Department of Physics, Chemistry and Biology
Final Thesis
Stress-induced alternative splicing of
Serine/Arginine-rich proteins in the moss
Physcomitrella patens
Jessica Olsen
LITH-IFM-A-EX--11/2444--SE
Supervisor: Johan Edqvist, Linköpings universitet
Examiner: Jordi Altimiras, Linköpings universitet
Linköpings universitet Institutionen för fysik, kemi och biologi 581 83 Linköping
Rapporttyp Report category Licentiatavhandling X Examensarbete C-uppsats D-uppsats Övrig rapport _______________ Språk Language Svenska/Swedish X Engelska/English ________________ Titel Title
Stress-induced alternative splicing of Serine/Arginine-rich proteins in the moss Physcomitrella patens
Författare
Author: Jessica Olsen
Sammanfattning
Abstract
Plants are sessile organisms and thus more exposed to stressful environments. By changing the expression of stress related genes, plants are able to cope with stress. Alternative splicing (AS) of pre-mRNA is a major contributor to proteome diversity in eukaryotes. It has been shown that different abiotic stresses affect AS patterns, suggesting a functional role of AS in stress tolerance. The Serine/Arginine-rich proteins (SR proteins) are a conserved family of splicing regulators in eukaryotes. SR proteins are essential for AS and studies have shown that they are themselves subjects to AS after stress exposure which means that they can control their own splicing. In this study, the aim was to characterize the different SR-proteins in the SR subfamily in P. patens, analyze their phylogeny and measure the change in expression of the genes after exposure to five types of stress; osmotic, salinity, dehydration, cold and hormonal. The result showed both individual and overlapping changes in their expression profiles of the three genes. Furthermore, there was an alteration in the alternative splicing pattern for two genes during three of the stresses which resulted in intron retention and possibly a premature termination codon and subseqent non-sense mediated decay.
ISBN
__________________________________________________ ISRN
__________________________________________________
Serietitel och serienummer ISSN
Title of series, numbering
LITH-IFM-A-Ex—11/2444--SE
Nyckelord
Keyword
Alternative splicing, Physcomitrella patens, Serine/Arginine-rich proteins, Stress
Datum
Date
2011-06-03
URL för elektronisk version
Avdelning, Institution Division, Department
1 Contents
1. Abstract ... 1
2. List of abbreviations ... 1
3. Introduction ... 1
4. Materials and methods ... 3
4.1 Identifying SR-proteins ... 3 4.2 Phylogenetic analysis ... 3 4.2.1 Databases ... 3 4.2.2 Phylogenetic Analysis ... 4 4.3 Expression analysis ... 4 4.3.1 Growing P. patens ... 4 4.3.2 Primer construction ... 4 4.3.3. Stress conditions ... 5 4.3.4 RNA isolation ... 6
4.3.5 cDNA synthesis and amplification ... 6
4.3.6 Expression analysis and AS ratio ... 6
4.3.7 Statistics ... 6 4.3.8 Sequencing ... 6 5. Results ... 6 5.1 SR-protein identification ... 6 5.2 Phylogeny ... 7 5.3 Expression analysis ... 11 5.4 Alternative splicing ... 12
5.4.1 Alternative splicing expression ... 12
5.4.2 Sequencing of AS products ... 12
6. Discussion ... 14
6.1 Identification ... 14
6.2 Phylogeny ... 15
6.3 Expression analysis and alternative splicing ... 15
6.4 Conclusion ... 16
7. Acknowledgements ... 17
1 1. Abstract
Plants are sessile organisms and thus more exposed to stressful environments. By changing the expression of stress related genes, plants are able to cope with stress. Alternative splicing (AS) of pre-mRNA is a major contributor to proteome diversity in eukaryotes. It has been shown that different abiotic stresses affect AS patterns, suggesting a functional role of AS in stress tolerance. The Serine/Arginine-rich proteins (SR proteins) are a conserved family of splicing regulators in eukaryotes. SR proteins are essential for AS and studies have shown that they are themselves subjects to AS after stress exposure which means that they can control their own splicing. In this study, the aim was to characterize the different SR-proteins in the SR subfamily in P. patens, analyze their phylogeny and measure the change in expression of the genes after exposure to five types of stress; osmotic, salinity, dehydration, cold and hormonal. The result showed both individual and overlapping changes in their expression profiles of the three genes. Furthermore, there was an alteration in the alternative splicing pattern for two genes during three of the stresses which resulted in intron retention and possibly a premature termination codon and subseqent non-sense mediated decay.
Keywords:
Alternative splicing, Physcomitrella patens, Serine/Arginine-rich proteins, Stress
2. List of abbreviations
Abscisic acid - ABA Alternative splicing - AS
Basic Local Alignment Search Tool - BLAST
Complementary DNA - cDNA Constitutive splicing - CS Expressed sequence tags - EST Growth chamber - G.C
Nonsense-mediated decay - NMD
Polymerase Chain Reaction - PCR Premature termination codon - PTC Regulated unproductive splicing and translating - RUST
Reverse transcriptase PCR - RT-PCR RNA recognition motif - RRM
Room temperature - RT
Serine/arginine-rich protein - SR-protein
3. Introduction
Plants are sessile organisms and thus more exposed to stressful environments. They need to be able to protect themselves from different types of biotic and abiotic stresses like cold, drought, salinity, UV radiation and bacterial/fungal diseases. When plants are exposed to stress, different signaling cascades and pathways are activated which can alter plant growth and physiology and thus sustaining stress better (Zeller et al., 2009). The result of these pathways is an altered expression of stress-responsive genes which encodes proteins that are involved in the synthesis of for instance hormones like abscisic acid (ABA), which will act like a signaling molecule and spread the stress signal (Zeller et al., 2009). ABA has shown to be responsive to environmental stress conditions. However, different types of stresses have shown to be both ABA-dependent and ABA-independent (Thomashow, 1999). The
2
transcription factor DREB2 in wheat has for instance shown to be ABA dependent for dehydration and NaCl stresses but ABA independent for cold stress. By mediating these signaling pathways and changing expression of stress tolerant genes the plants are able to protect themselves and react to survive. Understanding the effect of stress in plants is particular important for crop improvement. Drought and salinity are a major problem for crop cultivation (Denby and Gehring, 2005) and the primary cause of crop loss worldwide (Kreps et al., 2002).
