Mechanism specific effects of two organic pollutants in a single and co-cultured system using two cell lines from Rainbow trout

(1)

BACHELOR’S THESIS IN BIOLOGY

15 hp

VT2020

TITLE

Mechanism specific effects of two organic pollutants in a single and co-cultured

system using two cell lines from Rainbow trout

Nicole Stylin

Nicsty019@gmail.com

Supervisor: Steffen Keiter

Examiner: Håkan Berg

(2)

Abstract

The present project aims at the investigation of the toxic effects of two organic environmental compounds and to determine whether the interactions of the compounds are different in a single and co-cultured system using two cell lines. The two compounds used for this purpose were PFBS (perfluorobutanesulfonic acid) and BaP (benzo[a]pyrene). For this study, two cell lines from rainbow trout, RTgill-W1 (gills) and RTL-W1 (liver) were used to test the toxic impacts of the selected compounds. The cell lines were cultured before performing the further tests using Neutral red cytotoxicity assay, qPCR and a multiple cell system. Neutral red was used to test acute toxicity, qPCR to determine changes in the expression of selected genes, and the multiple cell system for co-culturing. The hypothesis was to establish if there where interactions between the two cell lines in co-culturing and to investigate their sensitivity towards the compounds was comparable to single cell line. Neutral red indicated that neither BaP, PFBS or mixed compounds was causing acute toxicity. However, expression in gene regulation varied between the tested concentrations of BaP and PFBS, thus; co-culture indicated on lower expression.

(3)

Örebro University 2020

1. Introduction

Recent research frequently shows that not only the total quantities of pollutants that are released into the environment are important; in most cases also the properties of a pollutant, e.g. persistency and toxicity, represent important parameters that also determines their fate and distribution. Besides, the persistency varies among pollutants, though the mixture of compounds might be just as harmful (Häder et al., 2020). For the understanding of the effect of a chemical mixture, the information of individual compounds is vital (Backhaus & Faust, 2012). For the chemical risk assessment and the investigation of different chemical compounds and their toxicological effects, animals have frequently been used in in vivo studies. A major goal of current chemical risk assessment approaches, e.g. REACh, is to replace in vivo clinical trials on animals by cell-based in vitro assays (Hutchinson et al., 2016). Alternatives for in vivo testing have recently been introduced and seen as an more ethical method, such as the in vitro clinical trails to predict toxic effects (Fent, 2001). Ecotoxicology in vitro methods are used as experiments for testing hazardous chemicals, thus; these experiments are dependent on establishing good cell lines (Rehberger et al., 2018). The properties of using only cells from the organism instead of the whole animal is a good concept and replacement (Franco & Lavado, 2019). Besides, in vivo studies using animals (e.g. mammalian and fish) are still required; however, considering the existing amount of non-studied compounds, the high number of animals needed for in vivo testing is ethical questioned (Galbis-Martínez et al., 2018). Instead, the 3Rs concept demands to refine, reduce, and replace animal testing by alternative methods, such as in vitro testing and co-culturing (Katagi, 2020). In addition, research has shown that acute toxicity testing with cell lines is not sensitive enough, when comparing with in vivo investigations because in vitro studies also do not serve information about chronic exposure and bioaccumulation (Lammel et al., 2019). Therefore, co-culturing of cell lines may serve as an alternative to provide with more reliable information simulating the reaction of an whole organism (Dent et al., 2019), due to the cellular interactions and chemical responses.

(5)

2

1.1 Cell lines and co-culturing

In ecotoxicology, there are many different cell lines to use for investigation of acute toxic or mechanism-specific effects and numerous of these cell lines are originating from fish. For example, from Rainbow trout (Oncorhynchus mykiss) different permanent cell lines were

developed. Primary cell cultures of epithelial cell lines from the gills and fibroblast from the liver of adult rainbow trout were used to develop RTgill-W1 and RTL-W1 cell lines, respectively (Barlian & Caldwell, 1994;Lee et al., 1993). The use of permanent cell lines from fish represents an alternative to in vivo models, which can provide with some valuable information about the tested chemicals. Besides, these cell lines can stay being cultured without aging and, thus, produce a high amount of identical material with the same genetic background (Bopp et al., 2006). Hence, the study of toxic effects using permanent cell lines decreases the variety of data from different exposures, free from a dispute of ethical regulations and still being able to do the same repeated study (Schirmer, 2006). The cell based cytotoxicity assay using only fish cell lines is an alternative to the lethality test based on the whole organism. The predicted concentration causing cell death in vitro, will do so in the organism; however, questions must be taken into account, such as technical issues with cell lines, density in cell culture and methods to test toxicity (Rehberger et al., 2018). This means that higher concentrations of compounds may be required to give the same toxic effect as in vivo, thus, an in vitro test will serve false-negative results leading to an underestimation of the chemical hazard potential of a test substance (Schirmer, 2006). Moreover, the effect of cellular apoptosis due to exposure and the following impact on the organism cannot be studied in vitro, yet. However, other ways to improve the study with cell lines has been developed using co-culturing. Two or more cell lines can be cultivated in the same plate using inserts that provides cell-cell interactions. The purpose is that the presence of another population can show similar results as studying in vivo on animals (Goers et al., 2014). Moreover, co-culturing is a well-defined complement to investigate whether the signaling pathway and exchange between cells can improv the understanding of organic pollutants.

(6)

3

1.2 Perfluorobutanesulfonic acid (PFBS)

PFBS is a chemical belonging to a class of perfluoroalkyl substances (PFAS). They are well known as highly persistent, bioaccumulative, and toxic fluorinated chemicals. Numerous studies found that perfluoroalkyl substances have a large impact on living organisms and are poorly metabolized and, thus, leading to an increased biomagnification of PFAS at higher tropical levels (Oeritz et al., 2013). According to Newsted (2008), “thousands of different perfluoroalkyl substances have been used since the 1950s in products and the industry, becoming a harmful contaminant for the environment”. Moreover, due to the rigid C-F bindings, PFAS tend to be a stable lipo- and hydrophobic chemical (Menger et al., 2020). Bioaccumulation and persistence associates with the length of the F-chain thus; PFAS can degrade into longer or shorter F-chains, meaning F-alkyl carboxyl acids (PFCAs) e.g. perfluorooctanoic acid (PFOA), perflourononanoic acid (PFNA) and F-alkane sulfonates (PFSA) e.g. perflourooctanesulfonic acid (PFOS) that will persist and not further degrade (Krafft & Riess, 2015). PFOS is the most common PFAS to be found in the environment due to its structure, consisting of strong carbon-fluorine bonds, thus; not reported as genotoxic (Jernbro et al., 2007). Due to regulations and the environmental persistence of PFOS it has been replaced by perfluorobutanesulfonic acid (PFBS), thus can still be traced in the environment (Eriksen et al., 2010a).

(7)

4

1.3 Benzo[a]pyrene (BaP)

Polycyclic aromatic hydrocarbons (PAHs) consists of a group of ubiquitous compounds existing in complex mixtures, e.g. pyrogenic or petrogenic, depending on the origin. Petrogenic PAH mixtures yield from oil and pyrolytic from incomplete composure (Cousin & Cachot, 2014). In the same way, two sources of PAHs are existing in the environment in form of natural (e.g. oil seeps and forest fire) and anthropogenic (e.g burning fossil fuel, wood), because of their persistent and deficiency to degrade (Haritash & Kaushik, 2009). Due to its hydrophobicity, PAHs can stay in materials and environments for a long period (Behera et al., 2018).

