Min MA
Degree project inapplied biotechnology, Master ofScience (2years), 2010 Examensarbete itillämpad bioteknik 45 hp tillmasterexamen, 2010
Complement and CpG, how do they interact?
Min MA Summary
Various components of the immune system work together to defend us against invading pathogens. The complement system is a key part of the innate immunity.
Recent studies in a human whole blood loop system indicated that complement activation and toll-like receptor (TLR)-9 stimulation interplay and without complement activation, TLR-9 induced immune activation doesn’t take place[1].
Reports by others, in murine models, have shown that TLRs and complement are tightly linked [2]. TLR-4 stimulation in a decay-accelerating factor (DAF) deficient mouse, with an “uncontrolled” complement system, results in synergistic effects on cytokine production [3]. Considering that dendritic cells (DCs) are a source of
complement proteins [4], I set out to evaluate if cytosine-guanosine nucleotide (CpG) can induce the synthesis of complement proteins in DCs. This has been shown to happen when using lipopolysaccharides (LPS) stimuli [4].
Thus, this project evaluated the capacity of CpG 2006 stimulate human
monocyte-derived DCs to increase their production of complement proteins. The DCs used in this study were differentiated from blood monocytes using GM-CSF and IL-4.
DCs stimulated with LPS, as a positive control, were used to compare the expression levels of complement factors after CpG stimuli. Levels of complement products were analyzed by PCR and ELISA.
Results from my studies indicate that immature monocyte-derived DCs can enhance their production of complement proteins upon TLR-9 stimulation. As complement components mainly circulate with the blood in our body, DCs producing complement could potentially be a local source of complement factors at the site of CpG 2006 injection, thus affecting the immune response.
Index
Complement and CpG, how do they interact? ... - 1 -
Summary ... - 1 -
Introduction ... - 3 -
The innate and the adaptive immune system ... - 3 -
Complement system ... - 4 -
Dendritic cells ... - 5 -
Complement and DCs ... - 5 -
Toll-like Receptors... - 6 -
CpG ... - 7 -
CpG activation mechanisms ... - 9 -
Complement system and CpG ... - 10 -
Lipopolysaccharides ... - 11 -
Enzyme-linked Immunosorbent Assay (ELISA) ... - 11 -
Flow cytometry ... - 12 -
Aim of the study... - 13 -
Result ... - 14 -
DCs phenotype ... - 14 -
Complement mRNA expression ... - 15 -
Complement protein production ... - 17 -
Discussion ... - 19 -
Material and Methods ... - 20 -
Reagents ... - 20 -
Preparation and culture of cells ... - 21 -
Flow Cytometry ... - 21 -
RNA extraction ... - 21 -
cDNA synthesis ... - 21 -
PCR ... - 22 -
ELISA ... - 22 -
Reference ... - 22 -
Acknowledgments... - 27 -
Introduction
During the long evolution process, animals developed various defense mechanisms to protect themselves from infectious agents. Those mechanisms combined to establish a state of immunity against infections [5]. In1997, Yoshiaki and colleagues reported that both innate and antigen specific immunity could be activated by unmethylated cytosine-guanosine nucleotide (CpG) dinucleotides in bacterial DNA [6]. After that scientists started to investigate the immunostimulatory mechanisms of CpG and its application in the clinic. Recent advances in the toll-like receptor (TLR)/complement field show that CpG 2006 induced immune response interplay with the complement system [1]. Dendritic cells (DCs) were proven to be one source of complement production apart from the liver production [4]. In this project, I wanted to investigate how CpG 2006 mediates human monocyte-derived DCs in the complement
production, such as factor (F) B, FD and complement component (C) 3 in vitro.
The innate and the adaptive immune system
The innate immune system is composed of the external barriers and a branch of humoral system. It recognizes and responds to the pathogens, work as the first
protective barrier against infections. Once the pathogens enter our bodies, leukocytes, macrophages, DCs and neutrophils will be recruited and cooperate together to remove foreign invaders.
Studies on Gnathosome lymphocytes suggested that the adaptive immune system was formed in early vertebrates [7]. Compared to the innate immune system, the adaptive immune system has large numbers of specific immune defense mechanisms to eliminate pathogens. Two major cell types of the adaptive immune system are B (bone-marrow-derived) lymphocytes and T (thymus-derived) lymphocytes. Both types of lymphocytes develop from stem cells in the bone marrow while T cells migrate and mature in the thymus. The adaptive immune system is highly adaptable.
As T and B lymphocytes are characterized by somatic hypermutation and variable, diversity, joining recombination, they can generate a great number of different T cell receptors (TCR) and B cell receptors (BCR) for vast kinds of pathogens.
The adaptive immune system can be triggered when pathogens evade innate immune system. Parts of the pathogen, such as proteins and nucleic acids can be recognized as antigen by DCs, B cells or macrophages. Those antigens can enter cells by
endocytosis. Inside the cells big antigen structures will be cleaved into smaller parts.
Then they can bind to major histocompatibility complex (MHC) class II to form MHC II–antigen complexes and move to the surface of cell. Now T helper (Th) cells are able to recognize the fragments and develop into T effector cells to help eliminate the
memory cells to clear the specific pathogens immediately in case the same infection happens again.
Complement system
The complement system was first discovered and described in the late 19th century [8, 9]. Further studies indicated that the complement system belongs to the innate
immune defense and is composed of about 30 proteins and glycoprotein factors.
Generally, those factors are synthesized in the liver [10] and circulate with the blood as unactivated proproteins all over the body. The function of the complement system includes: a) as a part of host defense to clear pathogens; b) bridge innate and adaptive immune responses; c) disposal of immune complexes and apoptotic cells; d) tissue regeneration and maintenance of tolerance. Complement activation includes lots of biochemical cascade reactions that eventually result in the formation of the membrane attack complex (MAC) and cell lysis. Complement activation normally occurs
through three different pathways: the classical pathway, the lectin pathway and the alternative pathway (Figure 1).
lectin MBL
C1-like complex C4
C4b
Classical C1
C1 C4a
C2
C2a C2b
C3 convertase Ab-Ag MASP-1,2
C3 C3b C3
C3 convertase
Bb Factor B
Factor D C3b
C3 Alternative
Ca C3a C3a
C4b2a3b C3bBb3b
C5
c5b
MAC C5a
C6,7,8,9
Figure 1: Complement activation pathways. The complement system can be activated by the classical pathway, lectin pathway or the alternative pathway. The initiation signals are different in each pathway, but they all result in the lysis of the microorganism.