Environmental stresses do not only affect expression levels of genes, it also influence splicing or in this case; alternative splicing (AS). Splicing is the process in which introns are removed from the pre-mRNA. Introns are, in contrast to exons, non-coding sequences in the genome (Sharp and Burge, 1997). They are present in most eukaryotic genes and in some cases even in tRNA of some prokaryotes. Splicing of mRNA is catalyzed by a spliceosome, a complex consisting of several different units, small nuclear ribonucleoproteins, which removes the introns in several different steps (Sharp and Burge, 1997; Zhou et al., 2000).
The most common type of splicing is constitutive splicing (CS). In CS all the introns are removed leaving only the exons for translation, however, in some cases can AS occur. There are five different types of AS; intron retention, alternative donor site, alternative acceptor site, exon skipping and mutually exclusive exons. The most common type of AS in animals is exon skipping while in plant, intron retention occurs more often. Still, several different splicing models can occur in one gene (Xiao-Qin et al., 2007).
Alternative splicing is important because it provides proteome diversity in eukaryotes (Graveley, 2001; Manley and Tacke, 1996). Studies have shown that as much as 74 % of all genes in the human genome undergo alternative splicing (Johnson et al., 2003). It is believed that alternative splicing in plants are much less common. In 2009 Filichkin et al., reported, after having used the Illumina RNA-seq approach to catalog splicing in the plant Arabidopsis thaliana, that at least 42% of all the A. thaliana genes that contained introns are alternative spliced. When a protein undergoes AS and intron retention many of the alternatively spliced transcripts consist of a premature termination codon (PTC) (Palusa et al., 2007) and these PTC transcripts will be targeted for degradation through nonsense-mediated mRNA decay (NMD). NMD is a regulated unproductive splicing and translating (RUST) mechanism (Lewis et al., 2003) and in 2009, Filichkin et al.,. showed how abiotic stress could result in nonfunctional isoforms and could thereby draw the conclusion that RUST play a role in the regulation of gene expression in plants. In 2010, Palusa and Reddy demonstrated that almost 50% of all splice variants of Serine/Arginine rich proteins (SR-proteins) in A. thaliana with a PTC were degraded by NMD, proving that this is an important regulation mechanism in plants (Lareau et al., 2007). By insertion of introns into the new splice variants the PTC isoforms will function as a negative feedbacks loop that will regulate the production of SR-protein (Ni et al., 2007).
While studying A. thaliana, Iida et al., (2004) noticed how the splicing profiles changed after exposure of environmental stresses, especially when the plants were exposed to cold and heat treatment. This was also seen by Tanabe et al., (2006) and Paulusa et al. (2007). Both of them were studying SR-proteins in A. thaliana and reported that these SR-proteins were alternative spliced after exposure to stress. Tanabe et al. (2006) suggested that this must be a regulatory mechanism for these SR-proteins.
The SR-proteins are a conserved family of splicing regulators in eukaryotes (Lopato et al., 1999). They consist of at least one RNA recognition motif (RRM) and a SR region in the end of the gene which is rich in serine and arginine dipeptides (Wu and Maniatis, 1993; Manley and Tacke, 1996; Kalyna and Barta, 2004). SR-proteins have been divided into different subfamilies and in plants one of those families are the SR subfamily which contains two RRM
3
doamins; RRM1 and ψRRM. The ψRRM domain has a conserved heptapeptide which consist of the sequence SWQDLKD and this motif is important for selection of the splice site (Dauksaite and Akusjarvi 2004). SR-proteins have a function in both CS and AS. The proteins affect splicing by interacting with RNA sequences, like exonic splicing enhancers (Barta et al. 2008) and this interaction promotes pre-spliceosomal assembly (Shen et al., 2004). The transcripts encoding SR-proteins are also alternatively spliced and they can control their own splicing, which has been seen in both mammals and plants. Studies have shown that when genes encoding SR-proteins are mutated the expression and splicing pattern of SR-proteins change change (Ali et al., 2007; Reddy, 2007). In 2007 Palusa et al. showed that when A. thaliana were exposed to abiotic stress the expression of SR genes changed which resulted in a dramatically altered AS of the pre-mRNAs. These results indicate that the production of alternately spliced SR-protein transcripts is regulated by stress possibly by autoregulation. (Lopato et al., 1999). An evolutionary study of SR-proteins, from protist to mammalian origin, showed that the SR gene family has evolved by several gene duplications and that positive selection has diversified the SR family (Escobar et al., 2006).
A mapping of the AS in the plants A. thaliana and Oryza sativa has started but the AS events in the moss Physcomitrella patens is still unknown. P. patens separated from flowering plants and unicellular aquatic algae for more than 400 million years ago (Rensing et al., 2008) P. patens is believed to be able to reveal evolutionary changes associated with plant transitioning to land. This makes this moss a perfect tool for studies of plant evolution and complex biological processes (Cove et al., 1997; Reski, 1998; Wood, 2000; Cove et al., 2006). The genome of P. patens was completely sequenced in 2006 and there are several hundred thousands of EST-sequences for P. patens (Rensing et al., 2008).
In this study, the aim was to characterize the different SR-proteins in the SR subfamily in P. patens, analyze their phylogeny and measure the change in expression of the genes after exposure to five types of stress; osmotic, salinity, dehydration, cold and hormonal. The result showed both individual and overlapping changes in their expression profiles for the three genes. Furthermore, there was an alteration in the alternative splicing pattern for two genes during three of the stresses which resulted in intron retention and possibly PTC.
