Identification of adenovirus new splice sites

(1)

Identification of adenovirus new

splice sites

Uzair Tauheed

(2)

2

Abstract

RNA splicing is a process where introns are removed and exons are joined together. Human adenovirus type 2 pre-mRNAs undergoes intensive alternative splicing and produce more than 40 differently spliced mRNAs. This thesis work is focused on the identification of new splice sites in adenovirus. By virtue of Illumina mRNA sequencing technology we have identified 255 splice sites. Splice site analysis of the introns revealed the presence of three types of splice sites GT-AG (61.2%), GC-AG (25.9%) and AT-AC (12.9%). Among 255 splice sites, 224 were new. Significantly, more than 50% of the new splice sites were located in the major late transcription unit on the positive strand of adenovirus DNA. Three new splice sites; 17452-29489 (GC-AG) located on the negative strand of adenovirus DNA in the E2 region, 9668-20346 (AT-AC) and 9699-30505 (GC-AG) on the positive strand of adenovirus DNA in the major late transcription unit were further confirmed by PCR analysis.

(3)

3

(4)

4

1. Introduction

1.1. Adenoviruses

Adenoviruses belong to Adenoviridae family, affecting a broad range of vertebrate hosts. Human adenoviruses are responsible for respiratory infections, gastroenteritis and conjunctivitis. Children are mostly affected with adenovirus infections compare to adults but usually adenoviruses are not considered highly pathogen. Adenoviruses were discovered accidentally when two different groups of scientist were looking for the causative agents of acute respiratory infections (Hilleman and Werner, 1954; Rowe et al., 1953).These agents were named ‘’adenoviruses’’ due to their source, adenoid tissue (Enders et al., 1956).

Based on the oncogenicity, agglutination, homology and immunological properties adenoviruses have been classified into seven subgroups from A to G and serotypes (Jones et al., 2007). Currently, more than 50 human adenovirus serotypes have been discovered. Human adenovirus type 2 (Ad2) and 5 (Ad5) of subgroup C are among the most widely studied human adenoviruses. Ad12 serotype of subgroup A has been found oncogenic in rodents. Fortunately at present none of adenovirus serotypes have been reported as oncogenic in humans (Zheng, 2010).

1.1.1. Genome organization

(7)

7

Depending on the serotypes, these multiple mRNAs encodes for 30-40 proteins. Adenovirus genes are arranged into three transcriptional units producing six early genes (E1A, E1B, E2A, E2B, E3 and E4), two intermediate genes (IX and IVa2) and five late genes (L1-L5). All these genes are transcribed by cellular RNA polymerase II (RNAP II) whereas, two genes virus-associated RNAs I and II (VA RNA I and VA RNA II) are transcribed by RNA polymerase III (RNAP III), (Pettersson and Roberts, 1986).

Figure 1. A genomic map of human adenovirus type 2. Early genes are represented by red bars, Intermediate

(8)

8 1.1.2. Life cycle

Virus attaches to the host cells with its fiber either to coxsackie adenovirus receptor (CAR) or CD46, depending on the adenovirus serotype (Bergelson et al., 1997; Gaggar et al., 2003). Penton base then combines with secondary integrin family of host cell receptors and virus enters the cell through receptor-mediated endocytosis (Wickham et al., 1993). Inside the endosome, virus particle dissociates due to low pH of endosome and cleavage activity of viral L3 protease (Cotten and Weber, 1995; Greber et al., 1993). Subsequently, by disruption in endosome virus particle is released into the cytoplasm. The capsid reaches to the nuclear pore by travelling over the microtubules and releases viral DNA inside the nucleus (Greber et al., 1997). The lytic type of viral replication cycle is divided into early and late phases separated by the onset of viral DNA replication. In HeLa cells early phase of infection lasts for about 5-8 hours and viral DNA replication starts about 6-10 hours post infection. The virus completes its infectious cycle in about 36 hours releasing approximately 104 progeny of virus particles per cell (Green and Daesch, 1961).

1.1.3. Adenovirus gene expression

Adenovirus gene expression is a temporally regulated event. Some genes are predominant at early times of infection and others dominate at late stages of infection. Majority of the early gene products are regulatory proteins whose prime function is to push host cell into S phase and to block antiviral response whereas late gene products are mostly structural proteins.

