Eosinophil Cationic Protein : Expression Levels and Polymorphisms

Full text

(1)

(2)

(3)

(4)

(5)

(6)

(7) .

(8)

(9)

(10) !". #$%& !"'(). &'& %*+(*'&'* &,*%* &,& -..-.

(11) Dissertation for the degree of Doctor of Philosophy (Faculty of Medicine) in Clinical Chemistry presented at Uppsala University in 2002 ABSTRACT Byström, J. 2002. Eosinophil Cationic Protein, Expression levels and Polymorphisms. Acta Universitatis Upsaliensis. Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1161. 58 pp. Uppsala ISBN 91-554-5336-8. The eosinophil cationic protein (ECP) is usually associated with the eosinophil granulocyte. In this thesis the presence and production of this protein has been studied in two other cells. The circulating monocyte was found to contain ECP mRNA and small amounts of ECP, one thousand times less than that found in the eosinophil. The production decreased by differentiation of the myelomonoblastic cell line U937 into a macrophage phenotype. Submucosal lung macrophages did not stain for ECP and alveolar macrophages did not contain ECP mRNA. The circulating neutrophil contains ECP at a level hundred fold less than the eosinophil. We found that the protein is located to the primary granules of the neutrophil but could detect no ECP mRNA in the cell. It was shown in vitro that the protein was taken up by the cell and partly transported to the primary granules. The uptake did not seem to be receptor mediated. Upon stimulation of the neutrophils, ECP previously taken up, was re-secreted. The ECP protein is heterogeneous both to molecular characteristics and to function. To evaluate if a genetic component is involved, the ECP gene was analysed in 70 individuals. Three single nucleotide polymorphisms (SNP´s) were found, denoted 277(C>T), 434(G>C) and 562(G>C). The two first were located to the mature peptidecoding region and would change the amino acids, arg45cys and arg97thr. The prevalence of the most common SNP, 434, was evaluated in two eosinophil-related diseases, allergy/asthma and Hodgkin Lymphoma (HL). Forty-three HL patients were evaluated and it was found that the 434GG was significantly more prevalent in patients having nodular sclerosis (NS) as compared to other histologies (p=0.03). Erythrocyte sedimentation rate was also related to the 434GG genotype (p=0.009). In 209 medical students 434GG was more common (p=0.002) in those who indicated allergy. The genotype was unrelated to the production of IgE antibodies to allergens. In analysis of 76 subjects with asthma it was found that the 434GG genotype was significantly more common among allergic asthmatics (p=0.04). Asthma and HL-NS are characterised by fibrosis and eosinophils and ECP has been suggested in fibrosis development. Key words: Eosinophils, Neutrophils, Monocytes, Macrophages, mRNA, eosinophil cationic protein, DNA, polymorphism, Hodgkin Lymphoma, asthma, allergy. Jonas Byström, Department of Medical Sciences, Clinical Chemistry, University Hospital, SE- 751 85 Uppsala, Sweden Jonas Byström 2002 ISSN 0282-7476 ISBN 91-554-5336-8 Printed in Sweden by Eklundshofs Grafiska, Uppsala 2002. 2.

(12) “..to boldly go there no one has gone before”. In memorial of my grandfather Pelle Byström, farmers son, agronomist, folk high school teacher and writer. 3.

(13) This thesis is based on the following papers, which are referred to in the text by their Roman numerals:. I. Byström, J., Tenno, T., Håkansson, L., Amin, K., Trulson, A., Högbom, H., Venge, P. Monocytes, but not macrophages, produce the Eosinophil Cationic Protein. APMIS. 2001;109:507–516. II. Byström, J., Garcia, R., Håkansson, L., Karawajczyk, M., Moberg, L., Sukka, J., and Venge, P. Eosinophil Cationic Protein (ECP) is stored in, but not produced by peripheral blood neutrophils. Clin Exp Allergy, 2002(In press). III. Byström, J., Molin, D., Jönsson, U. B., Enblad, G., Sundström, C., Högbom, E., and Venge, P. Identification of polymorphisms in the ECPgene. Relation to disease activity in Hodgkin lymphoma. Manuscript. IV. Jönsson, U. B., Byström, J., Stålenheim, G., and Venge, P. Polymorphism of the ECP gene is related to the expression of allergic symptoms. Clin Exp Allergy, 2002(In press).. Permission for reprinting the articles has been given by the publishers.. 4.

