Department of Physics, Chemistry and Biology
Final Thesis
The expression of thermoTRP channels in the
brood patch of jungle fowl (Gallus gallus) during
egg incubation
Shadi Jafari
LiTH-IFM- Ex--2130--SE
Supervisor: Jordi Altimiras, Linköpings universitet
Examiner: Cornelia Spetea Wiklund , Linköpings universitet
Department of Physics, Chemistry and Biology Linköpings universitet
Rapporttyp Report category Licentiatavhandling x Examensarbete C-uppsats x D-uppsats Övrig rapport _______________ Språk Language Svenska/Swedish x Engelska/English ________________ ISBN
LITH-IFM-A-EX--—09/2130—SE
__________________________________________________ ISRN
__________________________________________________
Serietitel och serienummer ISSN
Title of series, numbering
Handledare
Supervisor: Jordi Altimiras
Ort
Location: Linköping
Nyckelord
Keyword:
Brood patch, broody, jungle fowl, skin, thermoTRP
Datum
Date
2009-06-05
URL för elektronisk version
Sammanfattning
Abstract:
The regulation of egg temperature requires the transfer of heat from the brood patch. Thus, the brood patch needs the presence of thermo receptors as well as an appropriate vasomotor response. During the incubation an exact detection of the egg’s temperature is essential. So, in this study we attempted to detect the presence and regulation of thermo TRP channels (thermo Transient Receptor Potential channels) (TRPV1, TRPV3, TRPV4, TRPM8 and TRPA1) expressions during egg incubation. Six incubating Jungle fowl hens, and five non incubating jungle fowl hens and one jungle fowl cock were used as main samples and controls. Total RNA was extracted from liver, kidney, heart, blood, White Blood Cell, Dorsal Root Ganglion and skin. The samples from the skin were taken from the brood patch and inter scapular region. PCR investigation showed that different thermo TRP channels were expressed in different tissues. TRPV1, V3, V4 and M8 mRNA were detected in the skin of brood patch. However, V1 and V3 expression in the brood patch skin did not differ between broody and non broody hens. In conclusion, although considerable morphological changes in the skin of brood patch could be seen, the expression of TRPV1 and V3 channels did not change significantly, but this cannot exclude the alteration in the expression of TRP channels in different stages of broodiness or specific parts of skin like AVAs (Arteriovenous anastomosis) which will be the subject for more studies.
Titel
Title:
The expression of thermoTRP channels in the brood patch of Jungle fowl (Gallus gallus) during egg incubation
Författare
Author: Shadi Jafari
Avdelning, Institution
Division, Department
Avdelningen för biologi
Content
1 Abstract...……….………... 1
2 List of abbreviations... 1
3 Introduction...………..……… 1
4 Material and Methods...……….……….……… 3
4.1 Handling of animals...………. 3
4.2 Tissue sampling routines……….………. 3
4.3 RNA extraction...…………... 4
4.4 Reverse transcription...………... 4
4.5 Primer design for PCR and qPCR... 4
4.6 PCR...……….. 4
4.7 qPCR... 6
4.8 Data analysis... 6
4.9 Processing of histological samples for routine histological staining... 7
4.10 Morphometric analysis of skin samples... 7
5 Results………... 8
5.1 Identification of thermoTRP channels in Junglefowl tissues……… ... 8
5.2 TRPV4 expression in jungle fowl tissues………. 9
5.3 Expression of housekeeper genes in the skin……… 10
5.4 TRP channels expression change in nonbroody and broody Jungle fowls ………... 10
5.5 Histological changes of brood patch skin during the incubation………... 11
6 Discussion………... 11
6.1 TRPV4 mRNA in jungle fowl……….... 11
6.2 Presence of TRPA1, TRPV1, TRPV3 and TRPM8 in junglefowl tissues……… 14
6.3 Differential expression of thermoTRP channels in the brood patch of incubating jungle fowls………... 14
7 acknowledgements... 15
1
1 Abstract
The regulation of egg temperature requires the transfer of heat from the brood patch. Thus, the brood patch needs the presence of thermo receptors as well as an appropriate vasomotor response. During the incubation an exact detection of the egg’s temperature is essential. So, in this study we attempted to detect the presence and regulation of thermo TRP channels (thermo Transient Receptor Potential channels) (TRPV1, TRPV3, TRPV4, TRPM8 and TRPA1) expressions during egg incubation. Six incubating Jungle fowl hens, and five non incubating jungle fowl hens and one jungle fowl cock were used as main samples and controls. Total RNA was extracted from liver, kidney, heart, blood, White Blood Cell, Dorsal Root Ganglion and skin. The samples from the skin were taken from the brood patch and inter scapular region. PCR investigation showed that different thermo TRP channels were expressed in different tissues. TRPV1, V3, V4 and M8 mRNA were detected in the skin of brood patch. However, V1 and V3 expression in the brood patch skin did not differ between broody and non broody hens. In conclusion, although considerable morphological changes in the skin of brood patch could be seen, the expression of TRPV1 and V3 channels did not change significantly, but this cannot exclude the alteration in the expression of TRP channels in different stages of broodiness or specific parts of skin like AVAs (Arteriovenous anastomosis) which will be the subject for more studies.
Keywords: Brood patch, broody, jungle fowl, skin, thermoTRP.
2 List of abbreviations
AVA - Arteriovenous anastomosis DRG - Dorsal root ganglion
GAPDH - Glyceraldehyde-3-Phosphate Dehydrogenase
TRP channels - Transient receptor channels WBC - White blood cell
REST - Relative Expression Sofware Tool PCR - Polymerase chain reaction
NO - Nitric oxide
NTC - None template contorol qPCR - quantitative PCR
3 Introduction
Thermoregulation, and the maintenance of a fairly steady core body temperature even under a variety of internal and external conditions, is important to endothermic animals because each species has a preferred optimal body temperature1.Within the thermoneutral zone, thermoregulation occurs via changes in thermal conductance and without incurring in extra metabolic costs. In other words the regulation of heat exchange at the level of the skin is important, because it is the main avenue to changes in thermal conductance. So, whatever the temperature in the skin is, the skin can be used to give away heat or to prevent its loss to maintain a stable body or organ temperature.