4. Materials and methods 4.1 Identifying SR-proteins
To identify the SR-proteins in Physcomitrella patens, the Arabidopsis thaliana proteins in the subgroup SR subfamily defined by Barta et al., (2010) were blasted using BLASTp (Altschul et al., 1997) from National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov) against the sequenced genome of P. patens. All settings were default except the e-value which was limited to e-20. To qualify as a SR-protein and be selected, the proteins needed to have the characteristic SR domain of at least 50 amino acids, a minimum of 20% SR dipeptides (Barta et al., 2010) and two RNA recognition motifs (RRM), one in the N-terminal end (RRM1) and one in the middle of the protein (ψRRM). The molecular weights were calculated for each of the P. patens proteins using the Compute pI/mW program at ExPASy (Bjellqvist et al., 1993).
4.2 Phylogenetic analysis 4.2.1 Databases
The sequences for the phylogenetic analysis were selected using the same approach as in 4.1. SR-proteins from Physcomitrella patens, Selaginella moellendorffii, Oryza sativa and
4
Clamydomonas reinhardtii were found using Blastp (Altschul et al., 1997) with the SR subfamily from Arabidopsis thaliana (Barta et al., 2010) as queries. All settings were default, except for the e-value that was set to e-20.
All sequences from A. thalianawere found in TAIR, all sequence for O. sativa in TIGR, Phytozome (http://www.phytozome.net/) were used for P. patens and National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/) for S. moellendorffii and C. reinhardtii. Each BLASTp was performed against each organisms genome. The following accession numbers were found:
A. thaliana: At1g09140 (AtSR30), At1g02840 (AtSR34), At3g49430 (AtSR34a) and At4g02430 (AtSR34b). P. patens: Phypa_140978, Phypa_113630 and Phypa_205547. S. moellendorffii: SELMO_107678 and SELMO_119951. O. sativa: Os07g47630 (OsSR33), Os03g22380 (OsSR32), Os05g30140 (OsSR33a) and Os01g21420 (OsSR40). C. reinhardtii: CHLRE_195847 and CHLRE_195849.
4.2.2 Phylogenetic Analysis
A phylogenetic analysis was performed for the SR-proteins and for the RRM domains. All the RRM domains from the SR-proteins of A. thaliana, P. patens, O. sativa, S. moellendorffii and C. reinhardtii were found using PROSITE (Sigrist et al., 2010).
First a multiple alignment was performed using ClustalW2 - Multiple Sequence Alignment (Chenna et al., 2003). FASTA sequences were used and all settings were default except for the format which was changed to PHYLIP multiple alignment format. The alignment data was then used in the following steps.
First a neighbor joining analysis (Saitou and Nei, 1987) was performed using Phylip v3.69 (Felsenstein 1989). The different Phylip programs were used in following order: Seqboot, Protdist, Neighbor and Consense. All settings were left default except for multiple datasets which were set to 100 replicates. The neighbor joining tree was viewed in FigTree v1.3.1.
PhyML v3.0 (Guindon et al., 2003) was used to make a maximum likelihood analysis. All settings were used as default except for the bootstrap value which was set to 100. The tree was viewed in FigTree v1.3.1.
4.3 Expression analysis 4.3.1 Growing P. patens
P. patens was grown on plates containing modified BCD media (Ashton and Cove, 1977) in 24 light hours, 25 °C and continuous photosynthetic photon flux of 155 µmoles/m2/sec, which was used as standard conditions during the experiments. The BCD media was supplemented with CaCl2 (1 mM) and ammonium tartrate (5 mM). 1 % plant agar (Sigma) was used. Plates with the moss were sealed (Parafilm M Laboratory Film and 3M Micropore Medical Tape) and placed in the growth chamber (CU-36L/5 CLF Plant Climatics).
4.3.2 Primer construction
A set of primers was designed to amplify the cDNA in the RT-PCR reaction (Tab. 1, Fig. 1) to measure the basal expression of the genes. The primers were selected on the basis of the expressed sequence tags which were identified in public databases. The primer pairs were selected to amplify PCR products spanning several exons in order to increase the possibilities to detect alternative splicing events.
5
Table 1. Primers used in this study. Primer design for forward and reverse primer for all three P. patens genes
and for the reference gene Beta-tubuilin 1.
PRIMERS
Accession Organism Forward (5’ to 3’) Reverse (5' to 3') Amplicon size
PpSR40 P. patens Forward: AGAACTCGAGAACCCATCGAAA CCAGCACGAT Reverse: GTCCACGATGCCCATTGTTCCC 531 bp PpSR36 P. patens Forward: TAAGCTCGAGAGACGATATTGT AACCAGCACA Reverse GGCGTATTTCATATCGTCGTAG 569 bp PpSR39 P. patens Forward: GGAACTCGAGGTTGCTTATCAC ATTCAACAAC Reverse: TTCCAGCTGAGCCATCACGAAA 522 bp
Beta-tubuilin 1 P. patens Forward:
GACTGCTTGCAAGGTTTCCAAG
Reverse:
TTTAGCTGCCCAGGGAATCGGA
359 bp
4.3.3. Stress conditions
Three weeks old P. patens were exposed for various abiotic stresses and used for RNA extraction. The selected stress treatments were; cold, dehydration, NaCl stress, osmotic stress and hormone stress (ABA). Cold and dehydration treatments were performed on solid modified BCD medium (see 4.3.1) while the NaCl, osmotic and hormone treatments were performed in liquid modified BCD medium (see 4.3.1). Two unstressed controls were used; one control that was grown on solid BCD medium and the second one was grown on solid medium for 3 weeks and then transferred into liquid BCD medium for 24 hours. Time, conditions and concentrations are shown in Table 2.
Table 2. Stress types, growth conditions and incubation times for the expression analysis.