(14) Table of Contents Abbreviations………………………………………………………………….…6 Introduction………………………………………………………………….……8 Inflammatory cells of the innate immunity system …………………………………8 The eosinophil granulocyte…………………………………………………………8 The neutrophil granulocyte………………….………………………………..……10 The monocyte / macrophage ……………………………………………..….…….11 The eosinophil cationic protein …………………………………………….….…..11 Single nucleotide polymorphisms and the eosinophil……………………...………15 Inflammatory disorders involving the eosinophil…………………………..………16 Hodgkin lymphoma …………………………………………………….………….16 Asthma / Allergy……………………………………………………………………18 Figure 1……………………………………………………………………..………20 The aims of the Present Investigation………………………………………21 Materials and Methods…………………………………………………………22 Subjects…………………………………………………………………………..…22 Cell separation procedures……………….………………………………………..22 Cell line culture ……………………………………………………………………23 Immunohistochemisty………………………………………………………………23 Microscopic techniques…………………………………………………………….24 Flowcytometry for detection of protein inside cells, already present or taken up in vitro……………….……………………………….25 Subcellular fractionations …………………………………………….……………25 Subcellular location of internalised ECP…..………………………………………..26 Protein measurements……………………………………………………………….26 RNA preparation…………………………………………………………….………26 DNA preparation…………………………………………………………………….27 Reverse transcriptase and polymerase chain reaction……………………………….27 Northern Blotting……………………………………………………………………28 DNA sequencing……………………………………………………………………29 Statistical methods……………………………………………………….…………29 Subjects and Clinical Characteristics………………………………….……………30 Results and Discussion………………………………………………………..32 Paper I and II ECP in Neutrophils, monocytes and macrophages………………………………....32 De novo production of protein in circulating cells?…………………………………32 Uptake, storage and release…………………………………………………….……33 Figure 2………………………………………………………………………….…..35. 5.

(15) Figure 3………………………………………………………………………..35 Paper III and IV ECP gene sequencing…………………………………………………….……36 General population study…………………………………………………..….36 Figure 4……………………………………………………………….………..37 The 434 polymorphism in Hodgkin Lymphoma………………………………38 The 434 polymorphism in allergy and asthma………………………….……..38 Summary and Conclusions………………………………………………40 Aknowledements…………………………………………………………..41 Refereces……………………………………………………………………43. Abbreviations α2M αxβx βx B-cell BPI C/EBP CHL CR cSNP EBV E.coli ECP ECR EG-2 EPO EPX/EDN FcxR GATA G-CSF GM-CSF GADPH GI H cells HL H-RS ICAM-1 Ig IGF-1 IL. alpha 2 Macroglobulin integrins integrin B lyphocyte Bacteria permeability increasing protein CAAT box / enhancer binding protein Classical HL Complete remission SNP in coding region Eppstin Barr virus Escherichia coli Eosinophil cationic protein Erythrocyte sedimentation rate ECP specific Mab Eosinophil peroxidase Eosinophil protein X/Eosinophil derived neurotoxin Fc receptor Transcriptionfactor Granulocyte colony stimulating factor Granulocyte/Macrophage stimulating factor Glutaraldehyde dehydrogenase Gastointestinal Histocytes Hodgkin lymphoma Hodkin Reed Sternberg cells Intracellular adhesion molecule I Immunoglobulin insulin like growth factor 1 Interleukin. 6.