In the classical pathway, the interaction between the C1 complex (one molecule of C1q, two molecules of C1s and C1r) and the antigen-antibody complex induce C1q conformational changes. This activates C1r and C1s and split C2 and C4 into C4a, C4b, C2a and C2b. C4b and C2a combine to form the C3-convertase, which cleaves
convertase split C5 into C5a and C5b. C5b together with C6, C7, C8 and C9 form the MAC and leads to cell lysis. Immune complexes, apoptotic cells, some viruses and gram-negative bacteria initiate complement activation through the classical pathway.
In addition, it could also be activated when C-reactive protein binds to its ligand.
Similar to the classical pathway, microorganisms with mannose terminal groups can activate complement system without C1 complex. Mannose-binding lectin (MBL) or ficolins bound to mannose residues on the pathogen surface can activate
MBL-associated serine protease-1 (MASP-1) and 2 (MASP-2). The complex splits C4 and C2 into C4a, C4b, C2a and C2b. The C3-convertase is then formed and the later reactions are the same as in the classical pathway.
The C3 factor is unstable and can spontaneously hydrolyze into C3a and C3b to activate the alternative pathway. C3b can bind to the pathogen surfaces when they are in close proximity and form a covalent bond. C3b-pathogen complex together with FD can cleave FB into Ba and Bb. Bb then binds to C3b to make up C3bBb and C3bBb3b which is the C3- and C5-convertase of the alternative pathway. As in the classical pathway, MAC punches wholes in cell surface which lead to cell lysis. Many bacteria, fungi, viruses and tumor cells initiate complement activation through the alternative pathway.
As the complement system lyses cells in an extremely effective way, it can also destroy host tissue. So regulation of complement activation is crucial for the function of the immune system. Earlier studies indicated that factors such as FH, FI,
complement receptor (CR) 1, CD55 and CD59 can regulate complement activation [11].
Dendritic cells
DCs were first discovered in 1937. They belong to the innate immune system and are the main part of the antigen presenting cells (APCs). As an important link between innate and adaptive immunity, DCs are developed from hematopoietic stem cells and lymphocytic precursor cells. After migration with blood, they could be classified into myeloid DCs (mDCs), lymphoid DCs and plasmacytoid DCs (pDCs).
Normally, there are few DCs in the blood, and for a long time it was hard to acquire enough cells for research. In the 1990s, scientists developed a method to gain larger population of DCs for research. IL-4 and granulocyte monocyte colony stimulating factor (GM-CSF) were used to stimulate human monocytes into APCs. By
GM-CSF/IL-4 stimulation, monocyte-derived DCs arise and can be characterized by different markers. Cell surface markers like CD80, CD83 and CD86 increase during the maturation of the DCs, while monocyte marker CD14 disappears.
Complement and DCs
Studies on immune tolerance and autoimmunity revealed a strong link between the complement system and DCs [11]. Recent advances in complement research indicate that human monocyte-derived DCs can produce C3, C5, C9, FI, FH, FB, FD and properdin complement factors. Other than that, complement receptors discovered on the surface of the DCs indicate that complement and DCs might tightly interact with each other. Receptors for C1, C3, C4 and C5 have been reported and suggested to affect DC migration, maturation and function [13-20].
Researches on systemic lupus erythematosus (SLE) indicated the role of C1q in facilitating clearance of apoptotic cells and maintaining immune tolerance by DCs [21- 23]. Others reported that C1q could activate and mature human
monocyte-derived DCs in vitro [24].
Investigation of C3-deficient patients discovered that their DCs had a lower expression of HLA-DR, CD1a, CD80 and CD86 on the surface, indicating that C3 affects the function of DCs [20]. Soruri and colleagues showed that C3 play an important role in attracting DCs to the inflammation sites [13]. Moreover, C3 and C3R signaling pathways were able to promote the interaction and communication between T cells and DCs [25, 26].
C5a/C5aR was first reported to regulate DCs migration and differentiation [27]. Later, researches indicated that it played an important role to maintain immune tolerance.
However, the mechanisms of C5a/C5aR signaling are still unclear [28].
Toll-like Receptors
The innate immune system consists of pattern-recognition receptors that can detect ligands with specific structures. TLRs are able to recognize conserved structures both in microorganisms and in the host. In 1994, Nomura and colleagues described the first human TLR, since then 10 kinds of TLRs have been described in human [29, 30].
TLR function involves cytokine production and immune cells activation. But recent studies of the TLRs on tumors suggest that TLR expression on tumor cells had functions in both enhancing and suppressing the tumor growth [31]. TLR can be classified based on localization and function (Table 1).
