Final Thesis
Expression of β
1-adrenergic receptors in chicken fetuses
Sebastian Hedlund
zzzzzzzzzzzzzzzzzzzz
Avdelning, Institution Division, Department
Avdelningen för biologi
Institutionen för Fysik och Mätteknik
Datum Date 06 07 13 Språk Language Rapporttyp Report category ISB LITH-IFM-Ex--05/1603--SE X Engelska/English Licentiatavhandling X Examensarbete IS LiU-Biol-Ex-561 C-uppsats
X D-uppsats Serietitel och serienummer Title of series, numrering --- ISSN
Övrig rapport
____
Handledare: Jordi Altimiras Ort: Linköping
Titel /Title: Expression of β1-adrenergic receptors in chicken fetuses
Författare /Author: Sebastian Hedlund
Sammanfattning/ Abstract:
Chicken fetuses exposed to chronic hypoxia suffer from growth retardation and induces an overall sympathetic activity, including elevation of the concentration of circulating
catecholamines. Simultaneously, hypoxic fetuses display a lowered β-adrenoreceptor (βAR) density in myocardial tissue. In vertebrates, β1AR and β2AR are the most important signalling
pathways for acute elevation of cardiac performance. The aim of this study was to see how chronic hypoxia affects the level of messenger RNA (mRNA) for the β1ARin the fetal
chicken heart at different developmental ages. The broiler chicken is a suitable model organism for studying the progression of heart failure because the fast growth rate requires a large increase in blood perfusion at the end of fetal development. The β1AR sequence of the
broiler chicken is 1587 bp and located on chromosome 6. When running a PCR for
quantification of the sequence, primers for almost the whole sequence failed (1404 bp) and so did primers of 1193 bp; instead primers of 692 bp of the sequence were used and made quantification possible. Similar results were obtained from both the heart and liver of day 15 fetal chickens. The PCR product was cloned into a TOPO vector and sent for sequencing, to enable the making of a probe for a northern blot analysis of the mRNA in the fetal chicken hearts.
Table of contents 1 Abstract ... 1 2 Introduction ... 1 2.1 GPCR desensitization ... 2 2.2 Adrenergic receptors... 2 2.3 β-Adrenergic receptors ... 3 2.4 β-adrenoceptor signalling ... 3 2.5 Heart failure ... 3 2.6 Hypoxia... 5
3 Materials and methods... 5
3.1 Egg incubation ... 5
3.2 Heart sampling ... 6
3.3 RNA isolation ... 6
3.4 DNA isolation (Appendix A)... 6
3.5 Obtaining the β1AR sequence and primer design... 7
3.6 Polymerase Chain Reaction (PCR)... 7
3.7 Cloning the PCR product into a plasmid ... 7
3.8 DNA Labeling and Detection ... 8
3.9 Electrophoresis gels ... 10
3.9.1 Agarose gel (1%)... 10
3.9.2 Formaldehyde agarose gel (for RNA electrophoresis)... 10
4 Results... 10
4.1 Egg Incubation ... 10
4.2 Obtaining the β1AR sequence ... 10
4.3 PCR ... 11
4.4 Cloning the PCR product into a plasmid ... 11
5 Discussion ... 12
6 Acknowledgments... 14
7 References ... 14
Appendix A ... 21
1 Abstract
Chicken fetuses exposed to chronic hypoxia suffer from growth retardation and induces an overall sympathetic activity, including elevation of the concentration of circulating catecholamines. Simultaneously, hypoxic fetuses display a
lowered β-adrenoreceptor (βAR) density in myocardial tissue. In vertebrates, β1AR and β2AR are the most important signalling pathways for acute elevation of cardiac performance. The aim of this study was to see how chronic hypoxia affects the level of messenger RNA (mRNA) for the β1ARin the fetal chicken heart at different developmental ages. The broiler chicken is a suitable model organism for studying the progression of heart failure because the fast growth rate requires a large increase in blood perfusion at the end of fetal development. The β1AR sequence of the broiler chicken is 1587 bp and located on
chromosome 6. When running a PCR for quantification of the sequence, primers for almost the whole sequence failed (1404 bp) and so did primers of 1193 bp; instead primers of 692 bp of the sequence were used and made quantification possible. Similar results were obtained from both the heart and liver of day 15 fetal chickens. The PCR product was cloned into a TOPO vector and sent for sequencing, to enable the making of a probe for a northern blot analysis of the mRNA in the fetal chicken hearts.
Keywords: Chicken fetus, β-adrenergic receptor, Hypoxia, mRNA, Heart
2 Introduction
G protein-coupled receptors (GPCRs) constitute the largest class of cell surface-signaling molecules and are widely involved in the regulation of vital cellular processes (Zhou et al. 2000). They can be activated by a variety of extracellular stimuli such as light, odorants, neurotransmitters and hormones. GPCRs
associate closely with the G protein subunits (Gα and Gβγ dimer) and activate them by promoting binding of guanosine-5´-triphosphate (GTP) to the Gα subunit in exchange for guanosine-5´-diphosphate (GDP). This exchange leads to the dissociation of the Gα from the Gβγ dimer which allows both the subunits to activate downstream effectors such as adenylyl cyclases, phospholipases, and ion channels (Leifert et al. 2005). In the GPCR family, the adrenergic receptors and the muscarinic cholinergic receptors are particularly important for the heart because they function in the homeostatic regulation of the cardiovascular
2.1 GPCR desensitization
“Desensitization” is an important adaptive mechanism of GPCRs. It means that despite continuing agonist stimulation, the receptor responsiveness fades.