1.1.3.1. Early genes

(9)

9

interacting with tumor suppressor retinoblastoma protein (pRB) and thereby releasing cellular transcription factor (E2F) resulting into the activation of several cellular genes responsible for S phase induction (Johnson et al., 1993). E1B proteins block the p53-dependent apoptosis (Debbas and White, 1993) and also switch off the host cell proteins synthesis by interfering with host mRNAs transport and allowing only transport of viral mRNA transcripts (Pilder et al., 1986). E2 genes encode proteins involve in viral DNA replication. E2 transcriptional unit is subdivided into E2A and E2B regions. The transcript is temporally regulated by using different promoters. Thus, in early infection stage transcription starts from early promoter region and at late stage of infection it starts from late promoter. E2A region encodes single stranded DNA binding protein (ssDBP) and viral DNA polymerase (Ad-pol) while E2B region encodes pre-terminal protein (pTB), which works as primer-protein for DNA replication (Mysiak et al., 2004). E3 transcriptional unit encodes proteins that interact with host cell immune system (Gooding et al., 1990). E3-19K down regulates the expression of major histocompatibility complex class I (MHC-I) antigens on virus infected cells by virtue of which they hide themself from being recognized by cytotoxic T-cells (Wold et al., 1995).

(10)

10

1.1.3.2. Late genes

Generally, MLTU encodes structural proteins required for virion formation. The major late transcription unit (MLTU) makes a pre-mRNA of 28,000 nucleotides. By RNA splicing this single primary transcript produces about 20 mRNAs. They are grouped into five mRNAs families from L1 to L5. All these alternatively spliced mRNAs contains co-terminal 3’ ends. At 5’ end of each transcribed mRNA is a common tripartite leader sequence. This tripartite leader includes leader 1, leader 2 and leader 3 sequences, and also the (i) leader specifically present in the 52,55K mRNA transcript during early times of infection. During early stage of virus infection the MLTU promoter is as active as other early transcription units (Nevins and Wilson, 1981). However, most of the RNA polymerases terminate transcription before L2 poly (A) (Larsson et al., 1992). At late stage of infection after the onset of viral DNA replication, mRNA levels from the MLTU increases sharply because this time RNA polymerase is allowed to transcribe the entire late transcription unit generating five families of mRNAs from L1 to L5. Late MLTU mRNAs accumulation is also controlled at the level of poly (A) site selection and alternative splicing (Akusjarvi and Persson, 1981).

1.2. RNA splicing

A precursor messenger RNA (pre-mRNA) is transcribed by RNA polymerase II from DNA. The pre-mRNA undergoes RNA processing before it leaves the nucleus and transported to the cytoplasm for translation into proteins. Processing of pre-mRNA is a three step procedure; 5’ capping, 3’ end cleavage/polyadenylation followed by RNA splicing (Figure 2).

(11)

11

degradation (Furuichi et al., 1977; Lewis et al., 1995) and helps in transportation from nucleus to cytoplasm (Colgan and Manley, 1997; Hamm and Mattaj, 1990). In eukaryotes about 90 % of the proteins coding genes consist of coding (exons) and non-coding sequences (introns) (Wang et al., 2008). The pre-mRNA becomes mature when these intervening introns are removed and exons are joined together. Now this fully functional mature mRNA is ready for transport to the cytoplasm for protein translation. Pre-mRNA splicing was discovered for the first time in adenoviruses. In 1977 two independent research groups were working on adenovirus mRNAs structures. They found that adenovirus late gene mRNA transcripts were encoded by discontinuous segments (split genes) on the viral genome (Berget et al., 1977; Chow et al., 1977). Soon after the discovery of split genes and pre-mRNA splicing in adenoviruses scientists found the same phenomena in cellular genes as well (Rabbitts and Forster, 1978).

Figure 2. Summary of pre-mRNA processing. In eukaryotes pre-mRNA processing takes place in three steps,

5’capping, 3’ cleavage/polyadenylation and RNA splicing (Adopted: Lodish, Molecular Cell Biology, Fifth Edition)

1.2.1. Adenovirus alternative splicing

(12)

12

of 1 to 3 introns, except polypeptide IX mRNA which has no introns (Alestrom et al., 1980). However, fiber mRNA also contains three auxiliary leaders X, Y and Z which becomes mature after the removal of 6 introns (Chow and Broker, 1978). Adenoviruses produce multiple alternatively spliced mRNAs encoding about 40 proteins having more than 59 splice sites (NCBI Reference Sequence: AC_000007.1). In humans about 95 % of multi-exon genes from six different tissues; brain, cerebral cortex, skeletal muscle, heart lung and liver undergo alternative splicing (Pan et al., 2008). Alternative splicing also has been found in about 60% of Drosophila melanogaster genes (Graveley et al., 2011), 25 % of Caenorhabditis elegans genes (Ramani et al., 2011) and in plants about 42 % of Arabidopsis thaliana genes (Filichkin et al., 2010). Alternative splicing events are of many types (Kim et al., 2008) illustrated in figure 3.