Table 1: TLR receptors in human
Receptor Receptor location
Ligand Ligand location
Cell types
TLR-1 Cell surface Lipopeptides Bacteria Monocytes/macrophages, DCs, B cells
TLR-2 Cell surface Glycoloipids Lipopeptides HSP 70
Baceria Host cells Fungi
Monocytes/macrophages, mDCs, mast cells
TLR-3 Cell compartment
ds RNA Poly I:C
Viruses DCs, B cells
TLR-4 Cell surface Lipopolysaccaride HSPs
Fibrinogen
Bacteria Host cells
Monocytes/macrophages, mDC, mast cells, intestinal epithelium
TLR-5 Cell surface Flagellin Bacteria Monocytes/macrophages, DCs, intestinal epithelium
TLR-6 Cell surface Diacyl- lipopeptides
Mycoplasma Monocytes/macrophages, Mast cells, B cells
TLR-7 Cell compartment
Imidazoquinoline Loxoribine ssDNA
Small synthetic compounds
Monocytes/macrophages, pDCs,
B cells TLR-8 Cell
compartment
Small compounds ssRNA
Monocytes/macrophages, DCs, mast cells
TLR-9 Cell compartment
Unmethylated- CpG
ODN DNA
Bacteria Monocytes/macrophages, pDCs,
B cells
TLR-10 Cell surface Unknown Unknown Monocytes/macrophages, B cells
CpG
Early in the 1890s, William Coley used bacterial cell lysate in the treatment of cancer [32]. Then bacillus Calmette Guerin (BCG) was discovered and was introduced in clinical trials [33]. Later, investigators proved immunostimulatory effects of CpG stimulation using synthetic CpG oligodeoxynucleotides (ODN) [34, 35]. Considering that vertebrate DNA contains lots of unmethylated CpG motifs in the genome, those CpG motifs might be able to stimulate immune responses. Later studies on vertebrate DNA sequences indicated that they were nonstimulatory [34-36]. Genomic sequence analyses revealed that vertebrate CpG motifs are different from bacterial. Seventy percent of CpG in the animal genome have methylated cytosines but unmethylated CpG dinucleotides are not frequent. The most common form of unmethylated CpG is C-CpG-G [37, 38].
CpG classification
As reported earlier, CpG DNA can be recognized by B cells, DCs and
monocytes/macrophages as danger signals [39]. Figure 2 shows four classes of CpG that have different immunostimulatory effects on B cells and pDCs. Krieg et al tested CpG ODN and classified them based on their backbone structures and
immunostimulatory effects [36, 37, and 39].
pDC B
B IFNa
IFNb
IL12 IL2
T cell activation, NK cell, monocyte, neutrophils
activation
Ab production Plasma Cell
Differentiation IL6
IL10
A-class B-class C-class P-class
Figure 2: CpG classification based on sequence structure and function. Class A CpG strongly activates pDCs and B cells, and interferon (IFN)-α expression. Class B CpG has very strong effects on B cell proliferation and to a minor degree on pDCs to express costimulatory factors and IFN-α. Class C CpG can stimulate B cells and IFN-α secretion. Tests on class P CpG showed that this highly ordered CpG ODN could strongly increase IFN secretion.
Class A CpG was first described by Krug et al in 2001 [36]. ODN 2216 is one example in class A ODN. Class A ODN has poly-G regions in both 3’ and 5’ ends.
Nucleotides between the two ends are phosphorothioate (PS) modified to stabilize the nucleotides while CpG motifs in the center are phosphodieste (PO) [39].
Class B CpG was first described by Krieg et al in 1995 [40]. Compared to class A CpG, class B CpG has a complete PS-modified backbone and several CpG motifs and no poly-G in the ends. Most ODN contain one to five CpG motifs and studies have demonstrated that additional CpG motifs do not increase the ODN effect [39].
Class C CpG was first characterized by Krieg et al in 2004 [37]. CpG ODN 2395 is one example of class C ODN. Like class B CpG, they have complete PS-modified backbone and one to five CpG motifs. Class C CpG has self-complementary palindrome sequence which can form duplex or hairpin secondary structure [39].
Palindromic sequences can help to form secondary structures and studies indicated that palindromes could directly activate NK cells [39]. Secondary structures improve the characteristics of how CpG works as an immune stimulator, for example uptake and intracellular localization. Thus, scientists tried to modify class B CpG ODN by introducing palindromic sequences and named the new developed double palindromic CpG ODN as class P [38]. Class P CpG forms hairpins at both 3’ and 5’ ends.
CpG 2006
CpG 2006, also called CpG 7909 or PF-3512676, was developed in 2000 and belongs to the class B CpG ODN [41]. Lots of data from animal models using CpG 2006 show that it could be a potential adjuvant and immunotherapy candidate [42]. I focused on the CpG 2006 in this project.
CpG activation mechanisms
Innate immune cells lack highly specific receptors, instead they have pattern
recognition receptors (PRRs) to distinguish the foreign molecule structures from self cells [43]. ODN containing unmethylated CpG motifs activate innate and adaptive defense responses through various signaling pathways and involve most kinds of immune cells [39], so CpG ODN is considered to be a pathogen-associated molecular pattern (PAMP). CpG PAMP could be recognized as foreign molecules by the PRRs in the innate immune responses and trigger the protective immune reaction to remove it. Studies on cellular immunology of CpG indicated that CpG ODN induced
Th1-type of immune response [39]. Besides the direct activation of B cells and pDCs via TLR-9, CpG could affect other immune cells but the mechanisms are still unclear [44-46]. Scientists also tried to find out whether nonimmune cells could express TLR-9, but until now no other cell types have been reported [39].
In 2002, Hemmi et al reported that TLR-9 could recognize bacterial CpG DNA sequence and signal to activate cytokine and IFN expression [47]. Later Vollmer et al.
used TLR-9-/- murine splenocytes to check A-, B- and C-class ODN immune
activation effects based on the presence of TRL-9 [37]. While the study of CpG ODN uptake by cells indicated that cells have more than one pathway for uptake [40], the role of TLR-9 in the CpG uptake is unclear. Figure 3 shows how CpG ODN activation of innate and adaptive immune response by TLR-9 signaling [42].
TLR9
NKNK CpG ODN
pDC
IL-6
B cell TLR9
Increase IFN-γ, tumor killing
Monocyte
Neutrophils
IL-10
IFN and chemokines
Helper, Effector, Memory T cells
Plasma Cells Mature pDCNaive T cell
Naive T cell
IDO+DC Treg
Differentiation
Innate Immune Response (hours to days) Adaptive Immune response Days to weeks
TLR9
NKNK CpG ODN
pDC
IL-6
B cell TLR9
Increase IFN-γ, tumor killing
Monocyte
Neutrophils
IL-10
IFN and chemokines
Helper, Effector, Memory T cells
Plasma Cells Mature pDCNaive T cell
Naive T cell
IDO+DC Treg
Differentiation
Innate Immune Response (hours to days) Adaptive Immune response Days to weeks
Figure 3: CpG ODN activates innate and adaptive immune responses by TLR-9 signaling. TLR-9 is constitutively expressed intracellular by B cells and pDCs in the immune system. CpG ODN will bind to TLR-9 by chance and following the unmethylated motifs stimulate TLR-9. Once the CpG ODN is recognized by TLR-9, the cells become activated. Activated B cells differentiate into antibody-secreting plasma cells and produce more cytokines such as IL-6 and IL-10. Activated pDCs will upregulate IFN-γ secretion, which activates NK cells, monocytes, and APCs. pDCs matured by CpG ODN will be more effective at naïve T cell activation [42]. On the other hand, CpG ODN stimulation will induce the expression of immune suppressive factors 2, 3-dioxygenase (IDO+), which contributes to T regulatory generation and immune suppression.