One of the essential traits for the reproductive success of birds is egg contact incubation. The egg temperature is kept constant within narrow limits, which is compatible with embryonic and fetal development, making the skin region in contact with eggs, the brood patch, a highly temperature sensitive organ in incubating birds. The brood patch of incubating birds, usually the female, but in some cases the male as well, develops into a fleshy and well-vascularised skin area devoided of feathers 2. The transfer of heat into the egg is regulated through changes of blood flow in the brood patch and requires heat production by the parent 3.
2
An important part of the broodpatch skin, essential in the temperature regulation is AVA (Arteriovenous anastomoses). The presence of AVAs in the brood patch was first documented in 1984 4. AVAs are large vessels that shunt blood from arterioles to venules without passing the capillaries of the papillary plexus under the epidermis. Thus, the AVAs can shift the local blood flow through subepidermal capillary net. These AVAs show vasodilation induced by cold in the brood patch of broody hens, what is known as cold-induced vasodilation 3. This vasodilation lets blood to go to the skin of broodpatch in large amounts and transfer more heat to the eggs.
The regulation of egg temperature and blood flow through AVAs requires the transfer of heat from the brood patch skin. Thus, the brood patch needs the presence of thermo receptors as well as an appropriate vasomotor response. Although the stability of egg temperature is well documented, the mechanisms that govern it like how temperature changes are detected in the brood patch are not properly understood. These mechanisms behind the temperature detection are the first step for the whole process from detection to providing a constant temperature by adjusting the blood flow in the skin vessels of brood patch.
TRP channels (Transient Receptor Potential channels) belong to a large family of nonselective cation Ca2+ permeable channels that function in a variety of processes, including temperature sensation 5, 6 and are the likely candidates to explain molecular thermal transduction of broodpatch. The nine thermoTRPs which are activated by all the temperature threshold are TRPV1 which is activated by temperatures >42°C, TRPV2 by >52°C, TRPV3 by >33°C, TRPV4 between 27 and 42°C, TRPM2 between 35 and 42°C, TRPM4 and TRPM5 between 15 and 35°C, TRPM8 by <25°C, and TRPA1 by <17°C, when over expressed in cultured cells or Xenopus oocytes. Virtually the entire range of temperatures that mammals are exposed is covered by the temperature sensitivity range of these nine thermo-TRPs 7. Using sequence homology the candidate genes for eight of the nine mammalian thermoTRPs have been predicted in the chicken genome 7 but no further work has been published on thermoTRPs in birds.
Thermo receptors also must trigger a reflex response, which results in vasoconstriction due to skin cooling and vasodilation due to skin heating. TRP channels are not only the molecular transductors of thermo sensation but have other roles as well and their function is now being extensively explored. Among the thermoTRPs TRPV1 for instance is required for inflammatory sensitization to noxious thermal stimuli 8, and is related to pain sensation 9. TRPV3 (VRL3) is probably able to associate with TRPV1 as well and may modulate its responses10. TRPV4 was first described as a channel activated by hypotonicity-induced cell swelling 11, 12, 13, 14, 15.There is also evidence that Ca2+ entry through endothelial TRPV4 channels triggers NO- and EDHF-dependent vasodilatation. Moreover, TRPV4 appears to be mechanistically important in endothelial mechanosensing of shear stress 16.
The role of TRP channels in temperature sensation and their potential function as regulators of blood flow through sensory vasoactive neuropeptide release 17 led us to propose the idea that these channels play a role in the blood flow regulation in the brood patch of incubating birds as well and was the basis behind our study. The presence of thermoTRP channels in different tissues of birds, especially in the brood patch region, was detected by their predicted mRNA sequences from the chicken genome. We found five thermoTRP channels (V1, V3, V4, M8 and A1) in different tissues and in the brood patch skin although A1 was not present in the skin. These channels are interesting as they have been proven to detect the temperatures within the range of the desired temperature of incubated eggs. During the incubation an exact detection of the egg’s temperature is essential. So, we hypothesized that the thermoTRP channels and specifically those TRP channels which detect the temperatures in the range of egg’s desired temperature should be
3
upregulated. We also found some interesting Morphological changes in the brood patch skin. Morphological changes could help in better blood flow regulation through some TRP channels which might be upregulated as well. We did not find any upregulation in tested TRP channes, though.
4 Materials and Methods 4.1 Handling of animals
Junglefowl were acclimated outdoors in an outdoor aviary at Vreta Gymnasiet between April and August. The flocks typically consisted of 7-8 hens and 1 cock. Hens were allowed to breed naturally and were given access to individual nesting boxes. A total of eleven hens (body mass mean value of 798 g, range 600-1100 g) were euthanized by decapitation, six of them were broody and had been sitting on their eggs for at least 80% of embryonic development, the other five were non-broody even if they were laying fertilized eggs at the time of euthanasia and as such, were used as controls. All procedures were approved by ethical protocol Dnr.69-08.
4.2 Tissue sampling routines
Heart, liver, kidney, dorsal root ganglion and blood were taken from a few individuals to extract RNA and test PCR primers. From all hens, four skin samples were excised, three in the region of the brood patch and one from the interscapular region. The brood patch samples were obtained by dissecting the entire right and left pectoral apteria and the entire sternal apterium (Figure 1).
Figure 1. Anatomical description of the brood patch regions used in the study. The ventral feather tracts (c) separate the sternal apterium (3) from the right and left pectoral apteria (2).1, ventral cervical apterium; 2, pectoral apterium; 3, sternal apterium; 4, crural apterium; a, ventral cervical tract; b, pectoral tract; c, sternal tract; d, abdominal tract; e, crural tract
4
The pectoral apteria could be clearly distinguished because they are delimited by the sternal feather tracts (pterylae). The skin samples (>4 cm2) were pinned down to a silicon plate (Elastosil M4600, ABIC Kemi, Sweden) and kept under phosphate buffer saline during the dissection of four 1 cm2 sections. One of the sections was immediately processed for total RNA extraction (10 min total processing time) and the other three were subsequently extended and fixed with 4% paraformaldehyde (PFA) for a period of 2 h. One of the samples was kept in PFA until processed for histological staining and the other two were embedded in 30% sucrose overnight and frozen at -80 °C.