Benzo[a]pyrene (BaP) is a PAH of five aromatic rings with the formula C20H12 and originates

from incomplete combustion of organic materials. Thus PAHs can be toxic, mutagenic or cancerogenic as properties to absorb quickly and being lipid-soluble (Abdel-shafy & Mansour, 2016). Besides, to understand the mechanisms of toxic effect, it requires studies and tests at a cellular level (Schirmer et al., 2000). The investigation of toxic effects can be seen in gene regulation within the cell lines. For some classes of organic chemicals, certain genes (e.g. Cytochrome P4501A1) found in tissue as for RTL-W1 and RTgill-W1 (Levine & Oris, 1999) and can be used as an important biomarker. Moreover, CYP4501a1 metabolizes PAHs compounds, including BaP (Sadar & Andersson, 2001).

(8)

5

1.4 Biological endpoints

Cytotoxicity assays, such as the Neutral red assay, are widely used for in vitro toxicology studies. Often this is used to determine the concentration at where the test substance is causing acute cytotoxicity (Fotakis et al. 2006). It is a simple and sensitive test that facilitates the determination of viable cells (Borenfreund & Puerner, 1985) based on the cell's ability to absorb and bind the neutral red dye in the lysosomes (Gomez Perez et al., 2017).

Further investigations can be done to understand the compounds toxicity and their influence on cellular level (Hook et al., 2006). Moreover, gene alterations in response to exposure of chemicals can be studied using cell lines. QPCR (Quantitative real-time polymerase chain reaction) can be used to examine the impact of toxins regulations at genomic levels. It is a sensitive fluorescent method measuring amplifications at a given threshold (Padhi et al., 2020). Primers for specific genes are designed and used to investigate regulation in expression. Changes in mRNA expression levels are determined by using relative quantification.

1.5 Hypothesis and objectives

The hypothesis of the study is that co-culturing is more sensitive towards the compounds compared to each cell line alone. The cells presence and interactions will show difference in gene regulation for both PFBS and BaP.

The purpose was to examine whether the two specific organic compounds can cause acute or genomic toxicity using in vitro study. Two cell lines, RTL-W and RTgill-W1 derived from two liver and gills was used to perform a single and co-culturing. The results was analyzed and compared between the highest and the lowest concentration tested for PFBS and BaP and the two culture methods.

(9)

6

2. Materials and methods

2.1 Chemicals

DMSO (dimethyl sulfoxide, C2H6OS, CAS number 67-68-5) is a highly polar compound and

soluble in water; thus, it is a widely used solvent for in vitro testing of organic pollutants (Yang Xiang et al. 2018) such as BaP (benzo[a]pyrene, 50 mM, C20H12, CAS number: 50-32-8 ) and

PFBS (perfluorobutanesulfonic acid, 6.6 mM, C4HF9O3S, CAS number 375-73-5). DMSO was

used as dissolvent together with compounds and control for untreated cells. For cell culture, L15 medium (Leibovitz medium, CAS number 26700-71-0) were uses as it supports cell growth and is supplemented with 10% FBS (fetal bovine serum, CAS number 9014-81-7) and 5% antibiotics (penicillin/streptomycin, 1000 units/ml streptomycin: 10 mg/ml) CAS number 3810-74-0). Gentamicin (50 mg/mL, CAS number 1405-41-0) was used as an additional antibiotic for the cell lines. Trypsin-EDTA (1x) (0.5g/L porcine trypsin; 0.2g/L EDTA x 4Na, CAS number 9002-07-7) solution was used for cell detachment. Ethylenediamineteraacetic acid (EDTA) removes Ca2+ ions required for cell adhesion. Neutral red (Toluylene red, 50 µg/ml, CAS number 553-24-2) was used as a dye in Neutral red assay. Extractuin solution used in NR: 5 ml of glacial acetic acid (CH3CO2H, CAS number: 64-19-7), 250 ml ethanol (>96%) and

250 ml Milli-Q. DCP (dichlorophenol, 80 mg/L, Cl2C6H3OH, CAS number: 120-83-2) is an

anthropogenic organic compound common in water and soil pollutants and was used as a positive control in the neutral red assay as it is causing acute cell toxicity. PBS (phosphate-buffered saline, CAS number: 7447-40-7) used as a wash solution. All chemicals and reagents used in this project were purchased from Sigma-Aldrich (Merck).

Tissue-culture treated 96-well plates (0.32cm2, TPP Renner, Sigma-Aldrich Merck), 6-well plates (9.5cm2, TPP Renner, Sigma-Aldrich Merck) and 6-well plate with inserts (4.6 cm2, Corning® Transwell® polyester membrane) used for Neutral red and co-culturing was purchased at sigma-Aldrich.

2.2 Rainbow trout cell lines RTL-W1 and RTgill-W1

In 1994, Bols and co-workers developed the permanent cell line RTL-W1(Lee et al., 1993)from the liver of an adult male rainbow trout (Onchorhynchys mykiss). After the isolation of RTL-W1 it was shown that the cell line was suitable for culturing under in vitro conditions (Lee et al., 1993). Gill filaments from rainbow trout where sub cultivated to develop a RTgill-W1 cell line (Barlian & Caldwell, 1994). The two different cell lines were cultured in L15 medium containing 2 mM L-glutamine (CAS number: 26700-71-0). The complete medium for cell

(10)

7

culturing consisted of 450 ml L15, 5 ml penicillin-streptomycin and 45 ml FBS. Penicillin/streptomycin (penicillin 1000 units/ml and streptomycin 10 mg/ml) was added to the L15 medium, to decrease the risk of contamination. Besides, gentamycin (50 mg/mL) was added as supplement antibiotics (CAS number: 1405-41-0). The complemented medium containing 1% of penicillin-streptomycin and 10% fetal bovine serum was freshly prepared before starting cell culturing. Sterile PBS (phosphate-buffered saline) used as a wash buffer during the passaging of cells.

2.3 Thawing new RTL-W1 and RTgill

The cryovials with the cell lines (RTL-W1 or RTgill-W1) were taken out from the liquid nitrogen tank and thaw to room temperature. The cells were transferred into a falcon tube containing 9 ml of L15 medium with 5% penicillin-streptomycin and 10% fetal bovine serum. Subsequently, the cells were centrifuged for 10 minutes at 130 g acceleration. The supernatant was removed to liquid container and 2 ml of L-15 medium was added and resuspended to disrupt the pellet. The cell suspension was transferred to a cell culture flask with 10 ml of L15 medium and incubated at 21 ºC.

2.3.1 Exchange of medium

Regular exchange of medium is necessary to remove any dead floating cells and to prevent contamination. The medium was removed without disrupting the cell layer and discharge in a liquid container. 20 ml of new fresh L15 medium (with FBS and pen-strep) was added into the cell culture flask and further incubated at the same temperature.

2.3.2 Passaging of RTL-W1 and RTgill-W1

The medium was discharge from the flask and the cell lines were washed with 10 ml of PBS. The PBS was carefully sprayed onto the cells and gently rotated before removing. 2 ml of Trypsin was added into the culture flask with the cells. The flask was rotated and tapped on the workbench to detach the cells. When the cells were detached, 2 ml of L15 medium was added to stop the trypsinization. The medium was resuspended and transferred to two culture flasks

(11)

8

already prepared with fresh medium to a volume of 20 ml. Subsequently, the cell culture flasks were incubated at 21 ºC.