Stress types and conditions
Stress type Plate/liquid medium Time Concentration Environment
Freezing plate 24 h On ice in room with RT of 5°C
Dehydration plate 24 h Without lid in G.C
plate 48 h Without lid in G.C
NaCl liquid 1 h 300 mM On shaker (150 rpm) in G.C
liquid 4 h 300 mM On shaker (150 rpm) in G.C
liquid 1 h 500 mM On shaker (150 rpm) in G.C
liquid 4 h 500 mM On shaker (150 rpm) in G.C
Mannitol liquid 1 h 600 mM On shaker (150 rpm) in G.C
liquid 4 h 600 mM On shaker (150 rpm) in G.C
ABA liquid 24 h 50 µM On shaker (150 rpm) in G.C
Control (plate) plate G.C
Control (liquid) liquid On shaker (150 rpm) in G.C
6 4.3.4 RNA isolation
RNA was extracted from three replicates of each stress treatment and the two controls using liquid nitrogen and RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) according to protocol from the manufacturer. All samples were DNase I treated using DNase I, RNase-free (Fermentas).
4.3.5 cDNA synthesis and amplification
The cDNA synthesis was carried out using random hexamer primers for first strand cDNA synthesis and RevertAid H-minus Reverse Transcriptase (Fermentas) according to protocol.
One µg of cDNA template were used in the RT-PCR using forward and reverse primers for PpSR40, PpSR36 and PpSR39 (Tab. 1). P. patens Beta-tubuilin 1 was used as a reference gene (Holm et al., 2010). To be able to visualize the low concentration of PpSR36 in control (s), NaCl 500 mM (4 h), mannitol (1 h) and mannitol (4 h) a double amount of the template, two µg, were used and then normalized according to that. DreamTaq™ DNA Polymerase (Fermentas) were used according to protocol and the PCR settings were: 3 min at 94°C; 35 cycles of 30 sec at 94°C, 30 sec at 55°C, 1 min at 72°C; and 7 min at 72°C. A 1.2% agarose gel was used to visualize the PCR-products together with GeneRuler™ 1 kb DNA Ladder (Fermentas). All gels were run for 120 minutes on 110 volt in 0,5x TBE.
4.3.6 Expression analysis and AS ratio
The gel images from the RT-PCR experiments were analyzed using the program Image J 1.43u (Abramoff et al., 2004). All expression values from each replicates were normalized against the reference gene. Expression of replicates that did not show natural variance was sorted out. These measurements were selected if one of the three replicates expressions were twice as high or half as low as the other two.
The expression of each PCR product and their AS products were measured. A ratio between the expression of all gene products and their AS product was calculated and the mean values of all three replicates were plotted in a graph. The expression of all gene products were set to 1 and the expression of their AS product in relation to that.
4.3.7 Statistics
A one way ANOVA followed by Tukey test in Minitab v.16 (Meyer et al., 2004) was used to calculate if there is a significant change in the normalized expression between the controls and the different treatments in all three genes.
4.3.8 Sequencing
All PCR-products from the gel were cut out and DNA was extracted by using the GeneJET™ Gel Extraction Kit (Fermentas). Each eluted template was then purified using GeneJET™ PCR Purification Kit (Fermentas). The extracted DNA fragments were sequenced by Eurofins MWG Sequencing, Germany.
5. Results
5.1 SR-protein identification
To identify the SR-proteins belonging to the SR subfamily in P. patens the SR-proteins of A. thaliana (AtSR30 AtSR34, AtSR34a and AtSR34b) were used as queries in a BLASTp search (Altschul et al.,. 1997) using the database of Phytozome v7.0 (http://www.phytozome.net/). Three proteins were found and all three proteins had the characteristic arginine and serine rich
7
region (SR domain) and were therefore selected. The three proteins have the following accession numbers; Phypa_205547, Phypa_140978 and Phypa_113630 (Fig. 1).
All three proteins consist of two RNA recognition motifs (RRM), one in the N-terminal end (RRM1) and the other in the middle of the protein (ψRRM). All three proteins did also have a SR region in the C-terminal. Phypa_205547 consist of 13 exons and 12 introns and is 1068 bp long, from start codon until stop codon, Phypa_140978 has 14 exons and 13 introns and is 1002 bp long from start to stop while Phypa_113630 is 1050 bp long from start to stop and consist of 13 exons and 12 introns. The molecular mass of the proteins were 40 kDa, 36 kDa and 39 kDa, respectively.
The new nomenclature of the proteins is consistent with the method used by Barta et al., (2010). The first components is the Latin binomial of the species (P. patens: Pp), the second is the abbreviation of the sub family (SR subfamily: SR) and the last component is the molecular weight of the longest protein isoforms (kDa). The new nomenclature of the proteins were therefore: PpSR40 (Phypa_206647), PpSR36 (Phypa_140978) and PpSR39 (Phypa_113630).
Figure 1. A schematic picture of the genes PpSR40 (A), PpSR36 (B) and PpSR39 (C). The light grey boxes indicate
the exons while the black lines indicate the introns. The dotted grey lines show the positions of the RRM encoded characteristic domains. The SR region in the C-terminal end of the proteins is positioned within the marked area. The positions of the primers are shown by the small arrows, showing each amplicon.
5.2 Phylogeny
All proteins in the SR subfamily has a ψRRM domain which consist of a seven amino acid conserved region; SWQDLKD (Barta et al., 2010). This region can be used to identify proteins in this family. An alignment was performed with all sequences from P. patens, A. thaliana, O. sativa, S. moellendorffii and C. reinhartii and the alignment (Fig. 2) showed this conserved region.
8
Figure 2. Alignment of ψRRM domains from plant SR proteins. The presence of the conserved motif
SWQDLKD shows that the proteins belong to the SR subfamily of plant SR proteins. At=A. thaliana, Pp=P.
patens, Sm=S. moellendorffii, Os=O. sativa and Cr=C. reinhardtii.
The phylogenetic analysis of the SR subfamily proteins in A. thaliana, P. patens, O. sativa, S. moellendorffii and C. reinhardtii resulted in two phylogenetic trees with bootstrap values; one neighbor joining tree (Fig. 3A) and one tree showing maximum likelihood (Fig. 3B). These plants were selected because of their wide complex diversity in the plant kingdom. By selecting these plants the phylogenetic analysis would have a broad ranging from simple algae (C. reinhardtii), mosses (P. paten) and early diverged vascular plants (S. moellendorffii) to monocot and dicot flowering plants (A. thaliana).