Figure 3. Types of alternative splicing. Exons are representd by colored boxes and thin black lines inbetween as

(13)

13 1.2.2. Consensus sequences in pre-mRNA

Consensus sequences in a pre-mRNA define the exon and intron borders. The border between an exon and an intron is denoted by 5’ splice site whereas; intron/exon border is denoted by 3’ splice site. The 5’ splice site is also named splice donor and 3’ splice site splice acceptor (Figure 4). At the 5’ end of the intron a GU dinucleotide is present whereas, at the 3’ end of the intron, three sequence elements are present; the branch point, the pyrimidine rich region and an AG dinucleotide. The distance between branch (A) point and 3’ splice site is about 20-50 bases. A pyrimidine rich region of 10-15 bases is present between branch point and 3’ splice site (Will and Luhrmann, 2011).

Figure 4. Consensus sequences in a pre-mRNA. Exons and introns are shown as separate boxes. GU-AG at the

start and end of intron are represent red, bold underline letters. Branch point and pyrimidine rich tract are also shown. Y= pyrimidine (Adopted: Will, C. L., and R. Luhrmann. 2011. Spliceosome structure and function. Cold Spring Harb Perspect Biol 3).

1.2.3. Splicing mechanism and spliceosome

(14)

14

pyrimidine rich region and recruits U2 snRNP to the complex which forms base pairing with branch point (Figure 5). Extensive base paring between U4, U6 and U5 snRNPs forms a complex which then joins to already form U1, U2 and pre-mRNA complex resulting into the formation of spliceosome. Rearrangements in the paring of snRNAs and pre-mRNA consequently release U1 and U4 snRNPs. This spliceosome is now catalytically active and splicing is completed by two transesterification reactions. The first transesterification reaction breaks the pre-mRNA at 5’ splice site and forms 2’-5’ phosphodiester bond between 2’ hydroxyl of branch site and the phosphate at 5’ end of the intron. The second transesterification reaction joins the two exons by 3’-5’ phosphodiester bond. The reaction starts when the 3’ hydroxyl of the first exon attacks on the 3’ splice site consequently release the intron as a lariat structure along with snRNPs. The complex formed between intron and snRNPs dissociates and free snRNPs can participate in the new splicing cycle. The lariat intron structure is degraded further by debranching enzyme (Butcher and Brow, 2005).

Figure 5. Mechanism of spliceosome mediated splicing of pre-mRNA. snRNPs are denoted by colored circles,

exons 1 as red box and exon 2 as black box. Intron is shown as blue string with A (branch A site). Adopted: Villa, T., Pleiss, J.A., and Guthrie, C. 2002. Spliceosomal snRNAs: Mg (2+)-dependent chemistry at the catalytic core? Cell 109: 149-152)

1.3. Aim of the project

(15)

15

2. Materials and methods

2.1. RNA samples

RNA samples were obtained from the previous project (Zhao et al., 2012) where, human primary lung fibroblast cells (IMR-90) were infected with Ad2 virus. Infected cells were collected at 6, 12, 24, 36 and 48 hours post infection (hpi). Similarly, mock-uninfected cells were also collected at the same intervals. Total RNA was extracted using TRIZOL reagent (Invitrogen). However, only four types of RNA samples (mock, Ad-12h, Ad-24h and Ad-36) were used in the current project.

2.2. cDNA synthesis

The cDNA synthesis of mock, Ad-12h and Ad-24 RNA was performed using M-MLV reverse transcriptase Kit (Sigma®). 1µg of RNA was added to 4µl of 2.5mM dNTPs and 1µl of 50µM Oligo (dT)₂₀ and denatured at 70oC for 10 minutes, then placed on ice immediately for 5 min. Reverse transcriptase mixture containing 2µl of 10x M-MLV reverse transcriptase buffer, 1µl of M-MLV reverse transcriptase enzyme and 0.5µl of RNase inhibitor (40units/µl) was added to denatured RNA. Reverse transcription reaction was proceeded at 25oC for 10 minutes, 37oC for 50 minutes, 85oC for 10 minutes. cDNA was stored at -20 oC for future use.