2.3.3 Freezing RTL-W1 and RTgill-W1

The freezing medium is containing 10% DMSO, 20% FBS and 70% L15 medium. After the preparation, it was stored on ice. The cryovials were labeled with name, date, cell line, and passage number. The medium was removed from the cell culture flask and the cells were washed with PBS. For cell detachment, 2 ml of trypsin was added to the cells. A total of 8 ml L15 medium was added for stopping trypsinization and the cells were resuspended and centrifuged for 10 min at 125 g. The medium was decanted and resuspended in 2 ml of freezing medium. Equal portions of cell suspension were added in the cryovials and stored for 24 h at -80 ºC before transferred to a liquid nitrogen tank.

2.4 Neutral red cytotoxicity assay

The neutral red assay was used to determine the in vitro toxicity and to measure the membrane permeability (Knauer et al., 2007). Neutral red is a vital stain for living cells that will reveal all living cells counted on a Neubauer counter slide. The neutral red working solution was prepared one day before staining. A 1:80 dilution from the 0.4% neutral red aqueous stock solution and the medium was prepared. The solution was filtered with a 0.2 µm filtered to remove any bacteria and crystals that can damage the cells. The test compounds were dissolved in 10 ml of DMSO. The compounds were then added to the medium with a DMSO concentration that did not exceed 1% v/v. The 96-well plates were prepared according to dilution factor 1:2. 100 µl of the L-15 medium were added into column 2, 4-9 and 11. Column 2 and 11 was used as negative control. In column 3, 90 µl om medium and 10 µl of DCP were added as the positive control. The test solution with compounds was added to each well in column 9 and 10. Starting from column 9, the dilution series started. 100 µl was pipetted from column 9 and added into column 8. 100 µl was taken out from column 8 and added to column 7, etc. In column 4, 100 µl needed to be discharged.

(12)

9

Table 1 Compounds and concentration used for stock solution

Compound concentration

BaP 50 mM: 126 mg/10 ml PFBS 6.6mM: 200 mg/L

Figure 3 96 microtiter culture well plate for Neutral red cytotoxicity assay for measuring viability of

treated cells. The test is based on binding of neutral red by the lysosomes. Cells are added in column 2-11. Column 2 and 11 are used as negative control and column 3 as positive control. Viability are measured spectrophotometric at wavelength 540 nm.

The harvested cells were taken up in 7 ml of medium and the cells were counted in a Neubauer chamber. In 16 squares should be 30-40 cells counting for 3-4 x 105 _{cells/ml. For 60 wells, a}

total of 7 ml of cell suspension was needed. 100 µl of the cell suspension was added to each well in the plate using a multi-stepper. The plates with exposed cells were stored and incubated for 48 hours. After 48 hours of incubation, the medium from the plates was discharged and the neutral red solution was added into each well and incubated for 3-4 hours. The neutral red solution was later discharged and the cells were washed with 6 ml of PBS per plate (100 µl per well). The PBS was discarded and the dye was recovered with 100 µl of extraction solution per well (5 ml of glacial acetic acid, 250 ml ethanol (>96%) and 250 ml Milli-Q). Two wells were

(13)

10

filled with extraction dye (used as blank) and the empty wells were filled with PBS. The plates shook for 30 minutes before read with microtiter plate (Omega, BMG Labtech, Germany) at a wavelength of 540 nm against 690 nm as reference.

2.5 qPCR

The stock solution with PFBS and BaP was prepared and diluted from the highest to the lowest concentration in L-15 medium and DMSO. For highest concentration, 20 µl of compound was added to 1980 µl of medium. For the lowest concentration, 200 µl from mixture (2180 µl medium + 2.2 µl compound + 17.8 µl DMSO) was taken out and diluted in 1782.2 µl medium and 17,8 µl DMSO. For exposure of mixed compounds, 10 µl of each compound where used in highest concentration (total of 20 µl). As for the between step for lowest concentration, 1.1 µl from each compound was added to solution containing medium and DMSO.

A total amount of 2 ml of the compounds was added to a 6 well plate for both cell lines. DMSO with 1% concentration was used as control. Bottles with RTL-W1 and RTgill-W1 were harvested and resuspended in 4 ml L15 medium before added to the compounds in the 6 well plates and incubated for 48 hours.

After 48 hours of exposure, the medium was decanted and the cells where prepared for RNA purification. RNA purification for cultured cells was done by using a purification kit from MACHEREY-NAGEL (nucleoSpin). RNA purification enables isolation of RNA from sample using silica membrane technology.

The purification process was done according to the Nucleospin RNA protocol. After purification, RNA from all samples was measured using biodrop (UK). Biodrop uses spectrophotometer to determine purity and concentration of DNA, RNA and proteins

For each sample, following components was added in PCR tubes: 1µl random primers, 1ng-5µg RNA, 1µl 10 mM dNTP Mix, MilliQ for total of 12 µl. The cDNA was synthesized using M-MLV RT enzyme (Moloney murine leukemia virus). ML-MLV RT uses single stranded RNA or DNA to synthesize cDNA. The tubes run first for 5 minutes in 65 ºC and then put on ice. Further components were added to each tube, which were: 4 µl 5X First-strand buffer and 2µl 0.1M DTT (USB Dithiothreitol). The tubes where incubated for 2 minutes at 37 ºC before

(14)

11

adding 1µl of M-MLV RT and then incubated 10 minutes at 25 ºC. The tubes run further 50 minutes at 37 ºC before inactivated in 70 ºC for 15 minutes. The cDNA was diluted in 80 µl MilliQ water before used in qPCR.

Mastermix with each primer for qPCR was prepared containing: 100 µl SybrGreen (qPCRBIO syGreen Mix HI-ROX), 10 µl primers and 40 µl MilliQ water. Working solution with each primers where prepared with 5 µl forward and 5 µl reverse primer diluted in 90 µl MilliQ water. Gel electrophoresis was used for separation of DNA fragments. Gel was prepared with 0.4 g agarose in 40 ml 1xTAE buffer and heated until liquid was clear. 1 µl of ethidium bromide was added and the gel was filled in form to solidify. 2 µl loading dye was mixed with 8 µl of cDNA and loaded to wells. Ladder was loaded to first well as weight reference. 1xTAE was filled to cover the gel and then run for 30 minutes before investigated under UV.

A total of 15 µl of the Mastermix was loaded to the plate and 5 µl of each cDNA was added to all primers. The plate run in the qPCR machine at standard 2 hours. One sample of RTL-W1 and RTgill-W1 from each primer where used to prepare the standard curve. 1 µl cDNA where diluted in 10 ml of MilliQ (x10.000). 4 µl from x10.000 was added to the first tube containing 16 µl MilliQ (1:5 dilution) and mixed by pipetting. A new tip was used to take up 4 µl from first tube and where added to the second tube (containing 16 µl milliQ). Same procedure was repeated another 5 times for total of 7 tubes. For each cell line and primer, 2 replicates where loaded to the plate. 5 µl from cDNA (x10.000 dilution) where added in first well, as second until eight well was loaded with cDNA (1:5 dilution) from the seven tubes. Ct values were used to prepare the standard curve and to determine the primer efficiency. Primers were designed at primerblast and tested in silico using Beacon designer.