4.3 RNA extraction
Total RNA from 50-300 mg tissue from heart, liver, kidney, skin, dorsal root ganglion and blood was extracted using RNA proTM solution (Phenol pH 7.9 + Guanidine Thiocyanate) and a Fast Prep® Instrument following the protocol detailed by the manufacturer (processing for 40 s at a setting 6.0 following by centrifuging at ≥12000 g for 10 min at room temperature). Briefly, the upper phase was washed with 300 µL chlorophorm twice and centrifuged at ≥12000 g for 10 min at 4 ºC. 500 µL of cold 100% ethanol was added to the upper phase and the solution was incubated at -20 ºC for 30 min and centrifuged. The supernatant was discarded and the RNA pellet was washed with 75% cold ethanol and resuspended in 100 µL DEPC treated water. The RNA obtained was checked for quality and integrity using a Nanodrop spectrophotometer and stored at -80 ºC.
4.4 Reverse Transcription
Potential remains of genomic DNA were digested with DNase I, RNase-free (Fermentas, Sweden) for 30 min at 37 ºC followed by 10 min incubation with EDTA at 65 ºC. The reverse transcription step was carried out immediately after following the instructions from the manufacturer. Briefly, approximately 1 µg RNA was mixed with 0.5 µg oligo(dt)18 primer, 2 µL dNTP Mix (10 mM each nucleotide), 0.5 µL RiboLock™ RNase Inhibitor (20 u) and 4 μL 5X reaction buffer was added to the mixture after 5 min incubation at 70 ºC. 1 µL RevertAid™ H Minus M-MuLV Reverse Transcriptase was added (final volume 20 µL) and the reaction was incubated at 42 °C for 60 min, followed by 10 min at 70 °C to inactivate the reverse transcriptase.(First strand cDNA synthesis kit; Fermentas, Sweden). The cDNA was then used for the RT-PCR or qPCR immediately or stored at -80 ºC.
4.5 Primer design for PCR and qPCR
PCR primers for different TRP channels were designed using OligoPerfect Input (http://tools.invitrogen.com/content.cfm?pageid=9716) or Primer3Plus (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) software tools. The primers tested are detailed in Tables 1 and 2. Primers for housekeeper genes were taken from the literature 18
. All primer sets for each TRP channel mRNA were designed to intron/exon boundaries (eliminating contaminating genomic DNA signals).
4.6 PCR
The protocol specified by the manufacturer was followed. Briefly we prepared a master mix with Dream Taq DNA Polymerase (25 u), forward and reverse primer (0.1 µM each), and 5 µL dNTP Mix (2 mM each) (Fermentas, Sweden). The amplification was carried out in 50 µL (48 µL master mix plus 2 µl cDNA template). The following PCR protocol was used: step 1: 3 min at
5
TABLE 1. Primer Sequences for TRPA1, TRPV1, TRPV3, TRPM8 and housekeeper genes a: Primers worked in RT-PCR; b: Primers worked in both RT-PCR and qPCR; c: Primers did not work; bp: Base pair (amplicon size)
Target Forward Primer Reverse Primer bp
TRPA1(XM_418294.2) TRPV1(NM_204572) TRPV3(XM_00123515) ACCCACATACAGCCAGGAG ATCGTCATGAGATGCTGCTG ACTCCATCACAGGCTGCTCT GCTAAGCTGCAGGAAAATG AAAACGACACAAGGGTTTGC GGATGGGCCAATATGCTCTA ATCGGGAATCGCCATGAAAT CACTGCAAATGAGCTGGTGTa GGAGGAGCAAAGAGTGAACGb TTGCAATATCCAGCAGCAAGc CCAGGATCCCAAAGATCTCAb GCAGCCTGGAGTCAAGTTTCa GGATCTCCAGATCACCCAGAa CATCCCACACCACGTGTCAGc 281 354 246 168 445 275 206 TRPM8(NM_00100708) GAPDH(K01458) HPRT(AJ132697) β-Actin (L08165) G6PDH(AI981686) UB(M11100) CAATGACCGAAACTGGGAGT GATGCGCTCCTCACGTTTGT GGCACGCCATCACTATC ATGGGLACGCCATCACTA CCCAAACATTATGCAGACGA CACAGATCATGTTTGAGACCT CGGGAACCAAATGCACTTCGT GGGATGCAGATCTTCGTGAA CCATCTTCCACACAAACGTGa GGAGCTTACTGGCCCCAAGAc CCTGCATCTGCCCATTTa TCAGATGAGCCCCAGCCTTb TGTCCTGTCCATGATGAGCa CATCACAATACCAGTGGTACGb CGCTGCCGTAGAGGTATGGGAa CTTGCCAGCAAAGATCAACCTTa 239 241 61 129 66 101 122 147
95°C; step 2: 30 s at 95 °C; step 3: 30 s at 62-60 °C; step 4: 30s at 72 °C; step 5: 5 min 72 °C. Steps 2–4 were repeated 35 times. The PCR was performed using a Gradient Palm-cycler (CG1-96 from Corbett, Australia). For size and quality of PCR products, the PCR mixtures were analysed using agarose gel electrophoresis (0.5% Tris borate EDTA –agarose–gel containing ethidium bromide). A Low Range DNA Ladder (Fermentas, Sweden) was used to estimate amplicon size.
Agarose gels were visualized using a UV transilluminator camera (BioDoc-IT imaging system, USA). We made two different kinds of controls. One was prepared by adding autoclaved MilliQ water to the reagents instead of template DNA (NTC) and one with adding water instead of Reverse transcriptase enzyme in the RT-PCR process (data not shown).