Both the neighbor joining tree (Fig. 3A) and the maximum likelihood tree (Fig. 3B) suggest that the three P. patens genes are more closely related with each other than with all the other SR-proteins. The gene family in mosses seems to have their origin in two duplications occurring after the divergence from the other plants. A trend is seen in both trees which show that all organisms seem to be clustered together. Except from A. thaliana in both figure 3A and 3B were three of the four A. thaliana SR subfamily proteins seem to have evolved separately from the last and forth (AtSR34a). These results are confirmed with relatively high bootstrap values.
A phylogenetic analysis was also performed on a RRM domain level. A neighbor joining tree and a maximum likelihood tree was used once again but this time the sequences from the RRM and ψ RRM domains were used and the SR domains were excluded (Fig. 4A+B).
The neighbor joining tree (Fig. 4A) of RRM1 and ψRRM divided the two different RRM domains into two clades for each of the domains.
The maximum likelihood analysis (Fig. 4B) for the RRM and ψRRM sequenced also showed a division of the two RRM domains supported with high bootstrap values. Once again were all sequences for each RRM clustered together. The tree shows that RRM and ψRRM has evidently different evolutionary origin.
9
Figure 3. A) An unrooted neighbor joining tree of SR-proteins in plants. B) An unrooted maximun likelihood tree
of SR-proteins in plants. Numbers at the nodes are the percentage of 100 bootstrap resamplings that support the topology, in both trees, bootstrap values above 50 are presented. At=A. thaliana, Pp=P. patens, SELMO=S.
10
Figure 4. A) An unrooted neighbor joining tree of RRM1 and ψRRM for SR-protein proteins in plants. B) An
unrooted maximum likelihood of RRM1 and ψRRM for SR-protein proteins in plants. Numbers at the nodes are the percentage of 100 bootstrap resamplings that support the topology. In both trees, bootstrap values above 50 are presented. R1=RRM1, R2=ψ RRM. At=A. thaliana, Pp=P. patens, Sm=S. moellendorffii, Os=O. sativa and Cr=C. reinhardtii
11 5.3 Expression analysis
To examine the expression of each gene during normal and stress conditions an expression analysis was performed using RT-PCR. RT-PCR was used since the method gave possibilities to straight forward detection of AS-products.
Figure 5 shows the normalized fold change expression for PpSR40 (5A), PpSR36 (5B) and PpSR39 (5C) after exposure to 50 µM of ABA, 600 mM mannitol (1 and 4 hours), 300 mM NaCl (1 and 4 hours), 500 mM NaCl (1 and 4 hours), 24 hours cold and 24 and 48 hours of dehydration. There were significant (p>0.05) increases for PpSR40 (Fig. 5A) after treatments of 300 mM NaCl (4 h), 500 mM NaCl (4 h) and cold. Both 300 mM NaCl (1 h) and 500 mM NaCl (1h) showed significant decrease (p>0.01 and p>0.05 respectively). All treatments significant altered the expression of PpSR39 (Fig. 5B), however only 300 mM NaCl (4 h), cold and dehydration (24 and 48 h) increased the expression compared to the control. Result from PpSR39 (Fig. 5C) only show a significant increase (p>0.01) in the expression after cold treatment while both mannitol treatments, 300 mM NaCl (1 h) and 500 mM NaCl (1 h) were significant (p>0.05) decreased when compared to the control.
12
Figure 5. RT-PCR analysis of the expression of PpSR40 (A), PpSR36 (B) and PpSR39 (C) after treatment with to 50
µM of ABA, 600 mM mannitol (1 and 4 hours), 300 mM NaCl (1 and 4 hours), 500 mM NaCl (1 and 4 hours), 24 hours cold and 24 and 48 hours of dehydration. Three biological replicates were analyzed for each stress treatment. The density of the PCR product bands from RT-PCR was measured by ImageJ with normalization against beta-tubulin bands. Data are presented as means ± SD fold-change. A one-way ANOVA (N=3) and Tukey and Fisher method post-hoc analysis has been used. P-values are indicated with: *=0.05, **=0.01 and ***=0.001.
5.4 Alternative splicing
5.4.1 Alternative splicing expression
Alternative splicing was seen in PpSR40 and PpSR36 after four different treatments: 300 mM Nacl 4 h, cold, and dehydration 24 h and 48 h (Fig. 6A). These indications of splicing was not visible in the control. For PpSR40 one additional PCR-product is visible at approximate 630 bp.
For PpSR36 two additional PCR-products are shown, one at approximate 670 bp and one at 770 bp. Figure 6B shows the expression ratio of the AS products. These products expression are measured in contrast to their respective CS product. The expression of all CS products were set to 1 and the expression of the AS product in relation to that. The ratio is higher for dehydration treatment of PpSR40 after 48 hours then after only 24 hours. The 770 bp product for cold stress and dehydration 24 h have a lower ratio then their respective 670 bp product in PpSR36.
5.4.2 Sequencing of AS products
All AS products shown on the gel in figure 6A were sequenced by Eurofins MWG Sequencing, Germany. However, results were only obtained for the AS product in PpSR40 at 630 bp. Results from the sequencing are shown in figure 7. The result from the electropherogram (Fig. 7A) for the 630 bp AS product showed a sign of intron retention. At base pair 380 the electropherogram suddenly show a sign of two PCR products, most likely the CS and the AS product. This occurs at the exact location of the start of the first intron, thus suggesting intron retention. A schematic picture of this is seen in figure 7B showing the constitutive spliced and the alternative spliced PpSR40 with the retained intron.
A translation of the nucleotide sequence, containing all the exons and intron number 1 of PpSR40, to a protein sequence results in a stop codon 92 bp downstream from the start codon (Fig. 7C). This result suggests a premature termination codon (PTC).
13
Figure 6. Relative levels of alternative splicing of PpSR40 and PpSR36 during stress treatments. A)
A gel electrophoresis picture over alternative splicing products after NaCl 300 mM (4h), Cold (24h), and dehydration (24h + 48h). Arrows indicates the AS products, one product is visualized for PpSR40 and two products for PpSR36. B) Alternative splicing ratio. The expression of all gene products were set to 1 and the expression of the AS product in relation to that. Data are presented as means ± SD fold-change.