(15)

12

Table 2 Primers designed with primerblast. * reference gene.

Gene Accession number Forward 5’  3’ Reverse 3’  5’

Hsp90 XM_021603114.1 CAGCACCATGAATCCACAGG AAACTGATGGGGAAATGACGG

Cyp1a1 XM_021607648.1 ACTGCTCCTCTTGCCTTGAT ACAGGCACTTTATGATGTAGGT

bcl7a XM_021621577.1 TAGCAGCTATGTCGGGCAG TTGACTTGGGTTCGGTCACA

Cyp2k1 XM_021558859.1 CACCATCCGTGGAGTTCACA GGAAGGTGCCTATGAACCGAT

Interleukin-1-β NM_001124347.2 TTGGGCCTCTACGATCAGGA CAGGGGCGCTTACCACAATA

tnf-α AJ278085.1 GTCCACACATGATTGTCCATTCTC AGGCTACTGCTAGACTTATGTGA

Ef1- α* NM_001124339.1 ATCAAGCAGTGGTCGAGTGAG AATGCCTCCGCACTTGTAGA

2.6 Co-culturing system

RTL-W1 and RTgill-W1 were used in co-culturing to investigate whether their interactions would change the gene expression when exposed to compounds. This was compared to the single cell lines exposed to compounds and DMSO as control. A 6 well plate with 9.5 cm diameter and inserts with 4.6 cm where used. RTL-W1 where harvested (compare chapter 2.3.2) and counted in Neubauer counter slide. The concentration of cells in the flask were calculated to get confluent in each well. The tube with cells was spun down in centrifuge and the supernatant was removed without disturbing the pellet. Calculated volume of medium was added to the pellet and resuspended. Total of 2 ml of fresh medium where added to each well and x volume of cell suspension. The same procedure was repeated with the RTgills-W1; with some changes. Before adding the RTgill-W1 to the inserts, 2 ml of medium as added to each well under the inserts. A tweezer put in tube containing alcohol (75%) was used to remove the inserts. The x volume of cell suspension and 1 ml of medium was added to the inserts. The plates was put in the incubator for 24 hours. After 24 hours, 2 ml of fresh medium was added to RTL-W1 and inserts with RTgill-W1 was moved to wells containing RTL-W1. 1 ml of medium containing compounds was added directly to the RTgill-W1 in the insert. The plates were incubated another 48 hours before RNA purification.

(16)

13

Table 3 Calculation for co-culturing: Number of cells counted in 16 squares (4 x 105 _cells/ml)

Equation for RTL-W1 to be confluent in well 30 𝑐𝑒𝑙𝑙𝑠 𝑥 10 (𝑑𝑖𝑙𝑢𝑡𝑖𝑜𝑛) 𝑥 10 (𝑣𝑜𝑙𝑢𝑚𝑒 𝑚𝑙) 𝑥 10.000 4 (𝑠𝑞𝑢𝑎𝑟𝑒𝑠) = 7.5 𝑥 10 6 7.5 𝑥 106 75 𝑐𝑚2 = 100.000 cells/𝑐𝑚2 100.000 𝑥 9.5 𝑐𝑚2 (𝑤𝑒𝑙𝑙 𝑠𝑖𝑧𝑒) = 950.000 = 7.5µl medium added to 95µl cell suspension / well

(17)

14

3. Result

3.1 Acute cytotoxicity

PFBS and BaP did not cause any cytotoxicity in neither RTgill-W1 or RTL-W1 cells after exposure to the two concentrations (see fig. 4). Comparing both PFBS and BaP with cell lines against the control indicated on higher cell viability, might be that more lysosomes are produced and more neutral red dye can be retained. However, difference between RTL-W1 and RTgill-W1 are noticed.

Figure 4 Cytotoxicity determined in RTgill-W1 and RTL-W1 after 48 h of exposure to PFBS and BaP.

The absorbance of dye is measured using spectrophotometer at OD 540nm and cell viability are shown as percentage against the control. The exposure of BaP and PFBS did not indicate on acute toxicity. The test contains three replicates, but no statistics was used for testing significance.

In addition, the exposure with mixture of both compounds (PFBS and BaP) did not cause any acute cytotoxicity in RTgill-W1 nor RTL-W1 (see fig.5). Both cell lines indicated on higher cell viability than the control, thus; higher percentage was noticed for RTgill-W1 than for RTL-W1.

Figure 5 Cytotoxicity from exposure of mixed compounds (PFBS and BaP) after 48 h for RTgill-W1

and RTL-W1. The absorbance of dye is measured using spectrophotometer at OD 540nm and cell viability are shown as percentage. Comparing to control, the mixed compound did not indicate on acute toxicity. The test contains three replicates, but no statistics was used for testing significance.

(18)

15

3.2 Fold change expression BaP single and co-culture

Gene regulation in expression was compared between highest (50 mM) and lowest concentration (0.5 mM). This was done by examine the expression of the genes measuring fold change, tnfα, il1β, cyp2k1, cyp1a1, bcl and hsp90. Tumor necrosis factor (tnfα) is an inflammatory cytokines involved in wide range of signaling, inducing cell necrosis or apoptosis. Tnfα was upregulated at highest concentration (50 mM) for RTgill (0.083-fold), co-RTgill-W1 (0.75-fold), thus indicated on downregulation in the lowest concentration. For RTL-W1 and co-RTL-RTL-W1, upregulation was seen in lowest concentration at 0.2-fold and 1.497-fold. Cytokine Interleukin 1 beta (il1β) are involved in inflammatory responses, such as; apoptosis and cell proliferation. Upregulation of the gene was seen in RTgill-W1 (11.9-fold) and co-RTgill-W1 (0.134-fold) at the highest concentration, thus; for RTL-W1 and co-RTL-W1 il1β was instead downregulated at highest concentration. Cytochrome1a1 and 2k1, are both monoxygenases and involved in drugmetabolism and tend to be induced by some PAHs. Cyp1a1 was over-expressed in RTL-W1, as upregulated in 50 mM (30482-fold) and downregulated in 0.05 mM (11605-fold). Instead, RTgill-W1 indicated on upregulation (899-fold) in lower concentration rather than higher (169-(899-fold) concentration. For both co-RTL-W1 (516-fold) and co-RTgill-W1 (175-fold) cyp1a1 was upregulated in 50 mM. Thus, cyp2k1 indicated on upregulation in 0.5 mM for both RTL (2.4-fold) and RTgill-W1 (0.513-fold), whereas minimal or minor regulation was noticed in co-RTL-W1 and co-RTgill-W1. Bcl, belongs to proteins that regulate apoptosis and showed indication of upregulation in 50mM for RTgill-W1 (3.2-fold) and co-RTL-W1 (0.42-fold); thus, for the 0.05 mM, RTL-W1 (1.4-fold) and co-RTgill-W1 (124.8-fold) upregulation was observed.

Heat shock protein, hsp90, is a protein that assist to fold and stabilize other proteins against stress, which can be essential during e.g. tumor development. Hsp90 was upregulated at lower concentration in RTgill-W1 (11.9-fold). Moreover, downregulation was observed for co-RTL-W1 (0.13-fold) and co-RTgill-co-RTL-W1 (2.9-fold).

Two technical and one biological replicate was used to present the fold change, thus no statistical test was used.