Bands of the expected size were sent for sequencing (GATC Biotech) after removal of primers and nucleotides using Exonuclease I (10 u), Calf Intestine Alkaline Phosphatase (CIAP) (1 u) and Exonuclease 10×buffer (2 µL) following the protocol indicated by the manufacturer (Fermentas, Sweden) (60 min at 37 ºC, 15 min at 85 ºC and cooling to 4 ºC for 3 min.
6
TABLE 2. Primer Sequences for PCR for TRPV4
Primers used in RT-PCR for TRPV4. The arrow shows where the 6th intron place is.
EAS: Expected mRNA amplicon size; LAS: Located genomic amplicon size; FP: Forward Primer; RP: Reverse Primer a: The only primer worked in RT-PCR; bp: Base pair (amplicon size)
Target Primers EAS LAS
TRPV4 (NM_204692) FP: CCCGTGAGAACACCAAGTTT RP: ATCTCCAACACGGACACCTC FP: CGTGCACTATCTGACGGAGA RP: GATCTCCAACACGGACACCT FP: GAGGTGTCCGTGTTGGAGAT RP: GCGATGAGGGTGAAGATGAT FP: TCGGG↓ATCTTCCAGCACATCA RP: ATCTCCAACACGGACACCTC FP: GAAACATGCGGGAGTTCATCa RP: TAGAAGTAGCCGCCCTCATC 305 bp 721 bp 409 bp 826 bp 179 bp 246 bp 160 bp 160 bp 187bp 396bp 4.7 qPCR
Based on the results of RT-PCR in skin samples, the expression of positively identified TRP channels was further characterized using quantitative PCR methods. For qPCR we used TaqManH Reverse Transcription reagents and Power SYBR Green Master Mix (12.5 µL), 4 pmol of forward and reverse primer each and 4.5 µL water in a total volume of 25 µL reaction solution (Applied Biosystems). The following qPCR protocol was employed (5 µL of the RT product): initial denaturation step 10 min at 95 °C, denaturation for 15 s at 95 °C, annealing and extension for 60 s at 60 °C. 40 rounds of amplification were conducted in a RotorGene 6000 thermocycler (Corbet Life Science, Australia). A melting step by slow heating from 65 to 99 °C with a rate of 0.2 °C s-1 was performed at the end of the reaction to eliminate nonspecific fluorescence signals. No-template control assays were performed for each primer set used to rule out the presence of primer dimers or secondary primer structures. NTC samples produced negligible signal detection, typically 38–40 Cts in value. Standard curve assays were performed
by measuring mRNA transcript levels obtained with specific primer sets from a control cDNA sample made of an RNA pool diluted in sequential 2-fold steps. A similar standard curve was performed for the housekeeping genes GAPDH and β-actin. Therefore, for assessing the RNA quality and quantity of each sample we normalized the mRNA transcript level against GAPDH and β-actin at each dilution (∆Ct). The slope of the standard curve should be ≤0.1 for accurate mRNA transcript level determination. In our results all reaction efficiencies were 0.9≤x≤1.01. All standard curve and sample assays were performed in triplicate to enhance the accuracy of mRNA transcript detection.
4.8 Data analysis
RNA quality was assessed using a Nanodrop spectrophotometer. 260/280 Absorbance ratios between 1.98-2.3 and 260/230 absorbance ratios >2 were considered acceptable.
7
Quantification for qPCR data was done using REST-384-beta (Relative Expression Sofware Tool, version 2), which allows the comparison of the relative expression of up to 16 different genes 19. The PCR efficiency (E), the rate at which a PCR amplicon is generated based on the slope of the standard curve is calculated as E = 10[–1/slope]. The optimal efficiency of a qPCR run is 1. REST also uses the Pair Wise fixed Reallocation Randomisation Test for each sample, so the CP values (Crossing Point defined as the point at which the fluorescence rises for the first time above the background fluorescence) for reference and the target genes are modified to control and sample groups and the expression ratios are calculated on the basis of the mean values calculated. This randomization test avoids making any assumptions about distribution.
4.9 Processing of histological samples for routine histological staining
Following fixation, the skin samples were dehydrated in different ethanol solutions (70%, 95% and 99.5%, 2 h each), clarified in xylene and impregnated in paraffin overnight (60°C) before embedding. A paraffin microtome was used to obtain 10 µm cross sections of the skin samples, which were placed on chromalum coated glass slides, deparaffinated with xylene, rehydrated with ethanol solutions and distilled water and stained with Ehrlichs hematoxylin-eosin. After staining the slides were dehydrated again under ethanol, clarified with xylene and mounted with DPX. Slides were examined with a compound microscope (Elipse 80i, Nikon) and pictures were taken with a DS-U1 4 Mpixel colour camera (Nikon).
4.10 Morphometric analysis of skin samples
Morphometric quantification on the skin samples was carried out using the analytical tools built in the NIS-Elements AR Software (v.3.0, Nikon).The following variables were measured from each skin sample: epidermal thickness, density of arterio-venous anastomosis (AVAs) and average cross-sectional area of AVAs. A minimum of three cross-sections and five
Figure 2. Cross-sectional image of the brood patch skin. E, Epidermis; pp, papillary plexus ; AVA, Arterio-venous anastomosis, Scale bar, 50µm.
8
measurements in each cross-section was carried out for each sample. The epidermal layer could be easily distinguished because it was preferentially stained by hematoxylin, taken a more violet appearance (see Figure 2). AVAs were identified as vascularized regions located in the dermis and clearly distinct from the more continuous papillary plexus.
Figure 3. PCR products of different TRP channels in different jungle fowl tissues shown by gel electrophoresis A) TRPA1. B) TRPM8. C) TRPV1 and D) TRPV3. NTC samples were used as controls (con), The ladder is shown at the right side of each gel, the related fragment size is mentioned for each TRP channel.