GPCRs have developed highly structured mechanisms to shut off their signaling abilities (Lefkowitz 1998). One mechanism, which operates over hours, is a net loss of receptors which is called “downregulation”. This means that there is a decrease in receptor synthesis, a destabilization of mRNA or an increase of receptor degradation in the cell that is stimulated with the agonist. Another way to terminate the signal is to uncouple the receptor from the signal transducing G protein (Gα); this process only takes seconds to minutes but requires receptor phosphorylation which is performed by protein kinases (Lefkowitz 1998 and Pitcher et al. 1998). There are two ways in which the receptor can be
uncoupled. In heterologus desensitization or “the non-agonist-specific”
desensitization, the second messengers’ cAMP and DAG activate protein kinase A (PKA) and protein kinase C (PKC) which in turn uncouple the G protein from the receptor. In homologous desensitization or “agonist-specific”
desensitization, phosphorylation is performed by GPCR Kinase (GRK). There are six members in the GRK family, and all family members (GRK1-6) share the same characteristic of phosphorylating only agonist-occupied receptors or receptors that are stimulated. The most important GRK for the heart is the GRK2, which is called β-adrenergic receptor kinase (β-ARK1). The other GRKs are expressed in most tissues, except for GRK1 which is mainly expressed in the retina of the eye and GRK4 which is found in the brain and testis (Lefkowitz 1998 and Pitcher et al. 1998).
2.2 Adrenergic receptors
Today, several hundred GPRCs have been cloned, but the members of the GPCR family that been studied most extensive are the adrenergic receptors together with the visual pigment rhodopsin. It is the adrenergic receptors that form the interface between the sympathetic nervous system and the
cardiovascular system, but they are also located in many endocrine and parenchymal tissues (Hein & Kobilka 1997).
The existence of two subtypes of adrenergic receptors, the α-adrenoceptors
(αARs) and the β-adrenoceptors (βARs), was first demonstrated in 1948 by
Ahlquist (quoted by Queen & Ferro 2006). These receptors are, among others, the receptors for the endogenous catecholamines epinephrine and
norepinephrine and are found widely distributed in the cardiovascular system. (Queen & Ferro 2006).
Today, at least nine types of adrenergic receptors have been cloned from several different species. There are, at least, three α1AR subtypes, three α2AR subtypes and three βAR subtypes (Hein & Kobilka 1997 and Rockman et al. 2002). Several of the adrenergic receptor subtypes are both structurally and
functionally very similar, but the reason for the evolution of these closely related subtypes is not yet known.
2.3 β-Adrenergic receptors
Based on the relative potency of sympathomimetic amines in different tissues
two types of βAR, the β1- and β2 adrenoreceptor were found (Lands et al. 1967, quoted by Queen & Ferro 2006). Later on a third subtype, the β3-adrenoceptor was isolated and cloned (Emorine et al. 1989). Pharmacological evidence
suggested the existence of a fourth type of βAR (Kaumann 1997 and Galitzky et al. 1998). However, the putative β4AR has never been cloned, and recent
evidence suggests that it is probably a low affinity state of the β1AR
(Granneman 2001 and Arch et al. 2004) which now has been redefined as the propranolol-insensitive state of the β1AR (atypical β1 adrenoceptor) (Kaumann et al. 2001 and Bundkirchen et al. 2002).
The β receptors, including β1-, β2- and β3 adrenoceptors and also the atypical β adrenoceptors, are expressed in most mammalian cells (Harden 1983 and Lefkowitz 2004).
In the human heart, β1- and β2AR coexist, but β1AR predominate; in general the ratio of β1:β2 ARs is 70%:30% in the atria and 80%:20% in the ventricles, but the total number of βARs seems to be equally distributed over the heart (Brodde & Michel 1999). Recently, there has also been some evidence for β3AR messenger RNA (mRNA) expression in heart tissue (Gauthier et al. 1996 and Gauthier et al. 2000).
2.4 β-adrenoceptor signalling
The βARs are GPCRs which couple to the Gs protein that activate adenylyl cyclase which converts ATP into cAMP, cAMP then elicits its effects in cells via activation of cAMP dependent protein kinase A (PKA) (Harden 1983; Seino & Shibasaki 2005 and Young et al. 2005). This often results in positive
inotropic and chronotropic effects, and has been seen both in vivo as well as during in vitro studies.
Stimulation of both β1- and β2AR, together, can evoke maximal increases in force contraction (on isolated tissues in vitro) and heart rate (in vivo in healthy subjects), however, for the ventricles, stimulation of only β1AR can cause a maximal increase in force contraction while β2AR can only cause submaximal increases (Brodde & Michel 1999).
2.5 Heart failure
In failing hearts, apoptosis and necrosis has been demonstrated (Olivetti et al. 1997 and Haunstetter & Izumo 1998) and there is evidence that suggest that
stimulation of β1AR might promote apoptosis of the cardiomyocytes
(Communal et al. 1999;Shizukada & Buttrick 2002 andPönicke et al. 2003). β2AR, on the other hand, has been found, not only to couple to the Gs protein but also to the Gi protein (Xiao et al. 1995; Xiao et al. 1999 and Steinberg 1999) and therefore it might contribute to induction of antiapoptosis (Communal et al. 1999; Shizukada & Buttrick 2002 and Pönicke et al. 2003). This is supported in recent research where β2AR agonists seem to be able to activate the Gs protein pathway as well as the Gs- and the Gi protein pathway in rat atria (Xiao et al. 2003).
Heart failure is characterized by left ventricular dysfunction associated with insufficient perfusion of the tissues and organs (Towbin & Bowles 2002). If the heart gets damaged by an insult, the activation of the sympathetic nervous system plays an important role in adapting circulatory homeostasis to the
changes in the environment. (Leimbach et al. 1986). These observations have led to the hypothesis that sympathetic activation may be central to the
progression of heart failure (Bristow 1998). The role of the βAR system in the pathogenesis and treatment of CHF is well accepted (Lohse et al. 2003).
In studies of the failing heart in intact animal models, there are abnormalities at several levels of the βAR pathways (Table 1). Prior investigations have
identified several alterations in the βAR pathway that contribute to the weakening of the βAR stimulation of the failing heart. Most commonly, downregulation of β1AR without any changes on β2AR has been described in CHF (Lohse et al. 2003). But additional studies suggests that the β1ARs that remains in CHF are largely desensitized or uncoupled from Gs, in part, because of increased activity of GRK (Ping et al. 1997and Lohse et al. 2003) and also an increased abundance of Gi has been found in heart failure, which could oppose the Gs stimulation of adenylyl cyclase (Feldman et al. 1988; Kiuchi et al. 1993 and Xiao et al. 2003).