14
Figur 7. A) The figure shows an electropherogram from the sequencing analysis of the approximate 630 bp AS
product after cold treatment (24 h). The arrow indicates at which location two PCR products can be seen. This is at the exact location as where the first intron is located in PpSR40. B) Schematic picture of the CS product of PpSR40 and the AS product after stress treatment. C) Translation of exon 1 and intron 1 for PpSR40. Grey area indicate the exon while the black area indicates intron 1. The arrow shows where the premature stop codon would be located after intron retention.
6. Discussion
In this study Serine/Arginine-rich proteins from the SR subfamily of Physcomitrella patens were identified. First these proteins were phylogenetic analyzed, then their expression after stress exposure were measured and lastly their splicing profiles were examined. The results showed that there are three SR subfamily proteins, PpSR40, PpSR36 and PpSR39. The SR protein gene family in P. patens is the result of two gene duplications. These proteins changed most of their expression patterns after stress treatments and two of the three proteins, PpSR40 and PpSR36, went through alternative splicing after four of the chosen stress treatments.
6.1 Identification
All these proteins showed a similar exon and intron organization and localization of the two characteristic RRM domains and the SR region. However, even though these three proteins show similarities in their structure, the diversities in their sequences make it possible for more potential substrates. SR-proteins and isoforms with only small sequence differences can have different functions. Zhang and Mount demonstrated in 2009 the two SR-proteins with a difference of eight amino acids could have distinct biological functions. This suggests that SR proteins, even though they have similar sequence structure, can have different roles for the plant.
15 6.2 Phylogeny
The phylogenetic analysis of the SR-proteins in P. patens showed that they are more closely related to each other than to other SR-proteins in plants. The phylogenetic study also showed that the SR-proteins from all plants have the tendency to be clustered together, indicating that the gene families have evolved independently in each organism. All three genes in P. patens seem to have evolved from two duplications after the mosses diverged from the other plants. Escobar et al., analyzed, in 2006, 24 SR sequences of protist to mammalian origin and their phylogenetic analysis suggested that the SR family has evolved by several duplicated events and that this is a result of positive selection. By analyzing the phylogeny of the five chosen plant organisms (A. thaliana, P. patens, S. moellendorffii, O.sativa and C. reinhardtii) one cannot draw any conclusion of which proteins that show more similar functions between the organisms because of their independent separation, however, in 2004, Kalyna and Barta showed how the duplicated genes in A. thaliana had different expression patterns which indicated functional diversification. These results suggest that the different SR-proteins in these five plant organism may have different function although most of them, not only the proteins belonging to P. patens, are the result from gene duplication.
It is also interesting to see the division of the two RRM domains (RRM1 and ψRRM). By looking at these two motifs in both a neighbor joining tree and a most likelihood tree one can clearly see how these are divided into two separate groups indicating that they have different evolutionary origin which suggests two different functions of these domains. This is in agreement with other studies of SR-proteins and their RRM domains (Caceres et al.,., 1997). It has been proven that both RRM domains are important for interaction with the RNA, however, Caceres et al., (1997) showed that the ψRRM also has an important role in the specificity of AS.
6.3 Expression analysis and alternative splicing
The results from the expression analysis showed that the alterations of expression after stress treatments for each of the genes are individual but with some overlapping patterns and these results were in agreement with similar studies (Tanabe et al., 2006).
Lopato et al. (1999) analyzed the expression change in A. thaliana SR-proteins, AtSR30 and AtSR45a, and found that when these genes were treated with NaCl there was an increase in the transcription level of AtSR30 but no alterations were observed in AtSR45a. The same genes were also exposed to treatments with low temperatures which suppressed both of the genes. Similar results were also seen in 2006 when Tanabe et al. analyzed two other SR-proteins in A. thaliana and concluded that, when exposed to stress, these SR-proteins show both overlapping and non overlapping expression patterns. By comparing their results with the results from P. patens SR-proteins in lower plants seem to function similar to those in higher plants.
Not unexpectedly, the results from the expression analysis showed an alteration in the alternative splicing pattern. These results are in agreement with most studies performed on SR-proteins in A. thaliana. Paulsa et al. (2007) analyzed all 19 A. thaliana SR genes and studied their splicing patterns. They could see that different stress treatments affected different genes and thus changing their splicing patterns. They suggested that this must be a regulation mechanism for stress responsive gene by alternative splicing at transcription level.
A correlation between high expression and alternative splicing in response to stress treatment has been established for most SR proteins (Paulsa et al., 2007; Tanebe et al., 2006). Taking this in consideration, a result of higher expression in one of the SR genes after stress exposure should also show an alternative splicing product.
16
PpSR40 and PpSR36 show a significant higher expression after treatment of three respectively four stress types, however, this is not completely correlated with their change in splicing patterns. An alternative splicing product is detected for both dehydration treatments for PpSR40. However none of these treatments were shown to alter the expression. In PpSR36 high expression but no alteration of splicing patterns were seen in dehydration treatments. When exposed to NaCl (300 mM, 4h) and cold treatment PpSR40 and PpSR36 had two alternative splicing products. Previously a correlation between high expression and alternative splicing were established and NaCl and cold are the only treatments that show this correlation. In the other stress treatments there was no clear correlation indication that alternative splicing is stress determined rather than high expression.
These results are also seen in PpSR39. Here there is no sign of alternative splicing at all even though there is a significant higher expression after exposure of the cold treatment. This can however also be an indication that PpSR39, in contrast to the other two proteins, might not self regulate itself by alternative splicing. However, to draw such a conclusion more studies need to be made and the regulation of these SR-proteins need to be more closely studied.
Furthermore, as mentioned before, the results from the expression studies show that all these genes respond differently on these treatments. Some responses are similar but most of them are independent. This is an indication that these three duplicated P. patens SR-proteins, just as the SR-proteins studied in A. thaliana (Kalyna and Barta, 2004), have different functions.