5 RESULTS
9
The expression of five TRP channels was examined at the level of mRNA in jungle fowl tissues. PCR and gel electrophoresis showed that TRPV1, TRPV3, TRPM8, and TRPA1 mRNA could be found in different tissues. TRPA1 mRNA was only found in the liver and DRG and not in other tissues such as kidney, heart, WBC, whole blood and skin (Fig 3A) while TRPM8 mRNA
was found in all tissues tested (Fig 3B). TRPV1 was found in all tissues tested (skin, DRG, heart, WBC, kidney, liver) but not in whole blood (Fig 3C). TRPV3 mRNA was present in the heart and the kidney, liver, DRG and skin but the highest expression level was found in the heart. TRPV3 was not expressed in WBC and whole blood (Fig 3D).
In summary we found TRPV1, V3, and M8 expressed in the skin but not the TRPA1.
5.2 TRPV4 expression in jungle fowl tissues
The early results we got from searching TRPV4 mRNA (Table 2, the first primer set) showed that the fragment we could find (≈800 bp) was the genomic fragment instead of the mRNA fragment (305 bp). Based on amplicon size, it appears that the PCR product included also the introns despite DNase treatment (the expected genomic fragment size is 721 bp). This first primer’s forward sequence was in the 6th exon and the reverse set was in the 7th exon. Next we tried new primer sets designed against other exons with larger and smaller fragments (Table 2, the second and third primer sets) but the result was the same. Another attempt was based on a forward primer splitted between two exons, with 5 bp of primer in the 6th exon and 15 bp in the 7th exon (Table 2, the fourth primer set). The PCR product was as long as the expected fragment (160 bp). Given the results, we went back and prepared three different controls. PCR with the NTC controls with water instead of the template, also controls prepared with sample RNA from other organisms, instead of chicken template RNA, added to RT-PCR, were clear. The controls
Figure 4. PCR fragments of TRPV4 channel by different primer sets shown by gel electrophoresis. A) Fragments related to P1 (Primer 1), P2 and P3 are as long as genomic fragments. P4 fragment is mRNA fragment. All samples were DNase treated. P1, P2, P3 and P4 are in the order of the primers present in the table 2. B) PCR products of TRPV4 fifth primer set in different jungle fowl tissues. The controls (con) are with the samples prepared without addition of Reverse transcriptase.
10
with the template which was prepared by RT-PCR product resulted of adding all reagents but with adding water replaced for the reverse transcriptase showed the fragment (Fig 4A).
The last primer set we tested (Table 2, the fifth primer set) was designed for first five exons. This primer produced a fragment with correct size of 189 bp. Then the presence of TRPV4 was checked in different tissues which showed that bands of expected size can be found in kidney, DRG, heart, blood and skin, but not in liver or white blood cells (Fig 4B)
5.3 Expression of housekeeper genes in the skin
Several of the housekeeper genes used previously in other tissues of Jungle fowl 18 were checked for expression in the skin. All the genes checked (HPRT, G6PDH, β-actin, UB, and GAPDH) could be localized in skin RNA samples but the expression of GAPDH and β-actin was relatively higher than for others (Fig 5A). As a result, GAPDH and β-actin were chosen as the housekeeper genes in the qPCR study.
5.4 TRP channels expression change in nonbroody and broody Jungle fowls
Only TRPV1, TRPV3 and TRPM8 were located in skin RNA samples. A qualitative comparison of the expression patterns of brood patch skin compared to the control inter scapular skin in broody
and non-broody hens showed some differences for TRPV3 but not for TRPM8 and TRPV1
Figure 5. PCR fragments of TRP channels shown by gel electrophoresis. A) Expression of housekeeper genes in the skin. B) Comparison of TRPM8, TRPV1 and TRPV3 expression in the skin of broody and non broody jungle fowls, also between brood patch and inter scapular skin samples. Lad, Ladder; BIP, Broody hen Incubation Patch; BIS, Broody hen Inter Scapular patch; NBIP, Non Broody Incubation Patch, NBIS, Non Broody Inter Scapular Patch; HPRT, hypoxanthine-guanine phosphoribosyltransferase, G6PDH, Glucose-6-phosphate dehydrogenase; UB, Ubiquitin B; GAPDH, Glyceraldehyde 3-phosphate dehydrogenase.
11
(Fig 5B). The most apparent difference is that TRPV3 is higher in the brood patch than in the control skin for both broody and non-broody hens.
Next, we prolonged our investigation by searching for any difference in the expression of the chosen TRP channels in brood patch between non broody and incubating hens. For this experiment we used real-time PCR. TRP channel expression was validated using twelve skin samples from lateral part of brood patch, six samples from broody hens and six samples from non broody hens. The qPCR results analyzed by the REST method showed that TRPV3 was not significantly different in broody hens in any of the three qPCR runs (Table 3). TRPV1 expression was very low and the results showed that the expression did not change significantly either. TRPM8 primers did not work with any of the Master mixes we tried for real time quantitative PCR.
Table 3. Expression analysis of the skins from broody and non broody jungle fowls. The expression given is after normalizing to GAPDH and β-actin levels.
Genebank Run Real time PCR Efficiency Normalized fold Fold p value Expression TRPV1 1 -1.06 0.91 1.02 0.515 TRPV3 1 -1.28 0.86 0.93 0.562 2 +1.34 0.61 1.16 0.887
3 +1.01 0.98 0.91 0.461
All the cDNA pools and individual samples were produced by using the same source of RNA but separately for each run. The expression of each gene is considered 1 in the broodpatch skin of non incubating hens.
5.5 Histological changes of brood patch skin during the incubation
The brood patch skin changed markedly during incubation. The brood patch skin’s epidermal thickness was 11.32 ± 1 µm in the broody and 7.2 ± 1.06 µm in the non broody hens. Indeed, the epidermal thickness increased significantly in the skin of brood patch in the broody compared to non broody hens (p=0.001). The epidermis was also thicker in the skin samples of brood patch compared to the samples from inter scapular region in the incubating hens (p=0.004). In the interscapular region of non broody hens the epidermal thickness was 8.56 ± 1.55 µm (Fig 6A). The frequency of AVAs (arteriovenous anastomosis) increased significantly in the brood patch samples of broody jungle fowls compared to interscapular skin (p=0.012) and this did not occur in non broody birds. There was no difference in the AVA frequency between non broody and broody hens (Fig 6B). (The AVAs’ frequency was 2.33 ± 1.55, 1.42 ± 0.99, 0.35 ± 0.33 and 0.67 ± 0.36 mm-1 in the brood patch skin of broody and non broody hens and interscapular skin of broody and non broody hens, respectively.)