Table 1. Alterations in the βAR signalling pathway in chronic heart failure (Rockman et al., 2002). The arrows indicate if there is an increase or a decrease in receptor-, enzyme- or protein level.
Molecule Change β1AR ↓, uncoupled
β2AR No change, uncoupled
GRK2 ↑mRNA levels, ↑activity
GRK3 No change
GRK5 Not studied
Gi ↑
Gs No change
2.6 Hypoxia
Numerous studies in animal models have demonstrated that ß1-ARs are extensively altered in hypoxia (Karliner et al. 1989;Susanni et al. 1989; Strasser et al. 1990 and Hammond et al. 1993). In animal models of chronic hypoxia, adecrease in myocardial ß-ARs has been reported (Voelkel et al. 1981;Mader et al. 1991 andKacimi et al. 1992) but the AR regulation in those models might not be due to the hypoxia, instead they might be the result of the elevated endogenous catecholamine levels.
An advantage of using fetal chickens to study the effects of hypoxia is that hypoxia can easily be induced to the fetus by lowering the oxygen
concentration of the eggs environment. Also, broiler chicken is a suitable model organism for studying the progression of heart failure, because of the fast
growth rate (Currie 1999) which demands a large increase in blood perfusion at the end of fetal development.
There are cardiovascular adaptations in the fetus to protect the vital organs in situations such as hypoxia. These adaptations include bradycardia, increased systemic blood pressure, redistribution and increase of the cardiac output (Mulder et al. 1998) and leads to an increase of the sympathetic activity. At most levels of hypoxia and for most ages of the fetuses there will be a depression of heart rate and arterial pressure (Crossley et al. 2003). The
increase in sympathetic activity will cause a rise in the systemic blood pressure which the endocrine system will respond to by an increase of vasopressin and catecholamines in the fetal plasma in order to counteract the effects of the hypoxia (Mulder et al. 1998). It has been shown that adrenergic stimulation by catecholamines will limit the hypoxic hypotension. Also, pharmacological evidence suggests that the catecholamine response, due to the hypoxia, is the deriving mechanism for the pressure changes (Crossley et al. 2003).
The aim of this study was to compare the levels of messenger RNA
(mRNA) in fetuses of 15- and 19 days for the β1AR in hearts of chicken fetuses exposed to chronic hypoxia with the level of mRNA in normal fetal hearts. The hypothesis was that there would be a decrease of mRNA for the hypoxic hearts because of the induced catecholamine levels in the fetus during the incubation, which triggers the downregulation of the β1AR.
3 Materials and methods
3.1 Egg incubationBroiler eggs from 45-50 wk old hens were obtained from Svenska
Kläckeribolaget AB, transported to the lab and stored at 15 ºC and constant turning (angle of 45º) until needed for incubation. At the most they were stored for 3 weeks. The eggs used for the experiment were incubated in 37 ºC in either
a normoxic or a hypoxic (~14% O2) chamber for 15- or 19 days where the eggs were constantly turned through an angle of 45º.
3.2 Heart sampling
The embryos were quickly decapitated using a pair of scissors and then
weighted. The hearts were dissected and removed from the chicken and put in Heart ringer solution (138 mM NaCl, 3 mM KCl, 3 mM CaCl2, 1.8 mM MgCl2, 10 mM HEPES, 5 mM Na2Pyruvate). Tris was used to adjust the final ringer pH to 7.4 (final concentration of Tris was approximately 10 mM). Hearts were allowed to beat spontaneously for a couple of minutes to rinse residual blood. Then they were quickly frozen down in liquid nitrogen and stored in -80 ºC until needed, but at the most for 2 months.
3.3 RNA isolation
RNA was prepared using the TRI Reagent kit (Ambion) according to the manufacturers’ protocol (Ambion protocol 2006).
Briefly, a heart (~0.20-0.30g) was homogenized with an Ultra-Turrax T8 (IKA-Werke) in 1 ml TRI reagent. The homogenate was incubated at ambient
temperature, then centrifuged at 13 600g for 10 min. Chloroform (200 µl) was added to the supernatant followed by incubation (10 min, ambient temperature) and centrifugation for 10 min at 13 600g (Mikro 200, Hettich Zentrifugen). Isopropanol (500 µl) was added to the supernatant and the solution was then vortexed for 5 s, incubated at ambient temperature for 10 min and centrifuged at 13 600g for 8 min. The supernatant was removed and 1 ml 70% ethanol was added to the pellet and centrifuged at 5400g for 5 min. The supernatant was discarded and the pellet air-dried and redissolved in 200 µl of milli Q H2O. A 1% formaldehyde agarose (FA) gel was used for electrophoresis to check the quality of the RNA isolation under UV light. But before the results could be analyzed, the gel was washed in water three times to remove of the
formaldehyde which otherwise would make the whole gel illuminate instead of just the RNA when UV-light is used (since ethidium bromide illuminated by UV-light shows the double bond of the ethidium bromide and the formaldehyde also contains a double bond).
3.4 DNA isolation (Appendix A)
Liver or heart tissue (~0.20- 0.50g) were homogenized with an Ultra-Turrax T8 (IKA-Werke) in 1 ml homogenization buffer (50 mM Tris, 100 mM EDTA and 1% SDS), then 30 µl of 10 mg/ml solution proteinase K (in milli Q water) was added and incubated over night at 55 ºC. 25 µl 10 mg/ml RNase A was added and incubated for 1 h in 37 ºC. 50 µl 1 M Sodium acetate and 500 µl phenol was
added, then the solution was rotated for 20 min and centrifuged at 13 600g for 10 min. The aqueous phase plus the interface was used and 500 µl
phenol/chloroform (1:1 v/v) was added, rotated for 5 min and centrifuged (Micro 200, Hettich Zentrifugen) at 13 600g for 5 min. The aqueous phase was used and 500 µl chisam (Chloroform:Isoamylalcohol 24:1 v/v) was added, rotated for 5 min and centrifuged for 2 min at 13 600g. The aqueous phase was used and 500 µl isopropanol was added, mixed by invertion, and centrifuged at 13 600g for 2 min. The supernatant was removed and 500 µl 70% ethanol was added. The DNA solution was mixed and centrifuged again and then the supernatant was removed. 500 µl 100% ethanol was added, mixed and
centrifugation was repeated before discarding the supernatant. The pellet was air-dried, 300 µl Milli Q water was added and then the DNA solution was rotated for 15 min for proper mixing.