(16) IPS LDHL LFA-1 L&H cells LMP-1 LRHL Mab MAC-1 MBP MCHL MCP-5 M-CSF MHC II MIP-1α MPO NFAT NFkB NLPHL NSHL PAF PCR PU.1 RNase RANTES rECP RSV-B RT S.aureus SNP Th2 cell T cell TCR TGF-b TNF-a UTR VCAM-1 Vla-4 WBC. International prognostic score Lymphocyte depletion HL Leukocyte function associated antigen 1 Lymphocytic and histocytic cells latent membrane protein 1 Lymphocyte rich HL Monoclonal antibody Monocyte adhesion complex 1 Major basic protein Mixed cellularity HL Monocyte chemotactic protein 5 Macrophage- colony stimulating factor Major Histocomptability complex class II Macrophage inflammatory protein 1α Myeloperoxidase Nuclear factor of activated T cells Nuclear factor kappa B Nodular lyphocyte predominance HL Nodular scleroting HL Platlet activating factor Polymerase chain reaction transcription factor Ribonuclease Regulation upon activation normal T-cell expressed presumed secreted recombinant ECP Respiratory syncytial virus B Reverse transcriptase Staphylococcus aureus single nucleotide polymorphism T Lymphocyte type 2 T lymphocyte T cell recptor Transforming growth factor beta Tumour Necrosis factor alpha Unstranslated region Vascular cell adhesion molecule 1 Very late antigen 4 White blood cell count. 7.

(17) Introduction Inflammatory cells of the innate immunity system The common ancestral tasks of the innate immunity cells are those of phagocytosis of foreign intruders and secretion of destructive peptides and proteins (1), but through evolution different cells have evolved and become specialised in different ways. The leukocytes of the myeloid lineage constitute a separate defence system older than the lymphatic immune system, but a prominent cross talk has evolved between these cells. The cells all have receptors for immunoglobulins (Ig´s), one of the many connections to the lymphatic immune system. In several dysregulatory conditions the cells are recruited and perform actions that damage the tissue. The leukocytes of the innate immunity system are produced in the bone marrow and released into the bloodstream. Cells of the innate immunity system are neutrophils, eosinophils, basophils, mast cells and monocytes/macrophages. In the circulation the neutrophils and monocytes act as guards towards bacteria, whereas the eosinophils and differentiating macrophages leave the blood to perform their actions. By guidance of adhesion molecules on the blood vessel walls the cells are targeted to specific locations in the human body. The cells adhere to the wall and leave the blood vessels, moving towards an inflammatory focus. The speed and direction of the cells moving through the extracellular matrix is influenced by chemokines, and other substances, secreted by fibroblasts, epithelial cells and other cells in and in the vicinity of the inflammation area. Eventually the cells reach their target of action and obliterate it by phagocytosis or release of defence peptides, proteins, oxygen radicals or other mediators. Below three of these cells are reviewed i.e. the eosinophil granulocyte, the neutrophil granulocyte and the monocyte. Furthermore, one of the basic proteins involved in defence i.e. “the eosinophil cationic protein” (ECP), which is the main focus of this thesis, is reviewed. Finally, the occurrence and importance of eosinophils and ECP in the human diseases, allergy/asthma and Hodgkin lymphoma is discussed.. The eosinophil granulocyte Eosinophil granulocytes represent 1–8% of the leukocytes in the circulation. After release from the bone marrow the cell stays in the circulation for about 25 hr (2). The eosinophil is regarded as a cell mainly dwelling in the tissue, living there from a few days up to weeks. Most of the eosinophils are found in the submucosal tissue beneath the epithelial cells of the lungs, in the gastrointestinal (GI) tract and in the skin. Adhesion molecules are upregulated on the endothelial cells in the blood vessel wall, most likely in the post-capillary venules in the microvasculature, close to the inflammation focus. After activation the eosinophils roll along the vessel wall and adhere by specific ligand-receptor interaction that is called tethering (3). The surface. 8.