Complement system and CpG
Earlier studies showed that CpG could activate the complement system through different pathways. CpG 2006 has been reported to bind to antigen-antibody complex and MBL, thus activating the classical and lectin pathways. Other experiments indicated that CpG 2006 together with properdin could activate the complement via the alternative pathway (Figure 4) [1].
P
C3
C3b
C3b C3a
P
P C3a
C3b C3b B C3
D
Maturation Activation C5a
Production of complement factors like C3, FB, FD?
CpG 2006
DCs
DCs
DCs
C3b C3a C5a FB
FD Perperdin
Figure 4: CpG activates the complement system via the alternative pathway. Properdin (P) binds to the CpG 2006 to stabilize its structure and function. Complexes of properdin and CpG 2006 trigger C3 to split into C3a and C3b, leading to C3a and C5a release. C3b together with CpG 2006 activates DCs, thus complement system activated via the alternative pathway.
This study also revealed that CpG 2006 affected immune responses by C3, thus the inhibition of C3 leads to loss of all CpG responses. Further investigation of cytokine expression indicated that CpG 2006 induced cytokine upregulation based on C3 and C5 [1].
Lipopolysaccharides
Lipopolysaccharides (LPS) are large biomolecules composing the outer membrane of gram-negative bacteria. It contributes greatly to the structural integrity and protects the microorganism from the outer environment. LPS is known as an endotoxin and can induce a strong immune response, through the binding of CD14, TLR-4 and MD2 receptors and can thereby promote cytokine production, especially in macrophages.
Besides that, LPS can induce fever by acting as an exogenous pyrogen. Treatment of DCs with LPS was proven to promote the mRNA level of some complement factors such as C3 and FI while C9, FH, FB, FD and properdin were not [4].
Enzyme-linked immunosorbent assay (ELISA)
ELISA is widely used as a biochemical technique to detect the presence of certain kinds of antigens or antibodies. Figure 5 shows the simple principles of the ELISA:
first, antibodies were coated on to the bottom of a 96-well plate. Next antigens in the sample were caught by the immobilized antibodies. Then an enzyme-conjugated antibody is added and will bind to the immobilized antigen-antibody complex. Finally, a substrate for the enzyme is added which will convert a possible signal into a color that can be quantified by absorbance measurements. There are many types of ELISA used to detect various kinds of antigens which broaden the application of this method.
Widely used ELISA methods includes: indirect ELISA, sandwich ELISA, competitive ELISA and reverse ELISA.
Coating
Blocking Sampling
Detection antibody added
Substrate added
Detected Signal
Figure 5: Principles for sandwich ELISA
I used sandwich ELISA to detect the C3 production in the cell culture supernatants.
Flow cytometry
Flow cytometry is widely used in research and the clinic to analyze cells. Cells were stained with fluorescence-conjugated antibodies for different surface markers and suspended in solution before analysis. When the suspended cells run through the scatters one by one, fluorescence stained on the surface could be excited by the light offered by the machine and emitting signal light with certain wavelengths. Detectors will pick up the signals and collect for later analysis. This kind of analysis can give some characteristics about the cells. Fluorescence-activated cell sorting is one kind of flow cytometry used to separate cells of interest. Based on the specific fluorescent characteristics of each cell, cells with certain markers can be separated from the
of fluorescence labels are available right now. In this project, I used antibodies conjugated with fluorescein isothiocyanate (FITC), phycoerythrin (PE) and allophycocyanin (APC) to analyze immature DCs.
Aim of the study
This project aimed at evaluating if CpG 2006, the oligo which is in clinical trials now, can induce human DCs to increase their production of complement proteins, including FB, FD and C3. During the study, I used GM-CSF/IL-4 induced human
monocyte-derived DCs and compared the levels of complement proteins after CpG stimuli to DCs stimulated with LPS as a positive control. Levels of complement products were analyzed on mRNA and protein levels using PCR and ELISA.
Result
DCs phenotype
Flow cytometry was used to characterize DCs phenotypes. As shown in Figure 6, DCs were CD14 negative, which is a marker for monocytes and macrophages. DC specific markers like CD86, CD80, CD83 and HLA-DR were expressed on the cell surface.
HLA-A, B, C are expressed by all human cells.
Gate 1 Not in gate
FSC-H
0 256 512 768 1024
SSC-H
0 256 512 768 1024
Gate 1
CD40
FL1-H
100 101 102 103 104
Count
190 180 170 160 150 140 130 120 110 100 90 80 70 60 50 40 30 20 10 0
CD14
FL1-H
100 101 102 103 104
Count
100 90 80 70 60 50 40 30 20 10 0
100 101 102 103 104
Count
90 85 80 75 70 65 60 55 50 45 40 35 30 25 20 15 10 5 0
CD80
100 101 102 103 104
Count
90 85 80 75 70 65 60 55 50 45 40 35 30 25 20 15 10 5 0
HLA-DR
FL4-H
100 101 102 103 104
Count
100 90 80 70 60 50 40 30 20 10 0
CD54
FL4-H
100 101 102 103 104
Count
100 90 80 70 60 50 40 30 20 10 0
CD86
FL1-H
100 101 102 103 104
Count
100 90 80 70 60 50 40 30 20 10 0
HLA-ABC
FL2-H
100 101 102 103 104
Count
90 85 80 75 70 65 60 55 50 45 40 35 30 25 20 15 10 5 0
CD83
Figure 6: Phenotypic characteristics of monocyte-derived DCs. Expressions of the cell surface marker: HLA-ABC, HLA-DR, CD14, CD40, CD54, CD80, CD83 and CD86 after 7-day culture with GM-CSF/IL-4. Black color means negative control.