(19)

16

Figure 6 Tables of exposure for BaP. Fold change comparing highest (50mM) and lowest (0.5mM)

concentration of expression using multiple genes for both single and co-culture. a) tnfα, b) il1β, c)

(20)

17

3.3 Fold change expression PFBS single and co-culture

Gene regulation in expression was compared between highest (6 mM) and lowest concentration (0.06mM) of PFBS. This was done by examine the expression of the genes measuring fold change in tnfα, il1β, cyp2k1, cyp1a1, bcl and hsp90. Tumor necrosis factor (tnfα) is a cytokine, involved in regulation of cell necrosis and apoptosis. Tnfα was downregulated in highest (6 mM) concentration for RTgill-W1 (0.008-fold), as well as for co-RTL-W1 (0.156-fold). Thus, co-RTgill-W1 and RTL-W1 indicated on upregulation, (0.611-fold, 0.07) at 6 mM.

Interleukin 1 beta (il1β) is a cytokine, also involved in apoptosis indicated on upregulation of in 6mM in RTgill-W1 (2.77-fold), co-RTgill-W1 (0.182-fold) and co-RTL-W1 (0.40-fold); thus, upregulated at 0.06 mM for RTL-W1. Cyp1a1 and cyp2k1 are monooxygenase, involved in drug metabolism. RTgill-W1, co-RTgill-W1 and RTL-W1 indicated on upregulation at lowest concentration for cyp2k1, except for noticed downregulation in RTL-W1 (0.229-fold). Same observation was seen for cyp1a1.

Bcl, member of proteins for regulating apoptosis was indicated on upregulation for RTL-W1 (0.265-fold) at highest, 6mM, concentration. Thus, same regulation was noticed at lowest concentration for RTgill-W1, co-RTgill-W1 and RTL-W1. Heat shock protein, hsp90, is an assisting protein that fold and stabilize other proteins against stress. Upregulation of hsp90 was observed at lowest concentration, 0.06 mM, for both single and co-cultured cell lines.

(21)

18

Figure 7 Tables of exposure for PFBS. Fold change comparing highest (6.6mM) and lowest (0.06mM)

concentration of expression using multiple genes for both single and co-culture. a) tnfα, b) il1β, c)

(22)

19

4. Discussion

4.1 No significant acute toxicity detected using Neutral red assay

The Neutral red assay was used to determine the concentration of BaP and PFBS for both cell lines that does not cause acute cell toxicity and, thus, can be used for the qPCR. The Neutral red assay measures the cells viability, in proportion to the lysosomes ability to retain the corresponding dye. The test is based on investigate whether the compounds cause acute toxicity at short-term exposure. The highest to the lowest concentration was diluted and the cell lines were exposed for 48 hours. Besides the variation in concentration, the results showed no indication of acute toxicity for both cell lines and under any exposure condition tested including the mixture of both compounds. The percentage of viable cells varied and there was no indication of toxic affect at either the highest or the lowest concentration. However, only one timepoint for exposure was used (48 h); thus, the suggested timeline of exposure is be between 24-72 hours. Still, since no comparisons was done between different exposure time lines, no conclusion can be made whether longer exposure would have any other effect. Based on the compounds properties, BaP and PFBS tend to be less acute-toxic (Abdel-shafy & Mansour, 2016; Eriksen et al., 2010b)

Although, the noticed increasing percentage comparable to the control in all figures may be caused by lysosome proliferation. The cellular physiology is dependent on keeping homeostasis, a stable intracellular state. Due to external stress such as environmental changes and toxic pollutants, the cells can undergo hormesis; cellular defense due to response of stress (Berry & López-Martínez, 2020). Moreover, the exposure of BaP and PFBS may have caused an increased production of lysosomes and, therefore shown in higher cell viability in comparison to control.

In comparison to a previous study, BaP where used to test cytotoxicity on RTgill-W1. In the test, a 24 h exposure timeline was compared with exposure after 48 h. The result indicated that the cell viability decreased with 10-20% after 48 hours (Bussolaro et al., 2019). Therefore, further tests should be conducted to understand the cellular stress responses including different exposure times, e.g. 12, 24, 48, and 72 hrs.

(23)

20

4.2 Gene expression analysis in single and co-culture systems using RTL-W1

and RTgill-W1

4.2.1 Exposure to BaP

In this project, mechanism-specific toxicity of BaP was studied by analyzing gene expression in RTL-W1 and RTgill-W1, both as single culture and co-culture system, respectively. For the qPCR, specifically designed primers were used to measure changes in gene expression in two concentrations (50mM and 0.5mM) of BaP.

Upregulations in il1β, tnfα, cyp2k1, cyp1a1, bcl and hsp90 was noticed for both RTgill-W1 and RTL-W1. Expression in fold change for RTgill-W1 in cyp1a1 was upregulated (899-fold) in the lowest concentration, 0.5 mM, thus downregulated (169-fold) in the higher concentration 50mM. Similar upregulation in 50 mM was noticed for tnfα (0.083-fold), il1β (11.9-fold) cyp2k1 (0.513-fold), hsp90 (11.9-fold) and bcl (3.2-fold).

Heatshock proteins, hsp90 are induced based on stress from the environment. In this case, expression was downregulated in lowest concentration, which might indicate on stress of survival. As for the other genes, their expression are mechanism specific, such as tnfα and il1β which are inflammatory cytokines triggering might lead to necrosis or apoptosis.

Upregulation of cyp2k1 (2.43-fold), tnfα (0.2-fold) in RTL-W1 was observed at the lower concentration, 0.5mM. However, expression in il1β and hsp90 showed no difference in regulation to different concentration 50mM or 0.5mM. Fold change for il1β was measured at 0.265-fold (50mM) and 0.215-fold (0.5mM). Thus, upregulation in both concentrations was noticed for hsp90 (2.8-fold and 2.7-fold). The exposure of BaP caused an increasing over-expression of cyp1a1 in RTL-W1. Previous studies have shown higher over-expressions of cyp1a in liver tissue of rare minnow (Gobiocypris rarus) exposed to BaP, as well as small induction in gill tissue (Yuan et al., 2013), as induction in liver (3182-fold) and gill (3462-fold) (Costa et al., 2012). Upregulation of cyp1a1 has also been seen across embryonic development of zebrafish embryos exposed to BaP possessing a fold change of 948 ±1399 (Keiter et al., unpublished data). In this study, cyp1a1 for RTL-W1 caused a fold change of 30482 (50 mM) and 11602 (0.5 mM). From the literature it is well known that BaP acts on the aryl hydrocarbon receptor (AhR) and activates the AhR-mediated pathways including the expression of cyp1a1

(24)

21

(Shah et al., 2016). Moreover, induction of cyp1a1 can either lead to toxic outcomes (Behrens et al., 2001).

However, co-culture in comparison to single cultured lower expression in fold change was observed. In cyp2k1 for co-RTgill-W1 a low level of upregulation was noticed in both highest (0.003-fold) and lowest (0.009-fold) concentration. Thus, upregulation in highest concentration (50mM) in tnfα (0.75-fold) bcl (124-fold), il1b (0.134-fold), cyp1a1 (175-fold) and down regulation in the lowest concentration. For co-RTL-W1, the highest upregulated expression was seen in cyp1a1 (516-fold). Moreover, upregulation for highest concentration (50mM) noticed in cyp2k1 (0.256-fold), hsp90 (0.75-fold) and for the lowest concentration (0.5mM) tnfα (1.497-fold), bcl (0.42-(1.497-fold), il1β (0.14-fold).