(18) receptors α4β1 (very late antigen-4, VLA-4)- and α4β7-integrins are expressed on the eosinophil (unlike neutrophils). The MAdCAM-1 is counterreceptor for α4β7 and is almost exclusively expressed on gut endothelium. VLA-4 binds vascular cell adhesion molecule-1 (VCAM-1). Other receptors are commonly shared by other leukocytes such as L-selectin and P-selectin glycoprotein-1 (4-6). The P-selectin glycoprotein ligand 1 is the receptor for the latter. The cell comes to a firm arrest at and migrates out from the blood vessel between the endothelial cells. The receptor involved in this migration is the VLA-4/VCAM-1 and b2 (CD18)/ICAM-1 interaction (7). The eosinophil is thought to be involved in parasite killing and antiviral defence but not bacterial killing (8). Moreover, the evidence suggests that the cell participates in wound healing and as an aid in defence against certain tumours (9). On the surface of the cell there are Fc receptors for IgA (FcαR) (10), IgG (FcγR) (11) and IgE (FcεRII) (12). The IgA receptor is useful in regions of the body where the cell is in combat with intruders (GI tract, lungs).Chemokines of the CC family, expressed in the tissue, which attract and activate eosinophils, are RANTES (13), macrophage inflammatory protein-1α (MIP-1α) (14) and eotaxin (15). Receptors for RANTES, i.e. CCR-1 and CCR-3, are present on the eosinophils. CCR–3 also binds eotaxin and MIP-1α. Eosinophils are believed to be involved in diseases such as asthma, allergy, atopic dermatitis and Hodgkin lymphoma, because the cells most often are present at the foci of these conditions. In these conditions the eosinophils most probably are involved in tissue destruction or remodelling (16). After their task is performed the cells are believed to go into apoptosis (17). The eosinophil was first discovered by use of the acidic dye eosin during stainings performed by Paul Ehrlich in 1879 (reviewed in(18)). The cells have a bilobated nucleus and only traces of endoplasmic reticulum. The red colour of the eosin stained eosinophil granules and indicated that they contain a large amount of basic proteins. The eosinstained granules are the secondary (or specific) granules of the eosinophil, and in the electron microscope they are found to contain a densely packed crystalloid core and more loosely packed surrounding matrix. The eosinophil protein major basic protein (MBP) makes up most of the core (19), but other proteins such as IL-2, IL-5 and catalase are also found there (20-23). In the matrix three other granule proteins, eosinophil protein X/eosinophil-derived neurotoxin, (EPX/EDN), the eosinophil peroxidase (EPO), and the eosinophil cationic protein (ECP) are found. Other proteins found located in the matrix are IL-6 (24), tumour necrosis factor α, (TNF-α) (25), RANTES (26) and bacterial permeability increasing protein (BPI) (27). The eosinophil is a poor phagocyte; instead, it takes part in defence reactions by secretion of the contents of the granules. The release of eosinophil granules is suggested to be performed either through piecemeal degranulation, by exocytosis or by cytolysis. Exocytosis is the common way for phagocytes to secrete granule content, i.e. by fusion of the granule with the cell membrane (28,29), and would be the way for eosinophils to kill parasites (30). By piecemeal degranulation granules are gradually emptied into small vesicles and transported to the cell membrane. This might allow for the specific release of certain proteins (31). Cytolysis is an extreme alternative in which the whole cell is disrupted. Cytolysis has been shown in vitro by mixing cells with immunoglobulincoated beads (32) or ionophore A (33). In pathological conditions piecemeal degranulation and cytolysis, but not exocytosis, have been observed in vivo (34).. 9.