3.5 Obtaining the β1AR sequence and primer design
The sequence for the β1AR and also on which chromosome it was located was found with the help of Blast software (Blast, NCBI). Lasergene from DNA* (Madison. WI, USA) was used to design appropriate primers which were sent to DNA Technology A/S (Aarhus, Denmark) for synthesis.
3.6 Polymerase Chain Reaction (PCR)
The annealing temperature for the primers was calculated according to the formula: 4(G + C) + 2(A + T). The PCR was performed using 125 µl PCR Supermix (Invitrogen), 69 µl dH2O, 5 µl upper primer, 5 µl lower primer and 50 µl of the DNA (diluted in milli Q water). Five samples were used where the final volume for each reaction was 50 µl; the samples were exposed to different temperatures during the PCR; 57.9 ºC, 59.7 ºC, 61.3 ºC, 63.1 ºC and 65.0 ºC, the so called annealing temperature. The PCR programme consisted of an initial step at 94 ºC (2 min) followed by the following sequence: 94 ºC (30 s),
annealing temperature (gradient between 55 ºC – 65 ºC, 30 s) and 72 ºC (30 s). The sequence was repeated 30 times and then the PCR finished with 10 min at 4 ºC. The entire PCR process took about 2 h but was often run overnight and the PCR products were stored in 4 ºC after completion.
3.7 Cloning the PCR product into a plasmid
The PCR product was cloned into a vector using the TOPO TA Cloning kit (Invitrogen, Invitrogen protocol 2006). Briefly, 2 µl TOPO Cloning Reaction (3 µl of the PCR product, 1 µl Salt solution, 1 µl Sterile H2O and 1 µl TOPO
bacterial solution was heat-shocked for 30 s at 42 ºC (GD120, Grant) and
immediately put back on ice. 250 µl of SOC medium (2% Tryptone, 0.5% Yeast extract, 10mM NaCl, 2.5 mM KCl, 20 mM MgCl2, 20 mM MgSO4, 20 mM Glucose) were added and the solution incubated at 37 ºC for 1 h. 30 µl of the bacterial solution was put on an agar plate (preheated in 37 ºC with 80 µl X-gal (20 mg/ml) and 4 µl 1M IPTG) with , and the rest of the solution was put on a similar agar plate, then incubated in 37 ºC over night. Two white and two white/blue colonies were chosen since these colonies probably have the PCR sequence inserted. In the TOPO plasmid, the cloning site is actually within a lacZ gene. If cloning a piece of DNA into that site succeeds, the lacZ gene is interrupted and usually non-functional which prevents the colony to present a blue colour which would appear if the LacZ gene is intact. The colonies were put in separate tubes with 2 ml LB medium and 200 µl ampicilin, then put on a shaker (SM-30, Edmund Bühler) and incubated over night. To get the plasmid prepared,
Plasmid Mini Prep Kit 1 (E.Z.N.A, E.Z.N.A protocol 2006) was used. Briefly, the bacteria solution was centrifuged at 10 000g for 1 min. The supernatant was removed, 250 µl Solution I/RNase A was added and the cells were resuspended. 250 µl Solution II was added then mixed gently until a clear lysate was
obtained, then 350 µl Solution III was added and centrifuged for 10 min at 10 000g. The supernatant was transferred to a miniprep column and centrifuged for 1 min at 10 000 x g. The pellet was discarded, 500 µl Buffer HB was added then the column got centrifuged again. The tube was emptied all over again, 750 µl wash buffer was added to the column and centrifuged. The column was moved to an Eppendorf tube, 50 µl sterile deionised water was added, and then centrifuged in order for the plasmids to detach from the membrane. In order to control if the PCR product really got cloned into the TOPO vector a restriction enzyme (EcoRI) was used to cleave the plasmid. 10 µl DNA, 7 µl H2O, 2 µl Buffer H and 1 µl EcoRI was mixed for every different plasmid solution, then incubated at 37 ºC for 3 h, and run on a 1% agarose gel. If the PCR sequence was inserted in the TOPO vector, there should be two fragments of DNA visible on the gel. Afterwards, the concentration and the purity of the plasmid solution were measured with ND-1000 Spectrophotometer (Nanodrop). 30 µl of the plasmid samples were diluted to 50 ng/µl and sent to GATC Biotech AG (Konstanz, Germany) for sequencing to verify that the sequence cloned corresponded to the predicted sequence for the β1AR. The results of the sequencing was blasted as a control that it was the β1AR sequence that we cloned.
3.8 DNA Labeling and Detection
The labeling and the detection were performed using the DIG High Prime DNA Labeling and Detection Starter kit 1 (Roche) according to the manufacturers’
protocol (Roche protocol 2006). The DIG-DNA Labeling was briefly performed by diluting 1 µl of the PCR solution in 15 µl milli Q H2O (DNA solution), then denaturised in boiling water (GD120, Grant) for 10 min and immediately put on ice. DIG-High Prime (Roche) was mixed thoroughly, 4 µl was added to the denatured DNA solution and incubated over night at 37 ºC. To stop the reaction, 2 µl 0.2 M EDTA was added then put in 65 ºC for 10 min. The concentration of DIG-DNA solution was measured to in order to be able to determine the efficiency of the labeling. A dilution of 1 ng/µl DIG-DNA
solution was prepared, and then a dilution series according to table 2 was performed.
Table 2. Dilution series of DIG-DNA Label solution. All DIG-DNA solution was diluted with DNA Dilution Buffer (Roche).
