 1,25(OH)2D3 inhibits hormone secretion and proliferation but not functional dedifferentiation of cultured bovine parathyroid cells. Calcif Tissue Int 43:213-218. Watson, P.H., and Hanley, D.A. 1993. Parathyroid hormone: regulation of synthesis and secretion. Clin Invest Med 16:58-77. Hawkins, D., Enyedi, P., and Brown, E. 1989. The effects of high extracellular Ca2+ and Mg2+ concentrations on the levels of inositol 1,3,4,5-tetrakisphosphate in bovine parathyroid cells. Endocrinology 124:838-844. Brown, E., Enyedi, P., LeBoff, M., Rotberg, J., Preston, J., and Chen, C. 1987. High extracellular Ca2+ and Mg2+ stimulate accumulation of inositol phosphates in bovine parathyroid cells. FEBS Lett 218:113-118. Corbetta, S., Mantovani, G., Lania, A., Borgato, S., Vicentini, L., Beretta, E., Faglia, G., Di Blasio, A.M., and Spada, A. 2000. Calcium-sensing receptor expression and signalling in human parathyroid adenomas and primary hyperplasia. Clin Endocrinol (Oxf) 52:339-348. Brown, E.M., Gamba, G., Riccardi, D., Lombardi, M., Butters, R., Kifor, O., Sun, A., Hediger, M.A., Lytton, J., and Hebert, S.C. 1993. Cloning and characterization of an extracellular Ca(2+)-sensing receptor from bovine parathyroid. Nature 366:575-580. Juhlin, C., Klareskog, L., Nygren, P., Ljunghall, S., Gylfe, E., Rastad, J., and Åkerström, G. 1988. Hyperparathyroidism is associated with reduced expression of a parathyroid calcium receptor.

(222) 23.. 24.. 25.. 26.. 27.. 28.. 29.. 30.. 31.. 32.. mechanism defined by monoclonal antiparathyroid antibodies. Endocrinology 122:2999-3001. Lundgren, S., Hjälm, G., Hellman, P., Ek, B., Juhlin, C., Rastad, J., Klareskog, L., Åkerström, G., and Rask, L. 1994. A protein involved in calcium sensing of the human parathyroid and placental cytotrophoblast cells belongs to the LDL-receptor protein superfamily. Exp Cell Res 212:344-350. Hjälm, G., Murray, E., Crumley, G., Harazim, W., Lundgren, S., Onyango, I., Ek, B., Larsson, M., Juhlin, C., Hellman, P., et al. 1996. Cloning and sequencing of human gp330, a Ca(2+)-binding receptor with potential intracellular signaling properties. Eur J Biochem 239:132-137. Lundgren, S., Carling, T., Hjälm, G., Juhlin, C., Rastad, J., Pihlgren, U., Rask, L., Åkerström, G., and Hellman, P. 1997. Tissue distribution of human gp330/megalin, a putative Ca(2+)-sensing protein. J Histochem Cytochem 45:383-392. Juhlin, C., Johansson, H., Holmdahl, R., Gylfe, E., Larsson, R., Rastad, J., Åkerström, G., and Klareskog, L. 1987. Monoclonal antiparathyroid antibodies interfering with a Ca2+-sensor of human parathyroid cells. Biochem Biophys Res Commun 143:570-574. Juhlin, C., Holmdahl, R., Johansson, H., Rastad, J., Åkerström, G., and Klareskog, L. 1987. Monoclonal antibodies with exclusive reactivity against parathyroid cells and tubule cells of the kidney. Proc Natl Acad Sci U S A 84:2990-2994. Juhlin, C., Åkerström, G., Klareskog, L., Gylfe, E., Johansson, H., Larsson, R., Ljunghall, S., Nygren, P., and Rastad, J. 1988. Monoclonal antiparathyroid antibodies revealing defect expression of a calcium receptor mechanism in hyperparathyroidism. World J Surg 12:552-558. Nykjaer, A., Dragun, D., Walther, D., Vorum, H., Jacobsen, C., Herz, J., Melsen, F., Christensen, E.I., and Willnow, T.E. 1999. An endocytic pathway essential for renal uptake and activation of the steroid 25-(OH) vitamin D3. Cell 96:507-515. Segersten, U., Correa, P., Hewison, M., Hellman, P., Dralle, H., Carling, T., Åkerström, G., and Westin, G. 2002. 25-hydroxyvitamin D(3)-1alpha-hydroxylase expression in normal and pathological parathyroid glands. J Clin Endocrinol Metab 87:2967-2972. Correa, P., Segersten, U., Hellman, P., Åkerström, G., and Westin, G. 2002. Increased 25-hydroxyvitamin D3 1alpha-hydroxylase and reduced 25-hydroxyvitamin D3 24-hydroxylase expression in parathyroid tumors--new prospects for treatment of hyperparathyroidism with vitamin d. J Clin Endocrinol Metab 87:5826-5829. Grimelius, L., DeLellis, R., Bondeson, L., Åkerström, G., Arnold, A., Franssila, K., Hendy, G., Dupuy, D., and Eng, c. 2004. Parathyroid adenoma. In Pathology and Genetics of Tumours of Endocrine Organs. R. DeLellis, R. Lloyd, P. Heitz, and C. Eng, editors. Lyon: World Health Organization. 128-132. 41.

No results found