(19) The eosinophils mature in the bone marrow under the influence of the cytokines IL-5, IL-3 and GM-CSF (35), as has been shown by culture of CD34+ stem cells in vitro (36). Through myeloblast, promyelocytic, and myelocytic stages the proteins of the cells are produced and transported to the appropriate locations in the cells, such as the granule for the granule proteins. So far, no eosinophil lineage-specific transcription factors have been found for eosinophil-specific transcription, but several common to haematopoietic blood cells are involved, such as PU.1, members of the C/EBP family and GATA members (37-40). During the eosinophilic band stage the nucleus starts to condense the ER to retract and the protein production is shut down (41). This differentiation in the bone marrow takes on the average 3.5 days (42). In certain inflammatory diseases eosinophilopoiesis is enhanced (42), perhaps by increased production of IL-5 (43,44) or eotaxin (45) in the inflammation focus or directly in the bone marrow. IL-5 is involved in release of mature eosinophils (46), whereas eotaxin also participates in the release of immature cells from the bone marrow (47,47). Some mRNA and perhaps protein production is persistent in the circulation (36,48).. The neutrophil granulocyte Similar to the eosinophil, the neutrophil granulocyte has a lobated nucleus and large granules with proteins produced for defence. The neutrophil progenitors constitute 55– 60% of the bone marrow blood cells. In the circulation, the neutrophil represents on average 58% of the white blood cells and the cell stays in circulation for 14–20 hr before moving into the tissue. As for the eosinophil there are specific and common receptors upregulated on the blood vessel wall for the neutrophil to leave and move to an inflammatory site. Common receptors are L-selectin and P-selectin glycoprotein-1; specific for the neutrophil is E-selectin (49). Chemokines known to guide the neutrophil outside the circulation are, among others, C5a, platelet-activating factor (PAF) (50) and IL-8. The cells stay in the tissue from several hours up to 2 days before apoptosis and engulfment by macrophages. The neutrophils' main task is bacterial defence, and unlike the eosinophil, the cell phagocytises its targets, which end up in phagosomes where granules fuse with the phagosome and release the content on the imprisoned intruder (51). Similar to the eosinophil, the neutrophil contains a large number of granules that contain proteins shown to have bactericidal activity. At least 13 different granule populations have been separated by gradient centrifugation (52), but the most prominent are the primary (azurophil), secondary (specific) and secretory (gelatinase) granules. The most common and largest are the primary granules, containing lysozyme (53), myeloperoxidase (MPO) (54), elastase (55), defensins (56) and cathepsin G. Secondary granules contain lysozyme, collagenase, human neutrophil lipocalin and lactoferrin. The neutrophils have also been shown to take up non-neutrophil-produced proteins such as albumin (57) and EPO (58). In the bone marrow the cells differentiate and mature under the influence of G-CSF and GM-CSF. The different granules mature at different time points (59,60). The primary granules mature during the promyelocyte stage and the secondary granules during the myelocyte stage. Accordingly, MPO and elastase mRNA are found to be expressed during the promyelocyte stage and lactoferrin during the metamyelocyte stage (61). Common and lineage-specific transcription factors are involved in the production of the proteins. MPO production is directed by PU.1 and. 10.

(20) C/EBPs (62,63). Slowly over the maturation stages the mRNA production is decreased to only a small amount in circulating cells (64).. The monocyte/macrophage The monocyte/macrophage is mainly a phagocyte and bacteria and viruses are the main non-host targets. The cell is also involved in the clearance of ageing or apoptotic cells and defence against tumours (65). In contrast to the granulocytes the monocyte has a non-condensed nucleus when present in the circulation. Hence, the cell is not in an end point stage of differentiation, reflected by the fact that the cell represents only 3% of the bone marrow pool (66), and has functioning Golgi and mitochondria. The cell has a halflife in the circulation of 8–71 hr, representing 4% of the white blood cells. Monocytes express L-selectin, but it might be of less importance than for granulocyte endothelial adhesion. Adhesion receptors used by monocytes are members of the CD18 family: CD11a/CD18 (LFA-1), CD11b/CD18 (Mac-1) and CD11c/CD18 (glycoprotein 150,95) (67). The counterligands on the endothelial cells for LFA-1 and Mac-1 are ICAM-1 and -2 (68). ICAM-2 is inducible, whereas ICAM-1 is constitutively expressed (69). The monocyte also has fibronectin and laminin receptors for movement in tissue. The monocyte starts gene-regulated differentiation processes, dependent on the tissue the cell is moving into, in which the cell becomes an organ-specific macrophage (70). Macrophages are found outlining blood vessels in the connective tissue, in lung, liver, spleen, synovia and bone marrow. The cells might survive in the tissue from months up to years. The slow monocyte/macrophage migration in tissue is dependent on different chemokines. Monocyte chemoattractant protein-1 (MCP-1) produced by fibroblasts (71), and RANTES, produced by T-cells (72) are such agents. The macrophage is a phagocyte, and the phagocytosis is facilitated by Fc receptors for IgG and IgE (73). The cells do not have the same large granules as the granulocytes. Small lysosomal granules contain defence proteins such as lysozyme and RNase4 (74) that are secreted into the lysosome or secreted to the outside of the cell. During differentiation into a macrophage the amount of lysosomal proteins is increased (75), but MPO production is decreased (76).The cross talk between macrophages involved in inflammation and the lymphatic immune system is of great importance because the macrophage acts as an antigenpresenting cell (APC) where the major histocompatibility complex class II (MHC II) of the macrophage interacts with the T-cell receptor (TCR) on the T-cell (77). This cross talk is facilitated by interferon-γ. Growth and differentiation of monocytes in bone marrow is dependent on GM-CSF and IL-3, which stimulate several types of cells (78) and the monocyte-specific M-CSF. The production of cells in the bone marrow increases as a consequence of inflammation.. The eosinophil cationic protein One of the eosinophil-produced proteins dedicated for defence, which is also the main focus of this thesis, is the eosinophil cationic protein (ECP).. 11.