Complement mRNA expression
Analysis of the complement mRNA expression levels in DCs by PCR showed that CpG 2006 increased C3 mRNA expression in immature DCs (Figure 7). LPS could increase the C3 factor expression within 48 hours, and was used as a positive control.
Compared to the PBS negative control, CpG 2006 increased the mRNA expression of C3. Higher concentration CpG 2006 had stronger stimulatory effects.
C3
GAPDH LPS CpG60 CpG 6 PBS
Figure 7: Complement C3 mRNA expression in immature DCs. Total RNA was isolated from immature dendritic cells after treatment with LPS (1 μg/ml), CpG 6 (6 μg/ml) or CpG 60 (60
μg/ml). PBS was used as negative control. GAPDH was used as a control of mRNA expression in the cells. Similar results were obtained in three other independent experiments using blood cells from three different healthy adult donors.
Mature DCs were analyzed as described earlier. Immature DCs were matured for 2 days using LPS (1 μg/ml) before stimulated with CpG or LPS. As shown in figure 9, we did not see much difference in C3 mRNA level after LPS or CpG 2006
stimulation.
LPS CpG60 CpG6 PBS
GAPDH Factor B
C3
Figure 8: Complement Factor B mRNA expression in mature DCs. Total RNA was isolated from mature DCs after treatment with LPS (1 μg/ml), CpG6 (6 μg/ml), CpG60 (60 μg/ml) or PBS.
GAPDH was used as a control of mRNA expression in the cells. Similar results were obtained in three independent experiments using blood cells from three different healthy adult donors.
Both mature and immature DCs can synthesize factor B and mRNA expression levels can be detected by PCR. Results showed that mRNA expression of FB did not change
PBS CpG6 CpG60 LPS
GAPDH Factor B
Figure 9: Complement Factor B and C3 mRNA expression in immature DCs. Total RNA were isolated from immature dendritic cells after treatment with LPS (1 μg/ml), CpG6 (6 μg/ml), CpG60 (60 μg/ml). PBS was used as negative control. GAPDH was used as a control of mRNA expression in the cells. Similar results were obtained in three other independent experiments using blood cells from three different healthy adult donors.
We also tried to measure FD mRNA expression, but its expressions was too low to be detected.
Complement protein production
C3 complement protein secretion levels were evaluated in immature and mature DCs supernatant by ELISA. Monocyte-derived DCs from different donors were used and all experiments obtained similar results. Figure 10 show C3 secretion levels in immature DCs supernatants. DCs were cultured in medium without presence of human C3. From the ELISA results, it was demonstrated that C3 production increased after CpG 2006 and LPS treatment compared to the PBS treatment in immature DCs.
Mature DCs did not produce different C3 levels after stimulation with LPS or CpG 2006 compared to PBS (Figure 11).
Figure 10: After 48 hours stimulation, complement C3 protein production in supernatant by immature DCs. Supernatants were collected from immature DCs after treatment with LPS (1
μg/ml), CpG6 (6 μg/ml), CpG60 (60 μg/ml) or PBS. Results from two individual experiments are shown in the figure.
Figure 11: After 48 hours stimulation ,complement C3 protein production in supernatant by mature DCs. Supernatants were collected from mature DCs after treatment with LPS (1 μg/ml), CpG6 (6 μg/ml), CpG60 (60 μg/ml) or PBS. Results from two individual experiments are shown in the figure.
Discussion
As reviewed above, CpG can mediate immune response when C3 factor exist. The capacity of CpG 2006 as immunostimulatory agent has been proven [39]. However, how CpG interact with complement is unknown. This project aimed to investigate if the CpG 2006 can induce complement production in human monocyte-derived DCs.
In this study, a concentration of 60 μg/ml CpG was added to the DC medium to mimic the amount used in the clinic CpG therapy for local injections of CpG. Around the injection site, immune cells can be exposed to a microenvironment with an
extremely high CpG concentration. Our results showed that compared to the positive control LPS, immature DCs can be triggered by CpG 2006, and C3 mRNA expression was upregulated. However, no differences in FB mRNA expressions were found by CpG stimulation. We also showed that C3 protein, secreted by the immature DCs, increased after CpG and LPS treatment. Immature DCs can be matured by 48 hours of LPS exposure. When mature DCs were stimulated with CpG or LPS, there was no change in C3 expression neither on mRNA nor protein level. So we might conclude that mature DCs cannot be stimulated by the CpG 2006, or the LPS maturation process exhausted the C3 expression. C3 is essential to the CpG 2006 mediated immune response. In the alternative pathway activation, the upregulated expression of C3 support the idea that C3 might interact with CpG 2006 and play an important role in immune activation.
Most of the complement factors are circulating in the blood over the whole body.
Considering that 2% of the cells under the skin and mucosa are DCs [48], complement produced by DCs might influence the local concentration in the
microenvironment but not in the blood. When CpG 2006 is recognized by TLR-9 in pDCs, the cells become activated and will produce more C3. C3 together with other complement factors can further induce a local immune reaction, which will attract more DCs to produce complement factors at the specific site.
Our results also showed that mature DCs are not stimulated by CpG 2006 in the same way as immature DCs. The mature DCs seem to lose their ability to recognize and response to CpG 2006. Previous studies speculated that TLR expression changed during the maturation of DCs. As TLR-9 expression might change the
immunostimulatory effects of CpG 2006 on DCs.
The mRNA and protein expression levels of C3 were analyzed by PCR and ELISA.
The results did not show a very strict correlation between mRNA and protein. This difference might be due to the complicated regulation in transcriptional level and protein translation level. The complement secretion also can be regulated by the cell.