2.3. Primers

(16)

16

Table 1. List of designed primers

Splice site Primer name Sequence 5'>3' Primer length (bp) Amplicon (bp) 17452-29489 (ss29m) PP1-F AGTCCGTTGTGGGCGCGATG 20 131 PP1-R GGTGCAAACGGACCCGTGGA 20 24089-35547 (ss35m) PP2-F AATAGGTTTTTTTACTGGAGAAGGA 25 115 PP2-R GACACGTCCTCCATGGTTG 19 9668-20346 (ss20p) PP3-F TGAGCGAGTCCGCAACCCC 19 123 PP3-R CAGCGCGCCCCAAGGTTAATG 21 9699-30505 (ss30p) PP4-F ACCTCTCGAGAAAGGCGCAAGG 22 127 PP4-R AGGTAAGTTTGGCCTGCTTGACCAC 25 3437-9658 (ss9p) PP5-F TCTGGAAGGTGCTGAGGTACGAT 23 124 PP5-R GATGCGGACTCGCTCAGCTC 20

2.4. Polymerase Chain Reaction (PCR)

(17)

17

3. Results and discussion

3.1. Identification of adenovirus new splice sites by RNA sequencing

Illumina mRNA sequencing technology was employed to study the transcriptome of Ad2 infected IMR-90 cells. Three cDNA libraries of mock, Ad2-12hpi and Ad2-24hpi were prepared. The sequencing data generated 50-54 million 76 bp long sequence reads per sample. These reads were then aligned to human and Ad2 reference genomes (Zhao et al., 2012). Alignment of sequencing reads to the adenovirus reference genome resulted in the identification of 2228 splice sites. Significantly, 255 splice sites had more than 100 reads and were analyzed further. Among them, 236 splice sites were present at 24 hpi and only 23 splice sites were present at 12hpi. This correlated with the progression of adenovirus infection in which only immediate early adenovirus genes E1A were expressed at 12hpi, whereas the late viral genes began to be expressed from 24 hpi (Granberg et al., 2006). Furthermore, more than 70% of splice sites located on the positive strand of Ad2 DNA, whereas only 76 located on the negative strand of Ad2 DNA (Table 2).

Table 2. Summary of splice site analysis

Total splice sites Ad2 DNA strand

Number of splice sites

Types of splice site Number of splice sites % age 255 Positive 179 GT-AG 114 63.7% GC-AG 38 21.2 % AT-AC 27 15.1% Negative 76 GT-AG 42 55.3% GC-AG 28 36.8% AT-AC 6 7.9%

(18)

18

the rare types of splice sites (GC-AG and AT-AC) in Ad2 were present at higher percentage as compare to human introns. In humans 99% of introns contain GT-AG splice site and less frequently GC-AG and AT-AC type with 0.8% and 0.008% respectively (Abril et al., 2005).

According to Ad2 reference genome [http://www.ncbi.nlm.nih.gov/nuccore/9626158, 10th march 2011] there are 59 well-known splice site and 31 of them were detected here with more than 100 reads, whereas, 224 splice sites have not been shown previously. The distribution of these new splice sites was shown in Figure 6. The most significant was a group of 38 splice sites with a common 5’ end at 9724 which contain 28 new splice sites. A small cluster of splice sites with common 5’end at 9701 also had considerable number of sequence reads. However, these new splice site had less number of reads compare to known splice sites with exception of splice site 3437-9658, which had more than 18108 reads. Only 30% of the new splice sites were located on the negative strand of Ad2 DNA and most of them positioned in the E2 region.

Figure 6 Alignment of new splice junctions over Ad2 genome. Splice junctions are represented by red bars.

(19)

19 3.2. PCR analysis for new splice sites

Primers with specified criteria were designed for PCR. To amplify a splice site, a splice site specific primer (encompassing splice site) and a counter primer, 3’ or 5’ end of the splice site were designed by Primer-BLAST. Forward primer encompasses the splice site when the purpose was to amplify a segment downstream (towards 3’ direction) of the splice site. In contrast, a reverse primer encompasses the splice site when the purpose was to amplify a segment upstream (towards 5’ direction) of the splice site.