(21) ECP was first discovered in the laboratory in which this thesis is produced (79). It was found to be located in the secondary granules of the eosinophil. The protein is a singlechain peptide of 133 amino acids (a.a.) containing three sites for N-linked glycosylation. The size of the protein ranges from 18 to 22 kDa depending on level of glycosylation (80). A bacteria-expressed recombinant protein without glycosylations is 16 kDa in size (81). The protein contains 19 arginines, giving the high pI of 10.7. All 19 arginines are located on the surface of the protein (82). ECP has been shown to bind zinc and also binds heparin in a 1:1 molar ratio (83). The protein is a ribonuclease (84,85) which preferably cleaves poly-U RNA, but not double-stranded RNA (86). ECP binds (the negatively charged) single- and double-stranded DNA but does not degrade it (J. Byström, unpublished observations). The protein is a member of the RNase A superfamily and has characteristics of the other eight human RNase A family members (87): four cysteine bridges, β-sheet backbone, α-helixes (88) and the a.a.´s lysine and histidine important for the RNA degradation (81). The eight ribonuclease genes are located in a row on the chromosome (chr) 14q arm with distances between 6 to 90 kb in between (87). The ECP gene contains two exons, 67 bp (89) and 667 bp with the complete coding sequence (cds) in the second exon (90). The promoter contains a CAAT and TATA box (90). The intron between the two exons contains regulatory elements, a nuclear factor of activated T-cells (NFAT) binding site (91), which might be bound by a eosinophil-specific transcription factor EoTF (91), and two PU.1 sites, which might all be involved in RNA transcription during eosinophilopoiesis. A leader sequence (81 bp) is found in front of the sequence coding for the protein (90). The leader sequence most likely codes for a prepeptide that during protein translation guides the protein to the ER, because 20 of the 27 proposed a.a.´s are either hydrophobic or aliphatic, which is typical for a signal peptide (92). The other eosinophil-derived ribonuclease EPX/EDN is 89% homologous on the mRNA level and 67% on the protein level. Forty-five a.a.´s differ in the mature peptides, and fifteen of these a.a.´s are arginine in ECP. The two genes are located at 64-kb distance from each other, with an ECP/EPX/EDN pseudogene in between. Duplication events calculated to have taken place 30–50 million years ago produced the two new active genes. This is after the time of separation of Old World apes from New World monkeys; the human apes have ECP and EPX/EDN whereas the monkeys only have one ribonuclease (93). Subsequently, the ECP gene was put under positive Darwinian selection over a short period, increasing the number of arginines (94). The reason for this quick evolution is at present unknown but might be related to pathogen fighting. Single-nucleotide polymorphisms (SNPs) are found in the ECP gene and in the surrounding area (95). Many species have RNase A family members, all with two exons and one intron, some of which are associated with eosinophils (96-98). Whereas the circulating eosinophil contains on average 13.5 µg ECP/106 cells (99) other cells contain small amounts as well (64). A discussion of these findings is part of this thesis (papers I and II). ECP measured in plasma roughly reflects ECP in whole blood and has been measured to be 3 µg/L (100). ECP released in blood showed a turnover time t½ of 45 min (101), and in the blood α2-macroglobulin (α2M) was found to bind ECP. This was confirmed in vitro at 1.5 × 1011 mol ECP binding to 1.4 × 10-10 mol α2M, which was facilitated by 1.4 × 10-10 mol cathepsin G or methylamine (102). ECP has been shown to interfere with artificial cell membranes (103) and is consequently discussed as a pore-forming protein. A number of studies have evaluated the physiologic and pathophysiologic role of the protein. Below is a review of most of the papers dealing. 12.