Moreover, based on the results, single culture showed more upregulation in genes at lower concentration, than for the higher concentration. Thus, this is not reflected to the co-culture where upregulations where seen equally in both highest and lowest concentration. For cyp1a1, upregulation was seen in 50 mM for RTL-W1, co-RTL-W1 and co-RTgill-W1, thus; not for RTgill-W1. Moreover, the over-expression may indicate on oxidative stress, due to high concentration of BaP. The induction of cyp1a1 might also be a cause of other stress affected genes being upregulated. PAHS composed of more than four aromatic rings, tend to be less acute-toxic. PAHs in general alone are not considered being genotoxic, as they need to be metabolized in the ability of binding to DNA, moreover; causing mutations (Abdel-shafy & Mansour, 2016). Still, how whether there is any correlation between up- and downregulation needs further observations. Thus, best of my knowledge, finding data regarding regulation and cellular effects of bcl, hsp90, il1β and tnfα was difficult to find. Moreover, these results provides good indication regarding co-culturing being more sensitive.

4.2.2 Exposure to PFBS

Gene expression alterations of PFBS was tested with single cell and co-cultured systems using RTL-W1 and RTgill-W1 cells. Primers for genes expressed in the cell lines was used to perform qPCR. Two concentrations of PFBS were used for this test and measuring different gene regulations, 6 mM and 0.06 mM.

Highest upregulated gene for RTgill-W1 was noticed in il1β at lowest (2.77-fold) and highest concentration (2.08-fold); thus, lower concentration indicated on downregulation in

(25)

22

comparison to highest concentration. However, lowest concentration (0.06 mM) showed upregulation in tnfα (0.02-fold), cyp2k1 (0.02-fold), cyp1a1 (1.39-fold), bcl (0.59) and hsp90 (1.52-fold). The same pattern was seen as for RTL-W1, were upregulation was seen in lowest concentration for il1β (0.362-fold), cyp2k1 (4.6-fold), cyp1a1 (13.2-fold), bcl (1.82-fold) and hsp90 (3.39-fold). Moreover, the co-cultured RTgill-W1 indicated on downregulation in cyp2k1 (0.02-fold), cyp1a1 (0.19-fold), bcl (0.147-fold) and hsp90 (0.43-fold) at highest concentration, 0.06 mM; thus, upregulated in tnfα (0.611-fold) and il1β (0.182-fold).

As for co-RTL-W1, hsp90 (0.642-fold), cyp1a1 (6.7-fold) and tnfα (0.189-fold) was upregulated based on the lowest concentration of PFBS (0.06 mM), as for il1β (0.40-fold), cyp2k1 (0.295-fold) and bcl (0.265-fold) where upregulated in the highest concentration (6.6 mM) instead.

PFBS is a compound composed of 4-carbon and used as substitute to PFOS. In previous studies using mixture PCB126+PFOS, gene expression in cyp1a1 indicated on significant induction (Blanc et al., 2017). Comparing PFBS against other perflouronated substances, it tend to be less toxic; thus more studies using other organisms are needed (Newsted et al., 2008). Still, difference in toxicity are difficult to predict comparing two organic pollutants origin from two different groups of chemicals, thus; in this study PFBS show tendency of being less genotoxic than BaP, which are shown by lower fold-change. Besides, studying regulation on bcl, hsp90, il1β and tnfα at exposure of PFBS was hard to find. Thus, more data and more tests are needed for further investigations.

4.2.3 Co-culture showed tendency on being more sensitive than single cell lines

The study aimed to compare the single and co-cultured cell lines and whether they were able to show tendency of diverse results. This was done by using the same confluent cell lines, exposed to the highest and lowest concentration of compound. Co-culturing are used to improve in vitro method in order to mimic the complexity of an organism, thus cell types in normal tissue are portioned in order to stimulate and perform certain functions (Goubko & Cao, 2009). Moreover, when examine and comparing the gene regulations, co-culture with RTL-W1 and RTgill indicated on being more sensitive than the single the cell lines independent. Therefore, in order

(26)

23

to investigate whether the co-culture was more sensitive than the single culture with both cell lines, they were cultivated and exposed under the same conditions. Co-cultured system provides a more sensitive in vitro setup, since cell lines are being cultivated for exchanging nutrients and signaling mechanism due to cell-cell interaction. Moreover, a useful tool for in vivo-like investigation of using only two or more cell lines (Goers et al., 2014)

RTL-W1 and RTgill were exposed to highest and lowest concentration tested for both BaP (50 mM, 0.5 mM) and PFBS (6.6 mM, 0.06 mM), respectively. The single cell lines where harvested and added to a 6-well plate the same day as exposed. Exposure time was 48 hours. The co-cultivation recovery period was 48 hours after isolation before exposure; therefore, allow to decrease the level of stress.

For both BaP and PFBS, the single cell RTL-W1 showed over-expression in regulation in cyp1a1, thus; not as high regulation in co-RTL-W1 co-RTgill-W1. Similar pattern was noticed in tnfα, il1β, cyp2k1, bcl and hsp90, whereas single cell lines indicated on higher fold change than co-cultured cell lines. Moreover, that may indicate on the function of co-culturing being more sensitive against exposure than the single cell lines

In real life context, the uptake of toxicants would go through exchange in the gills before distributed out in the body and detoxified in the liver. Moreover, the compounds being added into the wells directly on RTgill-W1 above RTL-W1, represent the physiological structure of the organism. Moreover, co-culture representing cell lines from major organ involved in toxic exchange may mimic and resemble real life organism (Newsted et al., 2008)

However, this study indicates on good data regarding indication of co-cultured cell lines being more sensitive. Still, more biological replicates are needed, as well statistics for significance.

5. Conclusion

RTL-W1 and RTgill exposed to BaP, PFBS and mixed compound in Neutral red assay did not indicate on any acute toxicity. Besides, the results showed an increasing cell viability in both RTL-W1 and RTgill-W1, compared to the control. Cells exposed to chemicals, tend to produce more lysosomes as they try to handle the stress. The neutral red dye are retained in the lysosomes and measured in percentage of living cells. RTL-W1 indicated on higher cell

(27)

24

viability exposed to BaP than RTgill-W1. Thus, exposure of PFBS showed a small difference in viability between RTL-W1 and RTgill-W1. Thus, testing acute toxicity using co-culture would be the next test.

When comparing gene expression using PFBS and BaP, and the two cell cultures, indications could be made comparing the results of gene regulation The aim of this study was to investigate whether difference could be observed in combination of using both single and co-culture. Moreover, the results regarding qPCR showed tendency of co-culture being more sensitive and therefore strengthen the theory of using co-culture for in vitro testing. Thus, up and downregulation of the genes varied in highest and lowest concentration, as well as between the cell lines. There is difficult to see any similarities whether up regulation of one gene is causing down regulation in another, for both BaP and PFBS.

6. Acknowledgements

I would like to express my special thanks to my supervisor, Steffen Keiter for this opportunity and who made this project possible. Thank you for your kind way of teaching, supporting and trusting me on doing this project independently.

Thank you Ernesto Alfaro-Moreno, with your expertise, knowledge and advisement took your time to teach me about cell culturing.

Thank you Nikolai Scherbak for trusting me to do all the practical lab work and your way of pushing me to take my own decisions and conclusions.