Other factors during the PCR and ELISA, for example, primer and/or antibody efficiency might contribute to the difference.
higher CpG 2006 stimulation induced higher C3 expression. This further supports the CpG 2006 activated complement production. Thus, CpG 2006 could mediate immune response by regulating the expression of C3 rather than FB or FD.
Material and Methods
ReagentsCulture medium: Primary cells were maintained in RPMI 1640 (Invitrogen) medium supplemented with 1% pooled normal human AB serum (Uppsala University Hospital Blood Center), 10 mmol/l N-2-hydroxyethypiperazine-N’-2-ethanesulfonic acid (HEPES), 1 mmol/l L-Glutamine, 20 μmol/l β2-mercaptoethanol, 100 U/ml penicillin and 100 U/ml streptomycin (Invitrogen). Cells were cultured in a 37 ℃, 5% CO2 humidified incubator. For protein measurements, human serum was used during the differentiation into immature DCs, but during the LPS or CpG treatments 1% fetal calf serum (FBS) was used (Invitrogen). Bovine serum albumin (BSA) was purchased from Sigma. Fluorescent-labeled monoclonal antibodies against human CD14, CD40, CD80, CD83, CD54, CD86, HLA-A, B, C and HLA-DR were used to stain the cell surface receptors before FACS analysis (Table 2). Antibodies used for ELISA:
Rabbit-anti Human C3c antibody and Rabbit-anti Human C3c-HRP were purchased from DAKO, Denmark (Table 3).
Table 2: Antibodies used in FACS staining
Name of the antibody Clone Cat.No Company Lot. No FITC anti human CD14 HCD14 325604 Biolegend B1148882 FITC anti human CD40 HB14 313004 Biolegend B115841 APC anti-human CD54 HCD54 559771 PharmingenTM 0000067347
PE anti-human CD80 2D10 305208 Biolegend B110943
PE anti-human CD83 HB15e 305308 Biolegend B100861 APC anti-human CD86 B70/B7-2 555660 Pharmingen M066753 FITC anti human HLA-A,B,C W6/32 555552 PharmingenTM 24231
Anti HLA-DR PE L243 347367 BD 36914
MultiMixTM Dual-color Control Reagent MouseIgG1/FITC
MouseIgG1/RPE
DAK-GO1 X0932 Dako 00038883
APC Mouse IgG κIsotype Control (FC) MOPC-21 400122 Biolegend B116107
Table 3: Antibodies used in ELISA
Name of the antibody Dilution REF Configuration Company Lot. No
Ka-anti-Hu C3c 1:3000 A0062 Ig fraction DAKO Ch-B 0561501 ka-anti Hu C3c-HRP 1:500 P0213 HRP Ig fraction DAKO 00003210
Recombinant human IL-4 and GM-CSF (GENTAUR) were purchased from
GENTAUR, Belgium. LPS from Escherichia coli 0111:B4 used as a positive control was purchased from Sigma. CpG 2006 PS (5’-TCG TCG TTT TGT CGT TTT GTC GTT-3’) were purchased from Cybergene.
Preparation and culture of cells
Fresh buffy coats were obtained from healthy donors from the university hospital blood center. PBS diluted blood was carefully added on a Ficoll-Paque (GE
Healthcare) gradient and centrifuged. PBMCs were resuspended in 80 ml RPMI 1640 culture medium and divided into four T-75 flasks (Corning) and cultured in 37 ℃ for 90 minutes. Adherent cells (approximately 1,000,000 cells/ml culture media) were collected and cultured with GM-CSF/IL-4 supplemented (50 ng/ml and 25 ng/ml respectively) media for six to seven days.
Flow cytometry
The differentiation of monocyte into immature DCs took six to seven days and this was checked using different cell surface markers. Cells were harvested and incubated with different antibodies for 10 minutes. After washing away the unbound antibodies, cells were analyzed by FACSCalibur flow cytometry (BD Bioscience). Cell surface markers used were CD14, CD 40, CD 54, CD80, CD83, CD86, HLA-A, B, C, HLA-DR and isotype-control of FITC, PE, APC. All the data was analyzed by CellQuest and FAC3 software.
RNA extraction
After 2 days treatment, immature and mature DCs stimulated with CpG, PBS or LPS were collected in lysis buffer and homogenized before store in -80 ℃. Total RNA was isolated using RNeasy Mini Kit (QIAGEN) according to the manufacturer’s protocol. Genomic DNA was removed by using RNase-Free DNase Set (QIAGEN).
RNA concentration was measured by NanoDrop. The quality of the RNA was checked by electrophoresis.
cDNA synthesis
One thousand ng of RNA was used to synthesize cDNA. Oligo dT (Invitrogen), RNase Out inhibitor (Invitrogen), and Superscript II reverse transcriptase (Invitrogen) were used according to the manufacturer’s instruction.
PCR
PCR was carried out with 1 ul of cDNA products and was amplified by 40 cycles in the presence of specific primers (Table 4). No amplification was detected in no template controls. Normal mRNA expression level was detected by
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) which is constitutively expressed in cells. No genomic DNA was amplified after the PCR.
Table 4: Primers used in the PCR
cDNA Primers Sequence (5’-3’) Annealing temperature
Amplified fragment (bp)
C3 3059F*
4038R*
GCTGAAGCACCTCATTGTGA CCTTGGTCTCTTCTGATCGC
55 ℃ 980
FB 201F 422R
CACCACTCCATGGTCTTGGC CACTCTACCTTCCTGACAGTC
54 ℃ 222
FD 143F 530R
ATGGCGTCGGTGCAGCTGAA TCCAGCACTGGCAAGAGCAC
56 ℃ 407
GAPDH 2F 320R
TCTCTGCTCCTCCTGTTCGAC GGATCTCGCTCCTGGAAGAG
50 ℃ 319
* Numbers refer to the nucleotide position in cDNA, F-forward, R-reverse.