(22) with this matter. To simplify comparisons, the concentration has been recalculated to µg/mL in parenthesis, using the mean Mw of 19.000 for the native protein (16–22 kDa) in cases where the ECP concentration is expressed in molar concentrations. The eosinophil has been suggested to be involved in defence from intruders. Parasites When 3-hr-old larvae of Schistosoma mansoni were incubated with 1 × 10-5 M (190 µg/mL) ECP 60% were killed. S. mansoni, 3 days of age, were paralysed by the protein (104). ECP (5 × 10-5 M; 950 µg/mL) killed 40% of Trypanosoma cruzi in 6 hr and 90% of Brugia malayi in 48 hr. The cytotoxic effect was inhibited by negatively charged heparin (105) and dextran sulphate, probably by interfering with the many arginines in the protein. Also, heat inhibited the toxic effect, showing the importance of the conformation of the protein (106). RNase activity was clearly shown not to be important for parasite toxicity, which was the case for EPX/EDN. Bacteria The function of bacterial killing of ECP was evaluated on Escherichia coli (E. coli) and Staphylococcus aureus (S. aureus). ECP at 50 µg/mL decreased the number of colonyforming units (cfu) by 72% and close to 100%, respectively, for the two strains after 2 hr of incubation. ECP only killed E. coli growing in logarithmic phase and affected both the inner and outer membranes of E. coli. (107) Recombinant ECP did also show cytotoxicity to S. aureus. Overnight incubation of rECP with the bacteria at a concentration of 1 × 10-6 M (16 kDa, 16 µg/mL) remained 35% cfu. rECP in which two amino acids involved in RNase activity had been substituted (lys38arg and his128asp), terminating the RNase activity, did not show decreased bacterial killing (81). Virus Recombinant ECP expressed in a baculovirus system was used to evaluate the toxicity to respiratory syncytial virus B (RSV-B). ECP (0.5 × 10–6 M; 9.5 µg/mL) incubated with the virus showed a sixfold reduction of the infectivity of the virus to a human pulmonary epithelial cell line (108). This antiviral activity was lower than that shown by EPX/EDN (54-fold reduction) (109), but the infectivity was increased by addition of RNase inhibitor (RI) to both proteins during incubation. The two proteins mixed did not show a synergistic effect on antiviral activity. RNase A, however [up to 4 × 10-3 M (76 mg/mL)], did not show antiviral activity, suggesting that the RNase site but not activity is important for inhibition of infectivity. ECP function has also been tested on cells of the human body. In only one of the assays used was account taken of the RNase activity. Neurotoxicity Guinea-pigs were treated intracerebrally with 0.06–30 µg ECP. Doses of 0.1 up to 30 µg gave cerebral symptoms, with the highest doses very potent and the lowest clearly affecting cerebral activity until day 16 after sacrifice. Purkinje cells and other cells in the brain were killed (110).. 13.