Last but not least, thanks to friends and family for always being supportive and believing in me.

(28)

25

7. References

Abdel-shafy, H. I., & Mansour, M. S. M. (2016). REVIEW A review on polycyclic aromatic hydrocarbons : Source , environmental impact , effect on human health and remediation. Egyptian Journal of Petroleum, 25(1), 107–123.

https://doi.org/10.1016/j.ejpe.2015.03.011

Backhaus, T., & Faust, M. (2012). Predictive environmental risk assessment of chemical mixtures: A conceptual framework. Environmental Science and Technology, 46(5), 2564–2573. https://doi.org/10.1021/es2034125

Barlian, N. C. B. A., & Caldwell, S. J. (1994). Development of a cell line from primary cultures of rainbow trout , Oncorhynchus mykiss ( Walbaum ), gills. 601–611.

Behera, B. K., Das, A., Sarkar, D. J., Weerathunge, P., Parida, P. K., Das, B. K., Thavamani, P., Ramanathan, R., & Bansal, V. (2018). Polycyclic Aromatic Hydrocarbons (PAHs) in inland aquatic ecosystems: Perils and remedies through biosensors and bioremediation. Environmental Pollution, 241, 212–233. https://doi.org/10.1016/j.envpol.2018.05.016 Behrens, A., Schirmer, K., Bols, N. C., & Segner, H. (2001). Polycyclic aromatic

hydrocarbons as inducers of cytochrome P4501A enzyme activity in the rainbow trout liver cell line, RTL-W1 and in primary cultures of rainbow trout hepatocytes.

Environmental Toxicology and Chemistry, 20(3), 632–643. https://doi.org/10.1002/etc.5620200324

Berry, R., & López-Martínez, G. (2020). A dose of experimental hormesis: When mild stress protects and improves animal performance. Comparative Biochemistry and Physiology -Part A : Molecular and Integrative Physiology, 242(January), 110658.

https://doi.org/10.1016/j.cbpa.2020.110658

Blanc, M., Kärrman, A., Kukucka, P., Scherbak, N., & Keiter, S. (2017). Mixture-specific gene expression in zebrafish (Danio rerio) embryos exposed to perfluorooctane sulfonic acid (PFOS), perfluorohexanoic acid (PFHxA) and 3,3′,4,4′,5-pentachlorobiphenyl (PCB126). Science of the Total Environment, 590–591, 249–257.

https://doi.org/10.1016/j.scitotenv.2017.02.232

Bopp, S. K., Bols, N. C., & Schirmer, K. (2006). Development of a solvent-free, solid-phase in vitro bioassay using vertebrate cells. Environmental Toxicology and Chemistry, 25(5), 1390–1398. https://doi.org/10.1897/05-374R.1

Borenfreund, E., & Puerner, J. A. (1985). A simple quantitative procedure using monolayer cultures for cytotoxicity assays (HTD/NR-90). Journal of Tissue Culture Methods, 9(1), 7–9. https://doi.org/10.1007/BF01666038

Bussolaro, D., Wright, S. L., Schnell, S., Schirmer, K., Bury, N. R., & Arlt, V. M. (2019). Co-exposure to polystyrene plastic beads and polycyclic aromatic hydrocarbon contaminants in fish gill (RTgill-W1) and intestinal (RTgutGC) epithelial cells derived from rainbow trout (Oncorhynchus mykiss). Environmental Pollution, 248, 706–714.

https://doi.org/10.1016/j.envpol.2019.02.066

(29)

26

analysis of ABC efflux transporters, CYP1A and GSTα in Nile tilapia after exposure to benzo(a)pyrene. Comparative Biochemistry and Physiology - C Toxicology and

Pharmacology, 155(3), 469–482. https://doi.org/10.1016/j.cbpc.2011.12.004

Cousin, X., & Cachot, J. (2014). PAHs and fish—exposure monitoring and adverse effects— from molecular to individual level. Environmental Science and Pollution Research, 21(24), 13685–13688. https://doi.org/10.1007/s11356-014-3161-8

Dent, M. P., Madnick, S. J., Hall, S., Vantangoli Policelli, M., Bars, C., Li, H., Amin, A., Carmichael, P. L., Martin, F. L., & Boekelheide, K. (2019). A human-derived prostate co-culture microtissue model using epithelial (RWPE-1) and stromal (WPMY-1) cell lines. Toxicology in Vitro, 60(May), 203–211. https://doi.org/10.1016/j.tiv.2019.05.023 Eriksen, K. T., Raaschou-Nielsen, O., Sørensen, M., Roursgaard, M., Loft, S., & Møller, P.

(2010a). Genotoxic potential of the perfluorinated chemicals PFOA, PFOS, PFBS, PFNA and PFHxA in human HepG2 cells. Mutation Research - Genetic Toxicology and Environmental Mutagenesis. https://doi.org/10.1016/j.mrgentox.2010.04.024

Eriksen, K. T., Raaschou-Nielsen, O., Sørensen, M., Roursgaard, M., Loft, S., & Møller, P. (2010b). Genotoxic potential of the perfluorinated chemicals PFOA, PFOS, PFBS, PFNA and PFHxA in human HepG2 cells. Mutation Research - Genetic Toxicology and Environmental Mutagenesis, 700(1–2), 39–43.

https://doi.org/10.1016/j.mrgentox.2010.04.024

Fent, K. (2001). Fish cell lines as versatile tools in ecotoxicology: Assessment of cytotoxicity, cytochrome P4501A induction potential and estrogenic activity of chemicals and

environmental samples. Toxicology in Vitro, 15(4–5), 477–488. https://doi.org/10.1016/S0887-2333(01)00053-4

Fotakis, G., & Timbrell, J. A. (2006). In vitro cytotoxicity assays: Comparison of LDH, neutral red, MTT and protein assay in hepatoma cell lines following exposure to cadmium chloride. Toxicology Letters, 160(2), 171–177.

https://doi.org/10.1016/j.toxlet.2005.07.001

Franco, M. E., & Lavado, R. (2019). Applicability of in vitro methods in evaluating the biotransformation of polycyclic aromatic hydrocarbons (PAHs) in fish: Advances and challenges. Science of the Total Environment, 671, 685–695.

https://doi.org/10.1016/j.scitotenv.2019.03.394

Galbis-Martínez, L., Fernández-Cruz, M. L., Alte, L., Valdehita, A., Rucandio, I., & Navas, J. M. (2018). Development of a new tool for the long term in vitro ecotoxicity testing of nanomaterials using a rainbow-trout cell line (RTL-W1). Toxicology in Vitro, 50(June 2017), 305–317. https://doi.org/10.1016/j.tiv.2018.04.007

Goers, L., Freemont, P., & Polizzi, K. M. (2014). Co-culture systems and technologies:

Taking synthetic biology to the next level. Journal of the Royal Society Interface, 11(96). https://doi.org/10.1098/rsif.2014.0065

Gomez Perez, M., Fourcade, L., Mateescu, M. A., & Paquin, J. (2017). Neutral Red versus MTT assay of cell viability in the presence of copper compounds. Analytical

Biochemistry, 535, 43–46. https://doi.org/10.1016/j.ab.2017.07.027

(30)

27

Materials Science and Engineering C, 29(6), 1855–1868. https://doi.org/10.1016/j.msec.2009.02.016