Furthermore, the AVA area was larger not only in the brood patch of incubating jungle fowls (1412.42 ± 746.61 µm2) in comparison with non incubating hens (397.93 ± 113.86 µm2) (p=0.02), but also in the brood patch versus inter scapular region (302.70 ± 411.07 µm2)(p=0.044) (Fig 6C).
6 Discussion
12
Fig 6. Morphological comparison between the broodpatch and interscapular skin in the broody and non broody hens. Results are from histochemistery studies and analysed by analytical tools built in the NIS-Elements AR Software. A)Epidermial thickness B)AVA’s frequency C)AVA’s area. AVA, Arteriovenous anastomosis.
TRP cation channel, subfamily V, member 4 (also known as TRPV4, OTRPC4, VR-OAC, TRP12, and VRL-2) is a Ca2+ permeable channel activated by a wide variety of physical and chemical stimuli 20. TRPV4 expression has been illustrated in a broad range of tissues, including the endothelial cells from mouse aorta 14, Human Embrionic Kidney cells (HEK293) 21, lung 22, and many other tissues like liver and DRG 23, 24.
13
Originally, TRPV4 was proposed as a mechano- or osmosensor. This nomination was because the channel opens in response to hypotonically induced cell swelling 11 and shear stress 25. However, TRPV4 can also be activated by moderate temperature (>27°C) 26. Some investigations using
TRPV4–/– mice revealed the involvement of TRPV4 channels in sensing mechanical pressure 27,
osmolality 23, and heat 28 in vivo.
TRPV4 expression has also been reported in the skin. Together with its activation by warm temperature 29 and NO 30, the role of NO in the vasodilation 31 was the reason we thought TRPV4 could have a part in the temperature and blood flow regulation of the brood patch in incubating hens. This role of TRPV4 makes this channel especially interesting.
In the early attempts we did not find the TRPV4 mRNA in any tissue we tried because the PCR product identified was also found in the absence of template (Fig 7A). There is evidence of TRPV4 mRNA in chicken 32,11 but it has been derived froma chicken auditory epithelium cDNA library and was never traced in any other tissue. This channel was shown to be expressed in liver, kidney, heart and even the nervous system in mammals 33. A possible reason is the existence of alternative splicing in the TRPV4 mRNA. In a gene with many exons it is possible for the splicing machinery to remove different sets of exons from a single pre-mRNA, resulting in different mRNAs from a single gene in different tissues. Bioinformatic analysis specifies that alternative splicing is found in 35–65% of human genes 34, 35. Because the human TRPV4 mRNA consists of 5 alternative splicing isoforms36 we believe that this is the most likely explanation of our results. In connection to this, we found that the chicken TRPV4 gene contains a duplication 2750 bp long (starting from base 2617 and base 5658). This duplication starts from the 6th intron and continues to the last exon and this is also the place where alternative splicing has been found in human TRPV4 mRNA (exons 4-7) 36 (Fig 7B). All of our four first primers were designed in the 4th to 8th exons region which is within the duplication part of TRPV4 mRNA.
Fig 7. A) Comparison between the situation of the chicken TRPV4 gene and the human TRPV4 gene. The localization of the exons and introns is indicated. B) Alternative splicing of human TRPV4 mRNA (HTRPV4 A-E) and chicken TRPV4 mRNA (ChTRPV4).
14
The fifth primer set showed TRPV4 is expressed in many tissues. These are the same tissues we could not find TRPV4 previously. This could be another indication of the presence of an alternative splicing of TRPV4.
6.2 Presence of TRPA1, TRPV1, TRPV3 and TRPM8 in junglefowl tissues
The expression of thermoTRP channels in mammalian tissues has been widely documented. Less is known in the chicken to the point that many mRNA thermoTRP sequences are just predictions based on their genes sequences. To our knowledge there has been no other study about TRPA1 and TRPV3 expression in chicken. Our results, though, showed that TRPA1 mRNA is found at least in the liver and DRG. TRPA1 mRNA has been documented in human DRG 37. TRPV3 mRNA is found in numerous tissues like heart, skin, DRG, liver and kidney of jungle fowls but not in the blood or WBC. In mammals, it was discovered in skin, DRG, kidney and WBC but not in the liver or heart 38, 39, 40. Interestingly, TRPM8 mRNA is extracted from all the tissues we examined. It has been shown in chicken DRG previously 41 but not in any other tissue. In other organisms it was found in the liver, kidney, DRG, skin 42, 43, 44. There was no evidence for presence of TRPM8 mRNA in the heart, blood and WBC.
TRPV1 was found in all tissues except for blood. It was already known from chicken DRG 45 and in mammals, TRPV1 is present in the liver, DRG and heart and WBC 5,46, 47,39.
6.3 Differential expression of thermoTRP channels in the brood patch of incubating jungle fowls
One of the essential parameters for the reproductive success of birds is a stable temperature of the egg with relatively little changes during the incubation. This is necessary for embryonic and fetal development. The parent bird undergoes remarkable changes in its behavior and physiology to maintain a constant temperature for the eggs.
One of the essential physiological changes in the brood patch is the vasodilation of AVAs. This process is likely mediated through temperature sensors (likely thermoTRP channels) in the skin of the brood patch 3. As the presence of thermoTRPs has been reported in the pulmonary artery and aorta 48 it was also possible that these TRP channels have a role in the blood vessels tone regulation.