Tube Dilution Final concentration (pg/µl)
1 - 1000 2 1:100 10 3 1:330 3 4 1:1000 1 5 1:3300 0.3 6 1:10 000 0.1 7 1:33 000 0.03 8 1:100 000 0.01 9 - 0
1 µl from tubes 2-9 (table 2) and 1 µl of the labeled control was applied to a positively charged nylon membrane (Roche). Nucleic acid was fixed to the membrane by cross linking it with UV-light for 1 min. The membrane was transferred into a plastic container with 20 ml Maleic acid buffer (0.1 M Maleic acid, 0.15 M NaCl, adjusted to pH 7.5 with NaOH) and incubated for 2 min, then moved and incubated for 30 min in 10 ml Blocking solution (10 x
Blocking solution (Roche) diluted 1:10 in Maleic acid buffer). Transferred to a new container and incubated for 30 min in 10 ml Antibody solution (Anti-Digoxigenin-AP (Roche) diluted 1:5000 in Blocking solution) then washed two times with 10 ml Washing buffer (0.1 M Maleic acid, 0.15 M NaCl, 0.3% Tween 20) for 15 min. The membrane was equilibrated by incubation for 5 min in 10 ml Detection Buffer (0.1 M Tris-HCl, 1 mM EDTA, pH 9.5), and
incubated in 2 ml colour substrate solution (40 µl of NBT/BCIP stock solution (Roche) in 2 ml Detection buffer) in a plastic container in the dark. When desired spot intensities were achieved, the reaction was stopped by washing of the membrane in 50 ml TE-Buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0).
3.9 Electrophoresis gels 3.9.1 Agarose gel (1%)
2g agarose was added to 200 ml 1 x TAE buffer (Electran) in a bottle. The solution was heated in a microwave oven and mixed until completely dissolved. The solution was cooled down by running tap water. When the temperature of the buffer was around 60 ºC, 10 µl ethidium bromide was added and then the it was stored in 60 ºC until use.
3.9.2 Formaldehyde agarose gel (for RNA electrophoresis)
2g agarose was added to 160 ml 1x TAE buffer. Then exactly the same procedure as for the 1% agarose gel but at the end 40 µl formaldehyde was added.
4 Results
4.1 Egg Incubation
Mortality among the incubated eggs with different treatments is presented in table 3. The mortality also includes non-fertilized eggs. In total, 220 eggs were incubated, the n value for the two normoxic groups was 48 each and for the two hypoxic groups it was 62 each.
Table 3. Mortality data for embryos incubated in normoxia or hypoxia (~14%) for 15- or 19 days. Non-fertile eggs that were incubated is taken into account.
Incubation Mortality (%) n Normoxic, 15 days 39.6 48
Normoxic, 19 days 29.2 48 Hypoxic, 15 days 52.0 62 Hypoxic, 19 days 29.7 62
4.2 Obtaining the β1AR sequence
The β1AR is located on chromosome 6 in broiler chickens and it has a length of 1587 bp. The primers that were designed with Lasergene are presented in table 4.
Table 4. The primers designed for the PCR of the β1AR for broiler chickens.
Upper primer Lower primer
1 CGA CTG CGG CCC CCA CAA C GCA CGC AGC CAC TTC TCT ATG 2 GAT GGC CCT GGT GGT GCT GCT CA TGC CGC TCC CCA AAA ATG TGC 3 ATC GAG ACC TTG TGC GTC AT AAG CAG AGC AGC CTC TTG AA
4.3 PCR
Both primer pair 1 (1404 bp sequence) and 2 (1193 bp sequence) failed to yield any results in the PCR for β1AR in broiler chickens, and so did a nested PCR with these two primer pairs. However, the 3rd pair succeeded to quantify a sequence (692 bp) of the β1AR in both heart (Figure 1a) and liver tissue (Figure 1b) with similar results. Sample nr 3 from heart tissue was used for cloning of the β1AR sequence into a plasmid.
Figure 1a. Electrophoresis of PCR results from heart, using the 3rd set of primers. The different samples are for different
annealing temperatures during the PCR procedure.
Figure 1b. Electrophoresis of PCR results from liver, using the 3rd set of primers. The different samples are for different annealing temperatures during the PCR procedure.
4.4 Cloning the PCR product into a plasmid
There were separate bands seen on an electrophoresis gel, for sample 1-3, when TOPO plasmids were cleaved with a restriction enzyme (Figure 2). The
separation indicates that the insertion of the β1AR sequence from the PCR product had succeeded. The concentration and purity for each of the samples are shown in Table 5. In sample 4 there was no separation and therefore no cloning had been successful in those plasmids. When the result from the sequencing of the plasmid sequence (Appendix B) was blasted, it showed a 100% similarity to the β1AR sequence in the blast database.
Figure 2. Electrophoresis of restriction cleavage on the plasmids with inserted β1AR
sequence.
Table 5. Concentration and purity of the plasmids with the β1AR sequence.
Sample Concentration (ng/µl) Purity
1 257.8 1.92
2 267.4 1.94
3 411.9 1.90
4 - -
5 Discussion
Oxygen is the main limiting factor for the growth of chicken fetus (Metcalfe et al. 1981). Diffusion of oxygen into the egg occurs through pores of the eggshell where the differences in oxygen tension of the blood and the ambient air builds up a gradient which regulates the oxygen flow to the fetus. Therefore the total flow of oxygen into the egg is dependent on how large this gradient is (Metcalfe et al. 1981). Hypoxia would therefore results in a lower gradient in oxygen tension between fetal blood and the environment. This means that there would supposedly be a higher mortality in the eggs incubated in hypoxia because fewer fetuses would be able to tolerate the challenging conditions due to the oxygen drop.
Chickens exposed to chronic hypoxia will change the fraction of cardiac output. There will be an increase of blood directed to heart, brain and
chorioallantoic membrane (analog to the placenta) at the expense of intestine, liver, yolk-sac and carcass (Mulder et al. 1998). Also there will be an elevation of the endogenous catecholamine level as a response to the increased
sympathetic activity caused by hypoxia (Voelkel et al. 1981).