ELISA
Supernatants from DCs after 2 days treatment with PBS, CpG or LPS were analyzed by ELISA. Medium with 1%FBS was used as negative control. All the supernatants were diluted in dilution buffer which contains 0.05% Tween 20 (Invitrogen) and 1%
BSA (Invitrogen). The antibody reacts with human C3c complement as well as the C3c part of C3 and C3b. A 96-well plate was coated with rabbit-anti human C3c and incubated at 4 ℃ overnight. Immobilized the antibodies on the surface and added the diluted samples and secondary antibodies follow the instruction. After 5 minute reactions with TMB (DAKO), the reaction was stopped by adding 1 M H2SO4. A standard curve was made using normal human serum. The absorbance was measured at 450 nm by Multiskan RC V1.5-0 (Reader serial No. ER3) and the data analyzed by DeltaSoft JV version 1.60.
Statistical analysis
The differences in C3 secretion between stimulates were compared using unpaired t test. ELISA results were analyzed by Graph Pad Prism software
Reference
[1] Mangsbo SM, Sanchez J, Anger K, Lambris JD, Ekdahl KN, Loskog AS, Nisson and Totterman TH. Complement activation by CpG in a human whole blood loop system: mechanisms and immunomodulatory effects. J Immunol 2009;
183(10):6724-32
[2] Hajishengallis G. Lambris JD. Crosstalk pathways between Toll-like receptors and the complement system. Trends Immunol. 2010; (Article in press)
[3] Zhang XH, Kimura Y, Fang C, Zhou L, Sfyroera G, Lambris JD, Wetsel RA, Miwa T Song CW. Regulation of Toll-like receptor-mediated inflammatory response by complement in vivo. Blood. 2007; 110:228-236
[4] Reis ES, Barbuto AM, Isaac L. Human monocyte-derived dendritic cells are a source of several complement proteins. Infl.amm. res.2006; 55: 179–184
[5] Pancer Z, Cooper MD. The evolution of adaptive immunity. Annu Rev Immunol.2006; 24:497-518
[6] Klinman MD, Barnhat KM and Conover J. CpG motif as immune adjuvants.
Vaccine. 1999; 17(1):19-25
[7] Cooper MD, Alder MN. The evolution of adaptive immune systems. Cell 2006;
124:815-822
[8] Walport MJ. Complement. Second of two parts. N Engl J Med. 2001; 344 (15):
1140-4
[9] Walport MJ. Complement. First of two parts. N Engl J Med. 2001; 344 (14):
1158-66
[10] Bouwman LH, Roos A, Terpstra OT, de KnijffP, van Hoek B, et al Gastroenterology. 2005; 129 (2):408-14
[11] Kooten CV, Fiore N, Trouw LA et al. Complement production and regulation by dendritic cells: molecular switches between tolerance and immunity. Molecluar Immunology. 2008; 45: 4046-4072
[12] Sozzani S, Sallusto F, Luini W, Zhou D, Piemonti L, Allavena P et al. Migration of dendritic cells in response to formyl peptides, C5a and a distinct set of chemokines.
J Immunol 1995; 155: 3292–95
[13] Soruri A, Kiafard Z, Dettmer C, Riggert J, Kohl J, Zwirner J. IL-4
down-regulates anaphylatoxin receptors in monocytes and dendritic cells and impairs
[14] Sallusto F, Lanzavecchia A. Understanding dendritic cell and Tlymphocyte traffi c through the analysis of chemokine receptor expression. Immunol Rev. 2000; 177:
134–40
[15] Kirchhoffk K, Weinmann O, Zwirner J, Begemann G et al. Detection of anaphylatoxin receptors on CD83+ dendritic cells derived from human skin.
Immunology 2001; 103: 210-217
[16] Gutzmer R, Lisewski M, Zwirner J, Mommert S, Diesel C, Wittmann M, Kapp A, and Werfel T. Human monocyte-derived dendritic cells are chemoattracted to C3a after up-regulation of the C3a receptor with interferons. Immunology 2004; 111(4):
435–443
[17] Vegh Z, Goyartsb EC, Rozengartena K, Mazumdera A, Ghebrehiwet B.
Maturation-dependent expression of C1q binding proteins on the cell surface of human monocyte-derived dendritic cells. International Immunopharmacology. 2003;
3: 39–51
[18] Waggoner SN, Cruise MW, Kassel R, and Hahn YS. gC1q Receptor Ligation Selectively Down-Regulates Human IL-12 Production through Activation of the Phosphoinositide 3-Kinase Pathway. The Journal of Immunology, 2005; 175:
4706–4714
[19] Castellano G, Woltman AM, Schena FP, Roosa A, Dahaa MR, Kooten CV.
Dendritic cells and complement: at the cross road of innate and adaptive immunity.
Molecular Immunology. 2004; 41:133–140
[20] Reis ES, Barbuto JA, Kohl J, Isaac L. Impaired dendritic cell differentiation and maturation in the absence of C3. Mol. Immunol. 2008; 45: 1952–1962
[21] Manderson AP, Botto M, Walport MJ. The role of complement in the development of systemic lupus erythematosus. Annu. Rev. Immunol. 2004; 22:
431–456
[22] Nauta AJ, Castellano G, Xu W, Woltman AM, Borrias MC, Daha MR, van Kooten C, Roos A. Opsonization with C1q and mannose-binding lectin targets apoptotic cells to dendritic cells. J. Immunol 2004; 173: 3044–3050
[23] Steinman RM, Hawiger D, Nussenzweig MC. Tolerogenic dendritic cells. Annu.
Rev. Immunol. 2003; 21: 685–711
[24] Csomor E, Bajtay Z, Sandor N, Kristof K, Arlaud GJ, Thiel S, Erdei A.
Complement protein C1q induces maturation of human dendritic cells. Mol. Immunol.