Sequencing data for the alternative splicing products were only successful for the product shown on PpSR40 after cold treatment. However, all AS products for PpSR40 seemed to be the same size which indicates that they are the same product and that different stress treatments results in one type of AS products and not four different. The result of the product from PpSR40 shows that the first intron was retained in the pre-mRNA which resulted in a premature termination codon (PTC). The most common alternative splicing event in A. thaliana and O. sativa have shown to be intron retention (41 % and 33 % respectively) (Wang and Brendel 2006). It is also common that overexpressed SR-proteins that result in AS goes through NMD (Lopato et al., 1999; Palusa and Reddy 2010). When analyzing NMD in SR-proteins in A. thaliana seedlings, 74% of all SR subfamily SR-proteins that were alternative spliced had PTC and went through NMD (Palusa and Reddy 2010).
It would however been interesting to see if this result was the same for PpSR36. Unfortunately, none of the sequencing result showed anything so one can only guess that because of what has been shown before, and because of the increased size of the AS product, intron retention is the most probably cause which most likely had resulted in a PTC (Palusa and Reddy, 2010).
6.4 Conclusion
To conclude this study showed that the SR-proteins in the SR subfamily of P. patens in most cases correlate with result of the same proteins in A. thaliana. This suggests that these proteins may have different functions but with some overlap and furthermore, that they may function similar to SR-proteins in later diverging plants. Although, to understand the alternative splicing mechanisms behind each SR-protein in more detail and to understand its importance both overexpression and knockout approaches will be needed in future studies. The correlation between high expression and AS where not as clear in P. patens as for A. thaliana this might be because the regulatory mechanism of these SR-proteins is not as refined in these early diverging plants. But, studies in other mosses like S. moellendorffii and Marchantia polymorpha or green algae would be necessary to say something definite.
17 7. Acknowledgements
Many thanks to my supervisor Johan Edqvist for all great support and to Andreas Ring for all the help and contribution to the discussions of my results. I will also thank Monika Edstam for pictures and help in the lab.
8. Reference
Abramoff, M.D., Magelhaes, P.J., and Ram, S.J. (2004). Image Processing with ImageJ. Biophotonics International 11, 36-42.
Ali, G.S., Palusa, S.G., Golovkin, M., Prasad, J., Manley, J.L., and Reddy, A.S. (2007). Regulation of plant developmental processes by a novel splicingnfactor. PLoS One 2, e471. Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D.J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25, 3389-3402.
Ashton, N.W., and Cove, D.J. (1977). The isolation and preliminary characterisation of auxotrophic and analogue resistant mutants of the moss, Physcomitrella patens. Molecular and General Genetics MGG 154, 87-95.
Barta, A., Kalyna, M. and Lorkovic, Z.J. (2008). Plant SR-proteins and their functions. Curr Top Microbiol Immunol 326, 83–102.
Barta, A., Kalyna, M., and Reddy, A.S.N. (2010). Implementing a Rational and Consistent Nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR Proteins) in Plants. The Plant Cell Online 22, 2926-2929.
Bjellqvist, B., Hughes, G.J., Pasquali, C.h., Paquet, N., Ravier, F., Sanchez, J.C.h., Frutiger, S., and Hochstrasser, D.F. (1993) The focusing positions of polypeptides in immobilized pH gradients can be predicted from their amino acid sequences. Electrophoresis 14, 1023-1031. Cáceres, J.F., Misteli, T., Screaton, G.R., Spector, D.L., and Krainer, A.R. (1997). Role of the Modular Domains of SR Proteins in Subnuclear Localization and Alternative Splicing Specificity. The Journal of Cell Biology 138, 225–238.
Chenna, R., Sugawara, H., Koike,T., Lopez, R., Gibson, T.J., Higgins, D.G., and Thompson, J.D. (2003). Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res 31, 3497-500.
Cove, D.J., Bezanilla, M., Harries, P., and Quatrano, R.S. (2006). Mosses as Model Systems for the Study of Metabolism and Development. Annu Rev Plant Biol 57, 497–520.
Cove, D.J., Knight, C.D., and Lamparter, T. (1997). Mosses as model systems. Trends in plant science 2, 99-105.
18
Dauksaite, V., and Akusjärvi, G. (2004). The second RNA-binding domain of the human splicing factor ASF/SF2 is the critical domain controlling adenovirus E1A alternative 5'-splice site selection. Biochem J 381, 343-350.
Denby, K., and Gehring, C. (2005). Engineering drought and salinity tolerance in plants: lessons from genome-wide expression profiling in Arabidopsis. TRENDS in Biotechnology 23, 547-552.
Escobar, A., Arenas, A., and Gomez-Marin, J. (2006). Molecular evolution of serine/arginine splicing factors family (SR) by positive selection. In Silico Biol 6, 347-350.
Felsenstein, J. (1989). PHYLIP - Phylogeny Inference Package (Version 3.2). Cladistics 5, 164-166.
Filichkin, S.A., Priest, H.D., Givan, S.A., Shen, R., Douglas W. Bryant, D.W., Fox, S.E., Wong, W., and Mockler, T.C. (2010). Genome-wide mapping of alternative splicing in A. thaliana. Genome Res 20, 45-58.
Graveley, B.R. (2001). Alternative splicing: increasing diversity in the proteomic world. Trends in Genetics 17, 100-107.
Guindon, S., and Gascuel, O. (2003). A Simple, Fast, and Accurate Algorithm to Estimate Large Phylogenies by Maximum Likelihood. Systematic Biology 52, 696-704.
Holm, K., Kallman, T., Gyllenstrand, N., Hedman, H., and Lagercrantz, U. (2010). Does the core circadian clock in the moss Physcomitrella patens (Bryophyta) comprise a single loop? BMC Plant Biology 10, 109.
Iida, K., Seki, M., Sakurai, T., Satou, M., Akiyama, K., Toyoda, T., Konagaya, A., and Shinozaki, K. (2004). Genome-wide analysis of alternative pre-mRNAsplicing in A. thaliana based on full-length cDNA sequences. Nucleic Acids Research 32, 5096-5103.