What effect the chronic hypoxia has on the levels of mRNA for the β1AR in chickens is not yet known. However, in intact animal models of chronic
hypoxia adecrease in myocardial ßARs has been reported (Voelkel et al. 1981; Bernstein et al. 1990 & Kacimi et al. 1992) but these reports were made on rats, not fetal chickens. However, one might expect to get a similar result since an elevation of catecholamine levels during hypoxia has been seen in both rats and chickens (Mulder et al. 1998). The α1-AR subtypesare differentially regulated at both the mRNA level and protein density during chronichypoxia where it selectively downregulates both the pharmacologically defined α1A-ARdensity and the α1C-AR mRNA level. (Li et al. 1995). Therefore a similar
downregulation of β1AR mRNA during chronic hypoxia might be expected. A reason for choosing broiler chickens when studying hypoxia and fetal hearts is that the broiler chicken is an animal that develops independently of the mother. The gas exchange takes place by diffusion through micropores in the egg shell, which can be seen as an equivalent to the placenta (Metcalfe & Stock 1993). This allows the introduction of hypoxia simply by lowering the oxygen concentration of the eggs environment. Other advantages of using fetal chickens are the short incubation time and economical aspect. These features make the chick fetus an attractive model for cardiovascular research.
The primers used in PCR were designed by Lasergene, so one might hope that they were optimal for the PCR of the β1AR sequence. In this experiment however, the PCR failed for β1AR sequences greater than 1000 bp. Perhaps there was a too big difference in annealing temperature for the first two sets of primers. This might have interfered during the process or perhaps the PCR Supermix (Invitrogen) which is said to be suitable for most PCR, failed to perform PCR for sequences longer than 1000 bp. Also, the broiler chicken genome has not yet been mapped, so when looking for the β1AR, the genome of
Gallus gallus (Red jungle fowl) was chosen since it is presumably closest
related to the broiler chicken. One important aspect of this is that the β1AR for the Gallus gallus does not necessarily have the exact same sequence as the one for broiler. That may also be a reason for the failing PCR with the first two sets of primers; they might not have the right sequence.
It does not come as a surprise that the results of the PCR from the heart and liver were quite similar. DNA of an organisms entire genome can be found in every cell of that organism. This means that, in principle, DNA for the β1AR could be isolated from any tissue of the fetus and the results would probably still be similar. However, for RNA the results would differ between tissues. For heart tissue the result of a PCR would be about the same as for DNA since the β1AR is mainly distributed in the heart where it is predominate (Brodde & Michel 1999). If the same PCR was run with RNA from liver or other tissues, the PCR would fail to yield any results because there are almost no β1ARs distributed in other tissues, and therefore no RNA neither.
Since the proposed project was not finished there is a big lack of results, still it would be interesting to follow up on some things. After completion of the proposed project it would be interesting to make a similar project but with a
myocyte cell culture instead of heart tissue to see what affect the
catecholamines have on the fetal heart during hypoxia. Perhaps it is more likely that there is an “upregulation” and an increase of mRNA levels for the β1AR in a cell culture where there is no increase of catecholamines due to the hypoxia. Also, it would be interesting to do an experiment where cell cultures constantly were stimulated by catecholamines, like the study Crossley et al. did in 2003, but with cell cultures instead of tissues.
It would be interesting to perform both of the suggested projects using a quantitative real time PCR (QRT-PCR) instead of the northern blot as the method of choice. A QRT-PCR could be used as the quantification method which would allow instant quantification of DNA, cDNA, or RNA templates (Fleige & Pfaffl 2006). However, since the QRT-PCR is based on the detection of a fluorescent reporter molecule that increases as the PCR product
accumulates with each cycle of amplification (Bustin & Mueller 2005), but it might not be as valid as the northern blot. Still, it could be of great advantage when doing a project like the proposed ones, since you would get the result of the quantification instantly. Also it would be interesting to compare the result of the QRT-PCR with the result achieved with a northern blot to see which method that gives the best results.
6 Acknowledgments
I would like to thank Kläckeribolaget AB in Väderstad for the kind donation of broiler eggs which made my project possible. Thanks to my supervisors
Assoc.Prof Jordi Altimiras and PhD student Isa Lindgren and also I would like to thank Prof. Stefan Thor and his research group for all the help with my experiments.
7 References
Ahlquist RP (1948) A study of the adrenotropic receptors. American Journal of Physiology 153:586-600.
Ambion protocol (2006). http://www.ambion.com/techlib/prot/bp_9738.pdf (23 Maj 2006).
Arch J (2004) Do low-affinity states of β adrenoceptors have roles in
Bernstein D, Voss E, Huang S, Rahul Doshi R & Crane C (1990) Differential regulation of right and left ventricular β-adrenergic receptors in newborn lambs with experimental cyanotic heart disease. Journal of Clinical Investigation 85:69-74.
Blast, National Center for Biotechnology Information (2006). http://www.ncbi.nlm.nih.gov/
Bristow M (1998) Why does the myocardium fail? Insights from basic science. Lancet 352:8-14.
Brodde O-E & Michel M (1999) Adrenergic and muscarinic receptors in the human heart. Pharmacological Reviews 51:651-689.
Bundkirchen A, Brixius K, Bolck B & Schwinger RH (2002) Bucindolol exerts agonistic activity on the propranololinsensitive state of β1-adrenoceptors in human myocardium. Journal of Pharmacology and Experimental
Therapeutics. 300:794-801.
Bustin S & Mueller R (2005) Real-time reverse transcription PCR (qRT-PCR) and its potential use in clinical diagnosis. Clinical Science 109:365-379. Communal C, Singh K, Sawyer DB & Colucci WS (1999) Opposing effects of
β1- and β2-adrenergic receptors on cardiac myocyte apoptosis: role of a pertussis toxin-sensitive G-protein. Circulation 100:2210-2212.
Crossley D II, Burggren W & Altimiras J (2003) Cardiovascular regulation during hypoxia in embryos of the domestic chicken Gallus gallus American Journal of Physiology. Regulatory, Integrative and Comparative Physiology 284: R219–R226.
Currie R (1999) Ascites in poultry: recent investigations. Avian Pathology 28:313-326
Emorine L, Marullo S, Briend-Sutren M, Patey G, Tate K, Delavier-Klutchko C & Strosberg D (1989) Molecular characterization of the human β3
-adrenergic receptor. Science 245:1118-1121. E.Z.N.A protocol (2006).
http://www.omegabiotek.com/productsrange/plasmiddnaisolation/plasmid %20PDF%20usermenul/Endo_free%20_Plasmid_%20Miniprep%20Kit.pd f (23 May 2006).