Despite all the morphological changes in the brood patch of incubating hens, those TRP channels we looked at (V1 and V3) did not change their expression level. This was different from what we found in the PCR suggesting that TRPV3 was more expressed in the brood patch’s skin. This could be because all skin layers (epidermis, dermis and hypodermis) were used for RNA extraction. If thermoTRP channels are very low expressed or if they are expressed specifically in some parts of skin it will be hard to achieve them. So, it might be important to use each layer separately to access to more specific mRNA. TRPV3, for instance, is expressed in keratinocytes and has been found in the smooth muscle cells of aorta and pulmonary artery 48, 49. As it was later recognized from the histological assessment, the thickening of epidermis and enlargement of AVAs are some changes that could be seen in the brood patch skin of incubating hens. Although the epidermis gets larger in broody hens its ratio to the whole skin is still too little and its expression change could be more considerable by examining the epidermal layer separately. Another possibility is the difference in the TRP channels’ expression in the brood patch versus other parts of skin. Histological studies showed that the AVAs’ frequency was greater in the skin of brood patch of broody hens compared to the skin of the interscapular area. This was not the case in non broody junglefowls. If any of the thermoTRP channels, TRPV1 or M8 for example,
15
are expressed in the AVAs, this increase in the AVAs’ area could provide more thermo receptors for detection of the temperature changes.
We also believe that it is important to consider the time duration in which we tried to see the change in the TRP channels’ expression. It has been mentioned that a rise in prolactin hormone is associated with the onset of egg incubation in a number of free-living passerine species. The rise may occur at the time of egg laying and incubation, or more slowly until later in incubation50. All our samples were taken on the 19th -20th day of incubation. If the regulation of TRP channels is triggered by prolactin increase, it is likely that in that late stage of incubation we cannot find any rise in mRNA of thermoTRPs in the brood patch skin. In other words it is possible that TRP channel’s mRNA goes up due to prolactin rise and after induction of TRP channels’ protein goes back to its normal levels in non broody hens.
In summary, there was no significant regulation in the examined TRP channels expression in the whole skin despite all histological changes like epidermal thickening or more frequent AVAs. This is in spite of the important role in thermoregulation and thermosensitivity of the brood patch 2
.
7 Acknowledgements
I am delighted to acknowledge my supervisor, Dr Jordi Altimiras, for his enthusiasm and commitment to the project. I am also grateful to Daniel Nätt for teaching me the qPCR technique used in the present study and for contributing with ideas and suggestions. Finally I want to thank to Ida Gustafson for doing part of histochemistery lab experiment.
8 References (Nature format)
1. Polk, C. & Postow, E. Handbook of Biological Effects of Electromagnetic Fields. 2nd ed. CRC Press: Boca Raton, FL (1995)
2. White, F. & Kinney, J. Avian incubation. Science 186, 107-115 (1974).
3. Midtgard, U., Sojrsen, P. & Johansen, K. Blood flow in the brood patch of bantam hens. Evidence of cold vasodilatation. J Comp Physiol 155, 703-710 (1985).
4. Midtgard, U. Density of arteriovenous anastomoses in some skin areas of the domestic fowl (Gallus domesticus). Nat Rec 209, 455-459 (1984).
5. Caterina, M. J. et al. The capsaicin receptor: A heat activated ion channel in the pain pathway.
Nature 389, 816-824 (1997).
6. Caterina, M. J., Rosen, T. A., Tominaga, M. A., Brake, J. & Julius, D. A capsaicin-receptor homologue with a high threshold for noxious heat.Nature 398, 436-441 (1999).
7. Saito, S. & Shingai, R. Evolution of thermoTRP ion channel homologs in vertebrates Physiol
Genomics 27, 219–230 (2006).
8. Davis, J. B. et al. Vanilloid receptor-1 is essential for inflammatory thermal hyperalgesia.
Nature 405, 183-187 (2000).
9. Caterina, M. J. et al. Impaired nociception and pain sensation in mice lacking the capsaicin receptor. Science 288, 306-313 (2000).
10. Smith, G. D. et al. TRPV3 is a temperature-sensitive vanilloid receptor-like protein. Nature
418, 186-190 (2002).
11. Liedtke, W. et al. Vanilloid receptor-related osmotically activated channel (VR-OAC), a candidate vertebrate osmoreceptor. Cell 103, 525–535 (2000).
16
12. Nilius, B., Prenen, J., Wissenbach, U., Bodding, M. & Droogmans, G. Differential activation of the volume-sensitive cation channel TRP12 (OTRPC4) and volume-regulated anion currents in HEK-293 cells. Pflügers Arch 443, 227–233 (2001).
13. Strotmann, R., Harteneck, C., Nunnenmacher, K., Schultz, G. & Plant, T. D. OTRPC4, a nonselective cation channel that confers sensitivity to extracellular osmolarity. Nat Cell Biol 2, 695–702 (2000).
14. Wissenbach, U., Bodding, M., Freichel, M. & Flockerzi, V. Trp12, a novel Trp related protein from kidney. FEBS Lett 485, 127–134 (2000).
15. Gevaert, T. H. et al. Deletion of the transient receptor potential cation channel TRPV4 impairs murine bladder voiding. J Clin Invest 117, 3453-3462 (2007).
16. Köhler, R. et al. Evidence for a functional role of endothelial transient receptor potential V4 in shear stress–induced vasodilatation. Arterioscler Thromb Vasc Biol 26, 1495-1502 (2006). 17. Inoue, R. et al. Transient Receptor Potential Channels in Cardiovascular Function and Disease. Circ Res 99, 119-131(2006).
18. De Boever, S., Vangestel, C., De Backer, P., Croubels, S. & Sys, S. U. Identification and validation of housekeeping genes as internal control for gene expression in an intravenous LPS
inflammation model in chickens. Vet Immunol Immunopathol 122, 312–317 (2008). 19. Pfaffl, M. W., Horgan, G. W. & Dempfle, L. Relative expression software tool (REST©) for
group-wise comparison and statistical analysis of relative expression results in real-time PCR.
Nucleic Acids Res 30, e36 (2002).