Johnson, J.M., Castle, J., Garrett-Engele, P., Kan, Z., Loerch, P.M., Armour, C.D., Santos, R., Schadt, E.E., Stoughton, R., and Shoemaker, D.D. (2003). Genome-Wide Survey of Human Alternative Pre-mRNA Splicing with Exon Junction Microarrays. Science 302, 2141.
Kalyna, M., and Barta, A. (2004). A plethora of plant serine/arginine-rich proteins: redundancy or evolution of novel gene functions? Biochemical Society Transactions 32, 561-564.
Kreps, J.A. Wu, Y., Chang H-S., Zhu, T., Wang, X., and Harper, J.F. (2002). Transcriptome Changes for A. in Response to NaCl, Osmotic, and Cold Stress. Plant Physiology 130, 2129-2141.
Lareau, L.F., Inada, M., Green, R.E., Wengrod, J.C., and Brenner, S.E. (2007). Unproductive splicing of SR genes associated with highly conserved and ultraconserved DNA elements. Nature 446, 926-929.
19
Lewis, B.P., Green, R.E., and Brenner, S.E. (2003). Evidence for the widespread coupling of alternative splicing and nonsense-mediated mRNA decay in humans. Proceedings of the National Academy of Sciences 100, 189-192.
Lopato, S., Kalyna, M., Dorner, S., Kobayashi, R., Krainer, A.R., and Barta, A. (1999). atSRp30, one of two SF2/ASF-like proteins from Arabidopsis thaliana, regulates splicing of specific plant genes. Genes & Development 13, 987-1001.
Manley, J.L., and Tacke, R. (1996). SR proteins and splicing control. Genes & Development 10, 1569-1579.
Meyer, R.K., and Krueger, D.D. (2004). A Minitab Guide to Statistics (3rd ed.). Upper Saddle River, NJ: Prentice-Hall Publishing. ISBN 978-0131492721.
Ni, J.Z., Grate, L., Donohue, J.P., Preston, C., Nobida, N., O’Brien, G., Shiue, L., Clark, T.A., Blume, J.E., and Ares, M. (2007). Ultraconserved elements are associated with homeostatic control of splicing regulators by alternative splicing and nonsense-mediated decay. Genes & Development 21, 708-718.
Palusa, S.G., Ali, G.S., and Reddy, A.S.N. (2007). Alternative splicing of pre-mRNAs of Arabidopsis serine/arginine-rich proteins: regulation by hormones and stresses. The Plant Journal 49, 1091-1107.
Palusa, S.G., and Reddy A.S.N. (2010). Extensive coupling of alternative splicing of pre-mRNAs of serine⁄arginine (SR) genes with nonsense-mediated decay. New Phytologist 185, 83-89.
Reddy, A.S.N. (2007). Alternative splicing of pre-Messenger RNAs in plants in the genomic era. Annu Rev Plant Biol 58, 267–294.
Rensing, S.A., Lang, D., Zimmer, A.D., Terry, A., Salamov, A., Shapiro, H., Nishiyama, T., Perroud, P.-F., Lindquist, E.A., Kamisugi, Y., et al.,. (2008). The Physcomitrella Genome Reveals Evolutionary Insights into the Conquest of Land by Plants. Science 319, 64-69. Reski, R. (1998). Development, genetics and molecular biology of mosses. Bot Acta 111, 1-15.
Saitou, N., and Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4, 406-425.
Sharp, P.A., and Burge, C.B. (1997). Classification of Introns: U2-Type or U12-Type. Cell 91, 875.
Shen, H., Kan, J.L.C., and Green, M.R. (2004).Arginine-Serine-Rich Domains Bound at Splicing Enhancers Contact the Branchpoint to Promote Prespliceosome Assembly. Molecular cell 13, 367-376.
20
Sigrist, C.J.A., Cerutti, L., de Castro, E., Langendijk-Genevaux, P.S., Bulliard, V., Bairoch, A., and Hulo, N. (2010). PROSITE, a protein domain database for functional characterization and annotation. Nucleic Acids Res 38, 161-6.
Tanabe, N., Yoshimura, K., Kimura, A., Yabuta, Y., and Shigeoka, S. (2006). Differential Expression of Alternatively Spliced mRNAs of A. SR Protein Homologs, atSR30 and atSR45a, in Response to Environmental Stress. Plant Cell Physiol 48, 1036-1049.
Thomashow, M. (1999). PLANT COLD ACCLIMATION: Freezing Tolerance Genes and Regulatory Mechanisms. Annu. Rev. Plant Physiol. Plant Mol. Biol 50, 571–99.
Wang, B-B., and Brendel, V. (2006). Genomewide comparative analysis of alternative splicing in plants. PNAS 103, 7175-7180.
Wood, A.J., Oliver, M.J. and Cove, D.J. (2000). Bryophytes as Model Systems. The Bryologist 103, 128-133.
Wu, J.Y., and Maniatis, T. (1993). Specific interactions between proteins implicated in splice site selection and regulated alternative splicing. Cell 75, 1061-1070.
Xiao-Qin, G., Hong-Zhi, Z., and De-Bao, L. (2007). Alternative splicing of pre-mRNA in plants. Chinese Journal of Agricultural Biotechnology 4, 1-8.
Zeller, G., Henz, S.R., Widmer, C.K., Sachsenberg T., Rätsch, G., Weigel, D., and Laubinger, S. (2009). Stress-induced changes in the A. thaliana transcriptome analyzed using whole-genome tiling arrays. The Plant Journal. doi: 10.1111/j.1365-313X.2009.03835.x.
Zhang, X-N., and Mount, S.M. (2009). Two Alternatively Spliced Isoforms of the Arabidopsis SR45 Protein Have Distinct Roles during Normal Plant Development. Plant Physiology 150, 1450-1458.
Zhou, Z., Licklider, L.J., Gygi, S.P., and Reed, R. (2002). Comprehensive proteomic analysis of the human spliceosome. Nature 419, 182–185.