Feldman AM, Cates AE, Veazey WB, Hershberger RE, Bristow MR, Baughman KL, Baumgartner WA & Van Dop C (1988) Increase of the 40,000-mol wt pertussis toxin substrate (G protein) in the failing human heart. Journal of Clinical Investigation 82:189-197.
Fleige S & Pfaffl W (2006) RNA integrity and the effect on the real-time qRT-PCR performance. Molecular Aspects of Medicine 27:126-139.
Galitzky J, Langin D, Montastruc J-L, Lafontan M & Berlan M (1998) On the presence of a putative fourth β-adrenoceptor in human adipose tissue. Trends in Pharmacological Sciences 19:164-165.
Gauthier C, Leblais V, Kobzik L, Trochu J-N, Khandoudi N, Bril A, Balligand J-L & Le Marec H (1996) The negative inotropic effect of β3-adrenoceptor stimulation is mediated by activation of a nitric oxide synthase pathway in human ventricle. Journal of Clinical Investigation 7:1377-1384.
Gauthier C, Leblais V, Moniotte S, Langin D & Balligand J-L (2000) The negative inotropic action of catecholamines: Role of β3-adrenoceptors. Canadian Journal of Physiology and Pharmacology 78:681-690.
Granneman J (2001) The putative β4-adrenergic receptor is a novel state of the β1-adrenergic receptor. American Journal of Physiology 43:199-202. Hammond K, Roth D, Mckirnan D & Ping P (1993) Regional myocardial
downregulation of the inhibitory guanosine triphosphate-binding protein
(Gi 2) and ß-adrenergic receptors in a porcine model of chronic episodic
myocardial ischemia. Journal of Clinical Investigation 92:2644-2652. Harden K (1983) Agonist-induced desensitization of the β-adrenergic
receptor-linked adenylate cyclase. Pharmacological Reviews 35:5-32.
Haunstetter A & Izumo S (1998) Apoptosis: basic mechanisms and implications for cardiovascular disease. Circulation Research 82:1111-1129.
Hein L & Kobilka B (1997) Adrenergic receptors from molecular structure to in vivo function. Trends in Cardiovascular Medicine 7:137-145.
Invitrogen protocol (2006).
http://www.invitrogen.com/content/sfs/manuals/topota_man.pdf (23 May 2006).
Karliner J, Stevens M, Honbo N & Hoffman J (1989) Effects of acute ischemia in the dog on myocardial blood flow, ß-receptors, and adenylate cyclase activity with and without chronic beta blockade. Journal of Clinical Investigation 83:474-481.
Kacimi R, Richalet J-P, Corsin A, Abousahl I & Crozatier B (1992) Hypoxia-induced downregulation of ß-adrenergic receptors in rat heart. Journal of Applied Physiology 73:1377-1382.
Kaumann A (1997) Four β-adrenoceptor subtypes in the mammalian heart. Trends in Pharmacological Sciences 18:70-76.
Kaumann A, Engelhardt S, Hein L, Molenaar P & Lohse M (2001) Abolition of (-)-CGP 12177-evokedc ardiostimulation in double β1/β2-adrenoceptor knockout mice. Obligatory role of β1-adrenoceptors for putative β4 -adrenoceptor pharmacology. Naunyn-Schmiedeberg’s archives of pharmacology 363:87-93.
Kiuchi K, Shannon RP, Komamura K, Cohen DJ, Bianchi C, Homey CJ, Vatner SF & Vatner DE (1993) Myocardial beta-adrenergic receptor function during the development of pacing-induced heart failure. Journal of Clinical Investigation 91:907-914.
Lands AM, Arnold A, McAuliff JP, Luduena FP & Brown TG (1967)
Differentiation of receptor systems activated by sympathomimetic amines. Nature 214:597-598.
Lefkowitz R (1998) G Protein-coupled Receptors. Journal of Biological Chemestry 273:18677-18680.
Lefkowitz R (2004) Historical review: a brief history and personal retrospective of seven-transmembrane receptors. Trends in Pharmacological Sciences 25:413-422.
Leifert W, Aloia A, Bucco O, Glatz R & McMurchie E (2005) G-protein-coupled receptors in drug discovery: Nanosizing using cell-free
technologies and molecular biology approaches. Journal of Biomolecular Screening 10:765-779.
Leimbach W Jr, Wallin G, Victor R, Aylward P, Sundlöf G & Mark A (1986) Direct evidence from intraneural recordings for increased central
Li H-T, Long CS, Rokosh DG, Honbo NY & Karliner JS (1995) Chronic
hypoxia differentially regulates α1-adrenergic receptor subtype mRNAs and inhibits α1-adrenergic receptor–stimulated cardiac hypertrophy and
signaling. Circulation 92:918-925.
Lohse M, Engelhardt S & Eschenhagen T (2003) What is the role of β-adrenergic signaling in heart failure? Circulation Research 93:896-906. Mader S, Downing C & van Lunteren E (1991) Effect of age and hypoxia on
ß-adrenergic receptors in rat heart. Journal of Applied Physiology 71:2094-2098.
Metcalfe J, McCutcheon IE, Francisco DL, Metzenberg AB & Welch JE (1981). Oxygen availability and growth of the chick embryo. Respiration
Physiology 46:81-88.
Metcalfe J & Stock MK (1993) Current topic: oxygen exchange in the
chorioallantoic membrane, avian homologue of the mammalian placenta. Placenta 14:605-613.
Mulder ALM, van Golde JC, Prinzen FW & Blanco CE (1998) Cardiac output distribution in response to hypoxia in the chick embryo in the second half of the incubation time. Journal of Physiology 508:281-287.
Olivetti G, Abbi R, Quaini F, Kajstura J, Cheng W, Nitahara J, Quaini E, Di Loreto C, Beltrami C, Krajewski S, Reed J & Anversa P (1997) Apoptosis in the failing human heart. New England Journal of Medicine 336:1131-1141.