2007; 44: 3389–3397
[25] Strainic MG, Liu J, Huang D, An F, Lalli PN, Muqim N, Shapiro VS, Dubyak GR, Stacey KJ, Sweet MJ, Hume DA. Macrophages ingest and are activated by bacterial DNA. J. Immunol.1996; 157(5):2116-22
Local production and activation ofcomplement up-regulates the allostimulatory function of dendritic cells through C3a-C3aR interaction. Blood. 2008; 111:
2452–2461
[27] Yang D, Chen Q, Stoll S, Chen X, Howard OM, Oppenheim JJ. Differential regulation of responsiveness to fMLP and C5a upon dendritic cell maturation:
correlation with receptor expression. J. Immunol. 2000; 165: 2694–2702 [28] Köhl J, Wills-Karp M. Complement regulates inhalation tolerance at the dendritic cell/T cell interface. Molecular Immunology. 2007; 44: 44–56
[29] Iwasaki A, and Medzhitov R. Toll-like receptor control of the adaptive immune response. Nat.Immunol.2004; (5):987-995
[30] Takeda, K. Kaisho, T, and Akira, S. Toll-like rceptors. Annu.Rev. Immunol.
2003; (21): 335-376
[31] van Maren WW, Jacobs JF, de Vries IJ, Nierkens S, Adema GJ. Toll-like receptor signalling on Tregs: to suppress or not to suppress? Immunology. 2008;
124(4):445-52
[32] Yamamoto S, Yamamoto T, Shimada S, Kuramoto E, Yano O, Kataoka T, Tokunaga T. DNA from bacteria, but not from vertebrates, induces interferons, activates natural killer cells and inhibits tumor growth. Microbiol.Immunol.1992;
36(9):983-97
[33] Shimada S, Yano O, Tokunaga T. In vivo augmentation of natural killer cell activitywith a deoxyribonucleic acid fraction of BCG. Jpn. J. Cancer Res. 1986;
77(8):808–16
[34] Brid AP. CpG islands as gene markers in the vertebrate nucleus. Trends Genet 1987; 3:342-47
[35] Han J, Zhu Z, Hsu C, Finley WH. Selection of antisense oligonucleotides on the basis of genomic frequency of the target sequence. Antisense Res. Dev. 1994;
4(1):53-65
[36] Krug A, Rothenfusser S, Hornung V, Jahrsdorfer B, Blackwell S, Ballas ZK, Endres S, Krieg MA and Hartmann G. Identification of CpG oligonucleotides sequences with high induction of INF-a/p in plasmacytoid dendritic cells. Eur. J.
Immunol.2001; 31: 2154-2163
[37] Vollmer J, Weeratna R, Payette P, Jurk M, Schetter C, Laucht , Wader T, Tluk S, Liu M, Davis HL, Krieg AM. Characterization of three CpG oligodeoxynucleotied classes with distinct immunostimulatory activities. Eur. J .Immunol.2004; 24:251-262 [38] Vollmer J, Krieg AM. Immunotherapeutic applications of CpG
oligodeoxynucleotides TLR9 agonists. Advanced Drug Delivery Reviews 2009;
[39] Krieg AM. CpG motifs in bacterial DNA and their immune effects. Annu.Rev.
Immunol. 2002; 20:709-760
[40] Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA, Teasdale R, Koretzky GA, Klinman DM. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 1995; 374 (6522): 546–9
[41] Hartmann G, Weeratna RD, Ballas ZK et al. Delineation of a CpG
phosphorothioate oligodeoxynucleotied for activation primate immune responses in vitro and in vivo. J Immunol. 2000; 164(3):1617-24
[42] Krieg AM. Development of TLR-9 agonists for cancer therapy. J clini Invest 2007; 117(5):1184-94
[43] Tokunaga T, Yamamoto H, Shimada S, Abe H, Fukuda T, Fujisawa Y, Furutanin Y, Yano O et al. Antitumor activity of deoxyribonucleic acid fraction from
Mycobacterium bovis BCG. I. Isolation, physicochemical characterization, and antitumor activity. Journal of the National Cancer Institute 1984; 72 (4): 955–62 [44] Kadowaki N, Ho S, Antonenko S, Waal MR, Kastelein RA, Bazan F, Liu YJ.
Subsets of human dendritic cell precursors express different toll-like receptors and respond to different microbial antigens. J. Exp. Med. 2001; 194(6):863–70
[45] Iho S, Yamamoto T, Takahashi T, Yamamoto S. Oligodeoxynucleotides
containing palindrome sequences with internal 50-CpG-30 act directly on human NK and activated T cells to induce IFN-γ production in vitro. J Immunol.1999; 163(7):
3642–52
[46] Weighardt H, Feterowski C, Veit M, Rump M, Wagner H, Holzmann B.
Increased resistance against acute polymicrobial sepsis in mice challenged with immunostimulatory CpG oligodeoxynucleotides is related to an enhanced innate effector cell response. J. Immunol. 2000; 165(8):4537–43
[47] Hemmi H, Takeuchi O, Kawai T, Kaisho T, Sato S, Sanjo H, Matsumoto M, Hoshino K, Wagner H, Takeda K, Akira S. A Toll-like receptor recognizes bacterial DNA. Nature. 2000; 408(6813):740-5
[48] Banchereau J, Steinman RM. Dendritic cells and the control of immunity. Nature.
1998; 392 (6637):245-52
Acknowledgments
I would like to thank all the people who help me to finish this project!
This project was done in a research group supervised by Professor Thomas Tötterman at the Clinical Immunology of Department of Oncology, Radiology and Clinical Immunology of Uppsala University. I am thankful to GIG group for all the help during my work in the lab, Sara and Linda’s help during my work and Hospital blood center to offer me the buffy coats as well as blood donors.
I am grateful to all presents and former members of GIG group for being nice, helpful and friendly during last ten months. I am also thankful to my friends Xi, Meng, Xue and all other friends who were helpful and supportive during the time of my stay in Uppsala.
Thank you Thomas for having me in your group and being so nice to me, your kindness and consideration is deeply appreciated. Linda and Sara, you are two of the best supervisors I have ever had. Your knowledge, skill and patience will be
remaining unforgettable. Di and Chuan, thanks a lot for all your help during my stay here! It is really great to meet you in Sweden!
最后，感谢我的父母，感谢你们二十多年对我的养育，也感谢你们对我学习的支 持和帮助！
Min Ma 马敏