(20)

20

Table 3. Selected splice sites

Primer Name

Infection Splice site Reads Splice junction DNA strand

PP1 12hpi 17452-29489 (ss29m) 3198 GC-AG Negative

PP2 12hpi 24089-35547 (ss35m) 3180 GT-AG Negative

PP3 24hpi 9668-20346 (ss20p) 1214 AT-AC Positive

PP4 24hpi 9699-30505 (ss30p) 4054 GC-AG Positive

PP5 24hpi 3437-9658 (ss9p) 18108 GC-AG Positive

Three primer pairs PP3, PP4 and PP5 were designed for the splice sites 9668-20346 (ss20p), 9699-30505 (ss30p) and 3437-9658 (ss9p) and all these splices sites were present on the positive strand of Ad2 DNA (Figure 7). Splice sites ss20p and ss30p were in the MLTU region of Ad2 genome and splice site ss9p was in E1B region. Two primer pairs PP1 and PP2 were designed for the splice sites 17452-29489 (ss29m) and 24089-35547 (ss35m) and were present on the negative strand of Ad2 DNA. Splice site ss29m was present in E2 region and splice site ss35m was present in E4 region.

Figure 7. Annotated map of designed primers. Primers are denoted by thick colored arrows. Each primer pair

(21)

21

To confirm the existence of new splice sites in adenovirus, a PCR was performed. A total of 5 new splice sites were tested in the run which include ss29m, ss35m, ss20p, ss30p and ss9p. In addition to 5 new splice sites, Proliferating cell nuclear antigen (PCNA) eukaryotic gene and E2A viral gene were used as positive control in the same PCR run. The samples used in this experiment were mock and Ad-36h cDNA as shown in figure 8.

PCNA is a well-known gene in eukaryotic cells which forms DNA clam a protein fold which acts as processitivity factor for DNA polymerase enzyme. PCNA gene was amplified more in infected cells as compare to mock-uninfected cells (lane 3 and lane 2), which showed that the PCNA gene in eukaryotic cells has been expressed and up-regulated during the course of adenovirus infection. The up-regulation of PCNA gene expression after adenovirus infection has been reported in IMR-90 cells (Zhao et al., 2012). E2A region in adenovirus produces single stranded DNA binding protein (ssDBP) which binds to the newly synthesized DNA strand (Stuiver and van der Vliet, 1990). Viral E2A gene was amplified in Ad-36h sample (lane 15) which showed that the adenovirus infection to the IMR-90 cells was performed correctly.

Three tested new splice sites ss29m, ss20p and ss30p out of five new splice sites produced PCR products in Ad36h samples (lane 5, 11 and 13) of the correct sizes corresponding to the 100bp fragment of the DNA marker. However the remaining two tested new splice sites ss35m and ss9p were not amplified in either mock or Ad-36h samples (lane 6-9) of corresponding sizes to the 100bp fragment of DNA marker.

(22)

22

this PCR which was present on the positive strand of Ad2 DNA in the E1B region. Although ss9p had the high number of reads (18108) but this splice site had shown no PCR amplification. This could be because ORF analysis for this splice site had not predicted any putative protein start site downstream to the splice site and the primer pair for this splice site was designed for upstream putative protein start site. It could also possible that the primer pair didn’t work for the amplification of this splice site or this splice site does not exist.

Figure 8. PCR results for PCNA, E2A and new splice sites. Mock and Ad-36h templates are shown on the top.

Lane M: is DNA marker where the last band in the bottom is 50bp. Lane 2-3: shows PCR products of PCNA gene. Lane 4-13 shows PCR products for new splice sites. Lane 14-15 shows E2A gene PCR products.

(23)

23

positive strand of Ad2 DNA in the MLTU region and contains rare type of splice sites AT-AC and GC-AG, respectively. The presented results for the newly confirmed splice sites demonstrated that adenovirus mRNAs also contains rare types of splice sites GC-AG and AT-AC along with a common type of splice site GT-AG. Though, pre-mRNA splicing with rare types of splice sites has not been reported in adenovirus. Splicing of major type of introns GT-AG and GC-AG is performed by the U2-dependent spliceosome machinery whereas splicing of minor types of introns AT-AC is performed by the dependent spliceosome machinery (Will and Luhrmann, 2005). Both U2 and U12-dependent spliceosome machineries coexist in the eukaryotic cells (Burge et al., 1998) and adenovirus has the equal chance to utilize these machineries for splicing its pre-mRNA. In this case adenovirus might also had taken advantage of U12-dependent spliceosome machineries and spliced its pre-mRNA with rare type of splice sites. It is not clear if this rare type of splice site usage by adenovirus has any influence on cellular genes splicing as well. Cellular gene splicing could be addressed from our mRNA sequencing data obtain from the transcriptome of adenovirus infected cells but that was beyond the focus of this research work.