Ping P, Anzai T, Gao M & Hammond HK (1997) Adenylyl cyclase and G protein receptor kinase expression during development of heart failure. American Journal of Physiology 273:707-717.
Pitcher J, Freedman N & Lefkowitz R (1998) G protein-coupled receptor kinases. Annual Review of Biochemistry 67:653-692.
Pönicke K, Heinroth-Hoffmann I, Brodde O-E (2003) Role of β1- and β2-adrenoceptors in hypertrophic and apoptotic effects of noradrenaline and adrenaline in adult rat ventricular cardiomyocytes.
Queen LR & Ferro A (2006) β-adrenergic receptors and nitric oxide generation in the cardiovascular system. Cellular and Molecular Life Sciences (in press).
Roche protocol (2006). http://www.roche-applied-science.com/pack-insert/1745832a.pdf (23 May 2006)
Rockman H, Koch W & Lefkowitz R (2002) Seven-transmembrane-spanning receptors and heart function. Nature 415:206-212.
Seino S & Shibasaki T (2005) PKA-dependent and PKA-independent pathways for cAMP-regulated exocytosis. Physiological Review 85:1303-1342. Shizukuda Y & Buttrick PM (2002) Subtype specific roles of β-adrenergic
receptors in apoptosis of adult rat ventricularmyocytes. Journal of Molecular and Cellular Cardiology 34:823-831.
Steinberg SF (1999) The molecular basis for distinct β-adrenergic receptor subtype action in cardiomyocytes. Circulation Research 85:1101-1111. Strasser RH, Marquetant R & Kubler W (1990) Adrenergic receptors and
sensitization of adenylyl cyclase in acute myocardial ischemia. Circulation 82:23-29.
Susanni E, Manders T, Knight D, Vatner D, Vatner S & Homcy C (1989) One hour of myocardial ischemia decreases the activity of the stimulatory guanine-nucleotide regulatory protein Gs. Circulation Research 65:1145-1150.
Towbin JA & Bowles NE (2002) The failing heart. Nature 415:227-233. Voelkel N, Hegstrand L, Reeves J, McMurty I & Molinoff P (1981) Effects of
hypoxia on density of ß-adrenergic receptors. Journal of Applied Physiology 50:363-366.
Xiao R-P, Ji X & Lakatta EG (1995) Functional coupling of the
β2-adrenoceptor to a pertussis toxin-sensitive G protein in cardiac myocytes. Molecular Pharmacology 47:322-329.
Xiao R-P, Cheng H, Zhou YY, Kuschel M & Lakatta EG (1999) Recent advances in cardiac β2-adrenergic signal transduction. Circulation Research 85:1092-1100.
Xiao R-P, Zhang S-J, Chakir K, Avdonin P, Zhu W, Bond R, Balke W, Lakatta E & Cheng H (2003) Enhanced Gi signaling selectively negates
β2-adrenergic receptor (AR)- but not β1-AR-mediated positive inotropic effect in myocytes from failing rat hearts. Circulation 108:1633-1639.
Young L, Li J, Baron S & Russel R (2005) AMP activated protein kinase: a key stress signaling pathway in the heart. Trends in Cardiovascular Medicine 15:110-118.
Zhou Y-Y, Yang D, Zhu W-Z, Zhang S-J, Wang D-J, Rohrer D, Devic E,
Kobilka B, Lakatta E, Cheng H & Xiao R-P (2000) Spontaneous activation of β2- but not β1-adrenoceptors expressed in cardiac myocytes from β1β2 double knockout mice. Molecular Pharmacology 58:887-894.
Appendix A
DNA isolation (Milli Q H2O) Day1
1) Homogenize the liver from a broiler embryo in 1 ml homogenization buffer (50 mM Tris, 100 mM EDTA and 1% SDS).
2) Add 30 µl of 10 mg/ml solution of proteinase K in milli Q water. 3) Invert to mix and incubate over night at 55ºC.
Day2
4) Remove from 55ºC then add 25 µl of 10 mg/ml RNase A. 5) Incubate at 37ºC for 1 hour.
6) Add 50 µl Phenol and rotate for 20 min. 7) Spin in centrifuge for 10 min at 13 600g.
8) Transfer all of the aqueous phase plus interphase to a new tube. 9) Add 500 µl phenol/chloroform (1:1 v/v).
10) Rotate for 5 min and then spin for 5 min in centrifuge at 13 600g. 11) Transfer all of the aqueous phase plus interphase to a new tube. 12) Add 500 µl chisam.
13) Rotate for 5 min and then spin for 2 min in centrifuge at 13 600g. 14) Transfer the aqueous phase to a new tube.
15) Add 500 µl isopropanol, invert to mix.
16) Rotate for 5 min and spin in centrifuge for 5 min at 13 600g. 17) Remove the supernatant.
18) Add 500 µl of 70% ethanol. 19) Remove the ethanol
20) Add 500 µl of 100% ethanol. 21) Centrifuge for 2 min at 13 600g.
22) Remove the ethanol and air-dry the pellet.
Appendix B
The sequence inserted into the TOPO vector:
atcgagaccttgtgcgtcatcgccatcgaccgctacctggccatcacttcgcctttccgctaccagagcctgatgac cagggctcgggccaagggcatcatctgcaccgtctgggccatctccgccctggtctctttcctgcccatcatgatg cactggtggcgggacgaggaccctcaggcactcaagtgctaccaggacccgggctgctgcgacttcgtcacca accgggcttacgccatcgcttcgtccatcatctccttctacatccccctcctcatcatgatcttcgtgtacctgcgggt gtaccgggaggccaaggagcagatcaggaagatcgaccgctgcgagggccggttctatggcagccaggagc agccgcagccacccccgctcccccaccaacagcccatcctcggcaacggccgcgccagcaagaggaagacg tcccgtgtcatggccatgagggagcacaaagctctgaagacattgggtatcatcatgggggtgttcaccctctgct ggctccctttcttcttggtgaacgttgtcaacgtcttcaacagagacctggtgccggactggctctttgttttcttcaac tggttgggctacgccaactccgctttcaaccccatcatctactgccgcagcccggacttccgtaaggccttcaaga ggctgctctgctt