Häder, D. P., Banaszak, A. T., Villafañe, V. E., Narvarte, M. A., González, R. A., & Helbling, E. W. (2020). Anthropogenic pollution of aquatic ecosystems: Emerging problems with global implications. Science of the Total Environment, 713, 136586.

https://doi.org/10.1016/j.scitotenv.2020.136586

Haritash, A. K., & Kaushik, C. P. (2009). Biodegradation aspects of Polycyclic Aromatic Hydrocarbons (PAHs): A review. Journal of Hazardous Materials, 169(1–3), 1–15. https://doi.org/10.1016/j.jhazmat.2009.03.137

Hook, S. E., Skillman, A. D., Small, J. A., & Schultz, I. R. (2006). Gene expression patterns in rainbow trout, Oncorhynchus mykiss, exposed to a suite of model toxicants. Aquatic Toxicology, 77(4), 372–385. https://doi.org/10.1016/j.aquatox.2006.01.007

Hutchinson, T. H., Wheeler, J. R., Gourmelon, A., & Burden, N. (2016). Promoting the 3Rs to enhance the OECD fish toxicity testing framework. Regulatory Toxicology and Pharmacology, 76, 231–233. https://doi.org/10.1016/j.yrtph.2016.02.006

Jernbro, S., Rocha, P. S., Keiter, S., Skutlarek, D., Färber, H., Jones, P. D., Giesy, J. P., Hollert, H., & Engwall, M. (2007). Perfluorooctane sulfonate increases the genotoxicity of cyclophosphamide in the micronucleus assay with V79 cells. Further proof of

alterations in cell membrane properties caused by PFOS. Environmental Science and Pollution Research, 14(2), 85–87. https://doi.org/10.1065/espr2007.01.384

Katagi, T. (2020). In vitro metabolism of pesticides and industrial chemicals in fish. Journal of Pesticide Science, 45(1), 1–15. https://doi.org/10.1584/jpestics.d19-074

Knauer, K., Lampert, C., & Gonzalez-Valero, J. (2007). Comparison of in vitro and in vivo acute fish toxicity in relation to toxicant mode of action. Chemosphere, 68(8), 1435– 1441. https://doi.org/10.1016/j.chemosphere.2007.04.009

Krafft, M. P., & Riess, J. G. (2015). Per- and polyfluorinated substances (PFASs):

Environmental challenges. Current Opinion in Colloid and Interface Science, 20(3), 192–212. https://doi.org/10.1016/j.cocis.2015.07.004

Lammel, T., Tsoukatou, G., Jellinek, J., & Sturve, J. (2019). Development of

three-dimensional (3D) spheroid cultures of the continuous rainbow trout liver cell line RTL-W1. Ecotoxicology and Environmental Safety, 167(June 2018), 250–258.

https://doi.org/10.1016/j.ecoenv.2018.10.009

Lee, L. E. J., Clemons, J. H., Bechtel, D. G., Caldwell, S. J., Han, K. B., Pasitschniak-Arts, M., Mosser, D. D., & Bols, N. C. (1993). Development and characterization of a rainbow trout liver cell line expressing cytochrome P450-dependent monooxygenase activity. Cell Biology and Toxicology, 9(3), 279–294. https://doi.org/10.1007/BF00755606 Levine, S. L., & Oris, J. T. (1999). CYP1A expression in liver and gill of rainbow trout following waterborne exposure: Implications for biomarker determination. Aquatic Toxicology, 46(3–4), 279–287. https://doi.org/10.1016/S0166-445X(98)00124-6

Mandal, P. K. (2005). Dioxin: A review of its environmental effects and its aryl hydrocarbon receptor biology. Journal of Comparative Physiology B: Biochemical, Systemic, and

(31)

28

Environmental Physiology, 175(4), 221–230. https://doi.org/10.1007/s00360-005-0483-3 Menger, F., Pohl, J., Ahrens, L., Carlsson, G., & Örn, S. (2020). Behavioural effects and

bioconcentration of per- and polyfluoroalkyl substances (PFASs) in zebrafish (Danio rerio) embryos. Chemosphere, 245, 1–10.

https://doi.org/10.1016/j.chemosphere.2019.125573

Newsted, J. L., Beach, S. A., Gallagher, S. P., & Giesy, J. P. (2008). Acute and chronic effects of perfluorobutane sulfonate (PFBS) on the mallard and northern bobwhite quail. Archives of Environmental Contamination and Toxicology, 54(3), 535–545.

https://doi.org/10.1007/s00244-007-9039-8

Oeritz, I. N. A. G., Alk, S. A. F., Tahl, T. H. S., Chäfers, C. H. S., & Chlechtriem, C. H. S. (2013). BIOMAGNIFICATION AND TISSUE DISTRIBUTION OF PERFLUOROALKYL SUBSTANCES ( PFASs ) IN MARKET-SIZE RAINBOW TROUT ( ONCORHYNCHUS MYKISS ). 32(9), 2078–2088. https://doi.org/10.1002/etc.2279

Padhi, B. K., Pelletier, G., & Shwed, P. S. (2020). A bioinformatics workflow for the evaluation of RT-qPCR primer specificity: Application for the assessment of gene expression data reliability in toxicological studies. Regulatory Toxicology and Pharmacology, 111(January), 104575. https://doi.org/10.1016/j.yrtph.2020.104575 Rehberger, K., Kropf, C., & Segner, H. (2018). In vitro or not in vitro: a short journey through

a long history. Environmental Sciences Europe, 30(1). https://doi.org/10.1186/s12302-018-0151-3

Sadar, M. D., & Andersson, T. B. (2001). Regulation of cytochrome P450 in a primary culture of rainbow trout hepatocytes. In Vitro Cellular and Developmental Biology - Animal, 37(3), 180–184.

https://doi.org/10.1290/1071-2690(2001)037<0180:ROCPIA>2.0.CO;2

Schirmer, K. (2006). Proposal to improve vertebrate cell cultures to establish them as substitutes for the regulatory testing of chemicals and effluents using fish. Toxicology, 224(3), 163–183. https://doi.org/10.1016/j.tox.2006.04.042

Schirmer, K., Chan, A. G. J., & Bols, N. C. (2000). Transitory metabolic disruption and cytotoxicity elicited by benzo[a]pyrene in two cell lines from rainbow trout liver. Journal of Biochemical and Molecular Toxicology, 14(5), 262–276.

https://doi.org/10.1002/1099-0461(2000)14:5<262::AID-JBT5>3.0.CO;2-2

Shah, U. K., Seager, A. L., Fowler, P., Doak, S. H., Johnson, G. E., Scott, S. J., Scott, A. D., & Jenkins, G. J. S. (2016). A comparison of the genotoxicity of benzo[a]pyrene in four cell lines with differing metabolic capacity. Mutation Research - Genetic Toxicology and Environmental Mutagenesis, 808, 8–19. https://doi.org/10.1016/j.mrgentox.2016.06.009 Yuan, L., Lv, B., Zha, J., Wang, Z., Wang, W., Li, W., & Zhu, L. (2013). New cytochrome

P450 1B1, 1C1, 2Aa, 2Y3, and 2K genes from Chinese rare minnow (Gobiocypris rarus): Molecular characterization, basal expression and response of rare minnow CYP1s and CYP2s mRNA exposed to the AHR agonist benzo[a]pyrene. Chemosphere, 93(2), 209–216. https://doi.org/10.1016/j.chemosphere.2013.04.064