(24)

24

4. Conclusions

(25)

25

5. Acknowledgment

Thanks to Allah Almighty, the most Gracious, the most Compassionate, Who blessed me strength in completing this thesis and finishing my master degree in Infection Biology. All of my devolutions and tributes to our Holy Prophet Muhammad (PBUH) for his teachings to recognize our Creator

I would like to express my sincere gratitude to Hongxing Zhao for her supervision, guidance, teachings, motivation and introducing the world of splicing. Thanks to Ulf Pettersson for allowing me to do my degree project in his group.

Thanks to Catharina Svensson for coordinating Infection Biology program and for critical reading of written thesis. Thanks to Göran Akusjärvi for permission to use adenovirus genome map and sharing of great ideas and his lectures in the course of the degree.

Thanks to Muhammad Akhtar Ali for his ideas, knowledge sharing and reading my thesis. Thanks to Sara Lind and Liodmila Elfineh my research group mates for providing nice working environment in the lab and Mårten Linden for helping me with computer and technical difficulties anytime I needed.

Thanks to all my teachers for their precious lectures in the degree courses of Infection Biology particularly, Anna Lunden for her supervision in the research training.

Thanks to all my friends especially, Muhammad Ishaq, Asif Rashid, Aqib Hayat, Zulqarnain, Tanvir Ahmad, Shahzad Gul, Imran Iqbal, Rizwan Khan, Sohaib Zafar Malik, Gul Mir, Irfan Shaukat, Babar Ali and others not mentioned, not forgotten for their company, pleasure, maintaining Pakistani culture, fantastic foods, parties and Chit Chat.

Finally, I have dedicated my thesis to my lovely parents (Tauheed Ahmad and Zia-ul-Qamar) and all my family members. I would like to give special thanks to my elder brothers Faraz Tauheed and Jawad Tauheed for their unconditional support wherever and whenever I needed their help.

LA ILAHA ILLA ANTA SUBHANAKA INNI KUNTU MINAZ ZALIMEEN

“None has the right to be worshipped but You (O Allah), Glorified (and Exalted) are You (above all that (evil) they associate with You). Truly, I have been of the wrong-doers."

(26)

26

6. References

Abril, J.F., Castelo, R., Guigo, R., 2005. Comparison of splice sites in mammals and chicken. Genome research 15, 111-119.

Akusjarvi, G., Persson, H., 1981. Controls of RNA splicing and termination in the major late adenovirus transcription unit. Nature 292, 420-426.

Alestrom, P., Akusjarvi, G., Perricaudet, M., Mathews, M.B., Klessig, D.F., Pettersson, U., 1980. The gene for polypeptide IX of adenovirus type 2 and its unspliced messenger RNA. Cell 19, 671-681.

Andersson, M.G., Haasnoot, P.C., Xu, N., Berenjian, S., Berkhout, B., Akusjarvi, G., 2005. Suppression of RNA interference by adenovirus virus-associated RNA. J Virol 79, 9556-9565.

Bergelson, J.M., Cunningham, J.A., Droguett, G., Kurt-Jones, E.A., Krithivas, A., Hong, J.S., Horwitz, M.S., Crowell, R.L., Finberg, R.W., 1997. Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science 275, 1320-1323.

Berget, S.M., Moore, C., Sharp, P.A., 1977. Spliced segments at the 5' terminus of adenovirus 2 late mRNA. Proceedings of the National Academy of Sciences of the United States of America 74, 3171-3175.

Burge, C.B., Padgett, R.A., Sharp, P.A., 1998. Evolutionary fates and origins of U12-type introns. Molecular cell 2, 773-785.

Butcher, S.E., Brow, D.A., 2005. Towards understanding the catalytic core structure of the spliceosome. Biochemical Society transactions 33, 447-449.

(27)

27

Chow, L.T., Gelinas, R.E., Broker, T.R., Roberts, R.J., 1977. An amazing sequence arrangement at the 5' ends of adenovirus 2 messenger RNA. Cell 12, 1-8.

Colgan, D.F., Manley, J.L., 1997. Mechanism and regulation of mRNA polyadenylation. Gene Dev 11, 2755-2766.