20. Nilius, B., Droogmans, G. & Wondergem, R. Transient receptor potential channels in endothelium: solving the calcium entry puzzle? Endothelium 10, 5–15 (2003).
21. Watanabe, H. et al. Heat-evoked activation of TRPV4 channels in a HEK293 cell expression system and in native mouse aorta endothelial cells. J Biol Chem 277, 47044–47051 (2002).
22. Fernandez-Fernandez, J. M., Nobles, M., Currid, A., Vazquez, E. & Valverde, M. A.
Maxi K+ channel mediates regulatory volume decrease response in a human bronchial epithelial cell line. Am J Physiol Cell Physiol 283, 1705–1714 (2002).
23. Mizuno, A., Matsumoto, N., Imai, M. & Suzuki, M. Impaired osmotic sensation in mice lacking TRPV4. Am J Physiol Cell Physiol 285, 96–101 (2003).
24. Güler, A., Lee, H., Shimizu, I. & Caterina, M. J. Heat-evoked activation of TRPV4 (VR-OAC). J Neurosci 22, 6408–6414 (2002).
25. Gao, X., Wu, L., & O’Neil, R.G. Temperature-modulated diversity of TRPV4 channel gating: activation by physical stresses and phorbol ester derivatives through protein kinase C-dependent and -independent pathways. J Biol Chem 278, 27129–27137 (2003).
26. Nilius, B., Vriens, J., Prenen, J., Droogmans, G., & Voets, T. TRPV4 calcium entry channel: a paradigm for gating diversity. Am J Physiol Cell Physiol 286, 195–205 (2004).
27. Suzuki, M., Mizuno, A., Kodaira, K. & Imai, M. Impaired pressure sensation in mice lacking TRPV4. J Biol Chem 278, 22664–22668 (2003).
28. Lee, H., Iida, T., Mizuno, A., Suzuki, M. & Caterina, M. J. Altered thermal selection behavior in mice lacking transient receptor potential vanilloid 4. J Neurosci 25, 1304–1310 (2005).
29. Chung, M. K., Lee, H. & Caterina, M. J. Warm temperatures activate TRPV4 in mouse 308 keratinocytes. J Biol Chem 278, 32037–32046 (2003).
30. Yoshida, T. et al. Nitric oxide activates TRP channels by cysteine S-nitrosylation. Nat Chem
17
31. Minson, C. T., Berry, L. T. & Joyner, M. J. Nitric oxide and neurally mediated regulation of skin blood flow during local heating. J Appl Physiol 91, 1619–1626 (2001).
32. Cuajungco, M. P. et al.PACSINs Bind to the TRPV4 Cation Channel. PACSIN 3 modulates the subcellular localization of TRPV4. J Bio Chem 281,18753–18762 (2006).
33. Clapham, D. E., Runnels, L. W. & Strübing, C. The TRP ion channel family. Nat Rev
Neurosci 2, 387-396 (2001).
34. Modrek, B. & Lee, C. A genomic view of alternative splicing. Nat Genet 30, 13–19 (2002). 35. Mironov, A. A., Fickett, J. W. & Gelfand, M. S. Frequent alternative splicing of human genes. Genome Res. 9, 1288–1293 (1999).
36. Arniges, M., Ferna´ndez-Ferna´ndez, J. M., Albrecht, N., Schaefer M. & Valverde, M. A. Human TRPV4 channel splice variants revealed a key role of ankyrin domains in multimerization and trafficking. J Bio Chem 281, 1580–1586 (2006).
37. Nagatomo, K. & Kubo, Y. Caffeine activates mouse TRPA1 channels but suppresses human TRPA1 channels.Proc Natl Acad Sci U S A 105, 17373-17378 (2008).
38. Xu, H. et al. TRPV3 is a calcium-permeable temperature-sensitive cation channel. Nature
418, 181-186 (2002).
39. Spinsanti, G. et al. Quantitative Real-Time PCR detection of TRPV1–4 gene expression in human leukocytes from healthy and hyposensitive subjects. Mol Pain 4, 51(2008).
40. Kitahara, T., Li, H.S. & Balaban, C. D. Changes in transient receptor potential cation
channel superfamily V (TRPV) mRNA expression in the mouse inner ear ganglia after kanamycin challenge. Hear Res 201, 132-144 (2005).
41. Chuang, H., Neuhausser, W. M. & Julius, D. The Super-Cooling agent Icilin reveals a
mechanism of coincidence detection by a temperature-sensitive TRP channel. Neuron 43, 859– 869 (2004).
42. Fonfria, E. et al. Tissue distribution profiles of the human TRPM cation channel family. J
Recept Signal Transduct Res.26, 159-178 (2006).
43. Bödding, M., Wissenbach, U. & Flockerzi, V. Characterisation of TRPM8 as a pharmacophore receptor.Cell Calcium 42, 618-628 (2007).
44. Slominski, A. Cooling skin cancer: menthol inhibits melanoma growth. Focus on "TRPM8 activation suppresses cellular viability in human melanoma". Am J Physiol Cell Physiol 295, 296-301 (2008).
45. Jordt, S. E. & Julius, D. Molecular Basis for Species-Specific Sensitivity to “Hot” Chili Peppers. Cell 108, 421–430 (2002).
46. Hillier, L. D. et al. Generation and analysis of 280,000 human expressed sequence tags.
Genome Res 6, 807-28 (1996).
47. Seebacher, F. & Murray, S.A. Transient receptor potential ion channels control thermoregulatory behaviour in reptiles. PLoS ONE 2, e281 (2007).
48. Yang, X., Lin, M., McIntosh, L. S. & Sham, J. S. K. Functional expression of transient receptor potential melastatin- and vanilloidrelated channels in pulmonary arterial and aortic smooth muscle. Am J Physiol Lung Cell Mol Physiol 290, 1267-1276 (2006).
49. Peier, A. M. et al. A Heat-Sensitive TRP Channel Expressed in Keratinocytes. Science 296, 2046-2049 (2002).
50. Vleck, C. M. Hormonal control of incubation/brooding behaviour: lessons from wild birds.