Cotten, M., Weber, J.M., 1995. The Adenovirus Protease Is Required for Virus Entry into Host-Cells. Virology 213, 494-502.

Debbas, M., White, E., 1993. Wild-Type P53 Mediates Apoptosis by E1a, Which Is Inhibited by E1b. Gene Dev 7, 546-554.

Enders, J.F., Bell, J.A., Dingle, J.H., Francis, T., Jr., Hilleman, M.R., Huebner, R.J., Payne, A.M., 1956. Adenoviruses: group name proposed for new respiratory-tract viruses. Science 124, 119-120.

Filichkin, S.A., Priest, H.D., Givan, S.A., Shen, R., Bryant, D.W., Fox, S.E., Wong, W.K., Mockler, T.C., 2010. Genome-wide mapping of alternative splicing in Arabidopsis thaliana. Genome research 20, 45-58.

Furuichi, Y., LaFiandra, A., Shatkin, A.J., 1977. 5'-Terminal structure and mRNA stability. Nature 266, 235-239.

Gaggar, A., Shayakhmetov, D.M., Lieber, A., 2003. CD46 is a cellular receptor for group B adenoviruses. Nat Med 9, 1408-1412.

Galabru, J., Katze, M.G., Robert, N., Hovanessian, A.G., 1989. The binding of double-stranded RNA and adenovirus VAI RNA to the interferon-induced protein kinase. European journal of biochemistry / FEBS 178, 581-589.

(28)

28

Granberg, F., Svensson, C., Pettersson, U., Zhao, H.X., 2006. Adenovirus-induced alterations in host cell gene expression prior to the onset of viral gene expression. Virology 353, 1-5.

Graveley, B.R., Brooks, A.N., Carlson, J., Duff, M.O., Landolin, J.M., Yang, L., Artieri, C.G., van Baren, M.J., Boley, N., Booth, B.W., Brown, J.B., Cherbas, L., Davis, C.A., Dobin, A., Li, R.H., Lin, W., Malone, J.H., Mattiuzzo, N.R., Miller, D., Sturgill, D., Tuch, B.B., Zaleski, C., Zhang, D.Y., Blanchette, M., Dudoit, S., Eads, B., Green, R.E., Hammonds, A., Jiang, L.C., Kapranov, P., Langton, L., Perrimon, N., Sandler, J.E., Wan, K.H., Willingham, A., Zhang, Y., Zou, Y., Andrews, J., Bickel, P.J., Brenner, S.E., Brent, M.R., Cherbas, P., Gingeras, T.R., Hoskins, R.A., Kaufman, T.C., Oliver, B., Celniker, S.E., 2011. The developmental transcriptome of Drosophila melanogaster. Nature 471, 473-479.

Greber, U.F., Suomalainen, M., Stidwill, R.P., Boucke, K., Ebersold, M.W., Helenius, A., 1997. The role of the nuclear pore complex in adenovirus DNA entry. Embo J 16, 5998-6007.

Greber, U.F., Willetts, M., Webster, P., Helenius, A., 1993. Stepwise dismantling of adenovirus 2 during entry into cells. Cell 75, 477-486.

Green, M., Daesch, G.E., 1961. Biochemical studies on adenovirus multiplication. II. Kinetics of nucleic acid and protein synthesis in suspension cultures. Virology 13, 169-176.

Hamm, J., Mattaj, I.W., 1990. Monomethylated cap structures facilitate RNA export from the nucleus. Cell 63, 109-118.

(29)

29

Hilleman, M.R., Werner, J.H., 1954. Recovery of new agent from patients with acute respiratory illness. Proc Soc Exp Biol Med 85, 183-188.

Johnson, D.G., Schwarz, J.K., Cress, W.D., Nevins, J.R., 1993. Expression of transcription factor E2F1 induces quiescent cells to enter S phase. Nature 365, 349-352.

Jones, M.S., Harrach, B., Ganac, R.D., Gozum, M.M.A., dela Cruz, W.P., Riedel, B., Pan, C., Delwart, E.L., Schnurr, D.P., 2007. New adenovirus species found in a patient presenting with gastroenteritis. J Virol 81, 5978-5984.

Kim, E., Goren, A., Ast, G., 2008. Alternative splicing: current perspectives. BioEssays : news and reviews in molecular, cellular and developmental biology 30, 38-47.

Larsson, S., Svensson, C., Akusjarvi, G., 1992. Control of adenovirus major late gene expression at multiple levels. Journal of molecular biology 225, 287-298.

Levine, A., Durbin, R., 2001. A computational scan for U12-dependent introns in the human genome sequence. Nucleic acids research 29, 4006-4013.

Lewis, J.D., Gunderson, S.I., Mattaj, I.W., 1995. The influence of 5' and 3' end structures on pre-mRNA metabolism. Journal of cell science. Supplement 19, 13-19.

Mysiak, M.E., Holthuizen, P.E., van der Vliet, P.C., 2004. The adenovirus priming protein pTP contributes to the kinetics of initiation of DNA replication. Nucleic acids research 32, 3913-3920.

Nevins, J.R., 1981. Mechanism of activation of early viral transcription by the adenovirus E1A gene product. Cell 26, 213-220.

(30)

30

Pan, Q., Shai, O., Lee, L.J., Frey, B.J., Blencowe, B.J., 2008. Deep surveying of alternative splicing complexity in the human transcriptome by high-throughput sequencing. Nature genetics 40, 1413-1415.

Pettersson, U., Roberts, R.J., 1986. Adenovirus gene expression and replication: A historical review. Cancer Cells 4, 37–57.

Pilder, S., Moore, M., Logan, J., Shenk, T., 1986. The adenovirus E1B-55K transforming polypeptide modulates transport or cytoplasmic stabilization of viral and host cell mRNAs. Molecular and cellular biology 6, 470-476.

Querido, E., Blanchette, P., Yan, Q., Kamura, T., Morrison, M., Boivin, D., Kaelin, W.G., Conaway, R.C., Conaway, J.W., Branton, P.E., 2001. Degradation of p53 by adenovirus E4orf6 and E1B55K proteins occurs via a novel mechanism involving a Cullin-containing complex. Gene Dev 15, 3104-3117.

Rabbitts, T.H., Forster, A., 1978. Evidence for noncontiguous variable and constant region genes in both germ line and myeloma DNA. Cell 13, 319-327.

Ramani, A.K., Calarco, J.A., Pan, Q., Mavandadi, S., Wang, Y., Nelson, A.C., Lee, L.J., Morris, Q., Blencowe, B.J., Zhen, M., Fraser, A.G., 2011. Genome-wide analysis of alternative splicing in Caenorhabditis elegans. Genome research 21, 342-348.

Roberts, R.J., O'Neill, K.E., Yen, C.T., 1984. DNA sequences from the adenovirus 2 genome. The Journal of biological chemistry 259, 13968-13975.

Rowe, W.P., Huebner, R.J., Gilmore, L.K., Parrott, R.H., Ward, T.G., 1953. Isolation of a cytopathogenic agent from human adenoids undergoing spontaneous degeneration in tissue culture. Proc Soc Exp Biol Med 84, 570-573.

(31)

31

Tigges, M.A., Raskas, H.J., 1984. Splice junctions in adenovirus 2 early region 4 mRNAs: multiple splice sites produce 18 to 24 RNAs. J Virol 50, 106-117.

Virtanen, A., Gilardi, P., Naslund, A., LeMoullec, J.M., Pettersson, U., Perricaudet, M., 1984. mRNAs from human adenovirus 2 early region 4. J Virol 51, 822-831.

Wang, E.T., Sandberg, R., Luo, S., Khrebtukova, I., Zhang, L., Mayr, C., Kingsmore, S.F., Schroth, G.P., Burge, C.B., 2008. Alternative isoform regulation in human tissue transcriptomes. Nature 456, 470-476.

Wickham, T.J., Mathias, P., Cheresh, D.A., Nemerow, G.R., 1993. Integrins alpha v beta 3 and alpha v beta 5 promote adenovirus internalization but not virus attachment. Cell 73, 309-319.

Will, C.L., Luhrmann, R., 2005. Splicing of a rare class of introns by the U12-dependent spliceosome. Biological chemistry 386, 713-724.

Will, C.L., Luhrmann, R., 2011. Spliceosome structure and function. Cold Spring Harbor perspectives in biology 3.

Wold, W.S., Tollefson, A.E., Hermiston, T.W., 1995. E3 transcription unit of adenovirus. Current topics in microbiology and immunology 199 ( Pt 1), 237-274.

Zhao, H., Dahlo, M., Isaksson, A., Syvanen, A.C., Pettersson, U., 2012. The transcriptome of the adenovirus infected cell. Virology 424, 115-128.

Identification of adenovirus new splice sites