(23) Asthma/Allergy The function of ECP has been analysed in several assays related to the presence of the eosinophil in the airways and in allergy. Both destructive and non-destructive effects have been found in interaction with various cells involved in asthma/allergy at various concentrations of the protein. ECP effect was analysed on guinea-pig tracheal epithelium. ECP at 5.4 × 10-6 M (103 µg/mL) caused exfoliation of mucosal cells after 6 hr of incubation (111). Lower concentration of the protein (2.5 µg/mL) caused release of respiratory glycoconjugates (marker of mucus) from feline tracheal explants with peak after 1 hr (112). The short, repeatable incubation time suggested a non-toxic mechanism. Because the basic protein MBP in the same assay showed the opposite effect, the mucus secretion cannot be dependent to electrostatic charge. ECP at 2.5 µg/mL showed the same effect on human trachea (112). Nasal epithelial cells were analysed for upregulation of the adhesion molecule ICAM-1. ECP (1 × 10-10 M; 2.1 ng/mL) was found to increase the expression of the adhesion molecule (113). Because eosinophils adhere to ICAM-1 with the β2 (CD18) integrin the upregulation was speculated as a positive feedback loop. ECP is also released by ICAM-1/β2 interaction (114). The effect of insulin-like growth factor 1 (IGF-1) on the bronchial epithelial cell line NCI-H292, was upregulated by incubation of 20 ng/mL of ECP with the cells for 16 hr (115). ECP was speculated to be involved in IGF-1-dependent lung tissue repair processes. Human embryonic lung fibroblasts were incubated for 6 hr with 10 µg/mL ECP. This resulted in a sixfold increase of proteoglycan accumulation. ECP affected the proteoglycan metabolism specifically and intracellularly (116). ECP might also be secreted in eyerelated allergy. Confluent primary human corneal epithelial cells were incubated with ECP, which induced a dose-dependent gradual increase in morphologic changes. At 100 µg/mL the protein induced decreases in cell viability (117). Mast cells Different kinds of mast cells have been evaluated for release of mediators, such as histamine, by the influence of ECP. Rat peritoneal mast cells were incubated with 9 × 10-7 M ECP (17 µg/mL) for 45 min, causing 50% histamine release. ECP did not cause histamine release from peripheral basophils (as MBP did) (118). Histamine release was not observed from human skin mast cells by incubation with up to 200 µg/mL ECP (MBP inhibited substance P-induced release from these cells) (119). Human heart mast cells, purified from traffic victims or subjects undergoing heart transplantation were analysed. ECP (2.5 µM; 4.7 µg/mL) within 60 sec caused release of between 10 and 80% of the mast cell preformed histamine and of some tryptase (MBP had a similar effect whereas EPX/EDN had no effect) (120). The release was found to be Ca2+-, temperature- and energy dependent, and ECP was non-toxic to the cells. PDG2 was de novo synthesised by the same amount of ECP added. Coagulation ECP shortened the coagulation time for plasma. This shortening was shown to be dependent on coagulation factor XII at 18 µg/mL ECP (121).. 14.

(24) Degradation of muscle protein ECP was shown to dose-dependently degrade myofibrillar proteins such as myosin heavy chain (MHC) and alpha-actinin. It also degraded the membrane-associated cytoskeletal proteins dystrophin and spectrin (122). The effects found on coagulation, muscle protein and heart mast cells might be symptoms found during conditions with eosinophilia such as the hypereosinophilic syndrome (HES), eosinophilic myositis or eosinophilic myalgia syndrome, in which ECP level in serum might be 4–10 mg/L. Lymphocytes ECP has further been analysed with respect to direct influence on the lymphatic immune system. Mononuclear cells (2 × 105) were incubated with or without phytohaemagglutinin (PHA) and 10-9–10-7 M ECP (190 ng/mL–2 µg/mL) for 48 hr, resulting in 67% or 50% inhibition of proliferation of the lymphocytes (123). The cells were not killed by the protein. As low as 0.5 ng/mL was shown to inhibit the immunoglobulin production by plasma cell lines (124), and 1 ng/mL inhibited immunoglobulin production by B lymphocyte cell lines (125). The effect was inhibited by anti-ECP antibodies, and ECP was not toxic to the cell lines because the cells continued to grow after addition of protein. IL-6 could restore the immunoglobulin production by the plasma cells, and IL-4 had the same effect on the B cells. Human plasma cells and large activated B cells responded to ECP in a manner similar to that of the cell lines (124). Growth inhibition of human cells The cell lines K562, HL-60 and A431 showed 50% inhibition of growth at 1.1 and 4 µM ECP (21 and 76 µg/mL), respectively, after 4 days of growth. To analyse whether growth inhibition was related to positive charge or RNase dependence, poly-lysine or RNase A was used with no effect (126). Similar results by the effect of ECP on K562 were found by A. Trulson et al. (unpublished observations).. Single-nucleotide polymorphisms and the eosinophil One of the findings from the Human Genome Project was that inter-individual singlebase pair differences exist approximately every 1000 bp. These base differences are referred to as single-nucleotide polymorphisms (SNPs). However, some genes contain many SNPs whereas others contain none (127). Some of these SNPs might be of no clinical importance whereas others might alter CDSs or regulatory sequences, eventually causing changes that result in clinical disease. Hence, the SNP-related changes might be a changed level of protein production or a functionally altered protein product. Databases are established containing SNPs for various diseases. At http://pga.mbt.washington.edu/resources.html several genes related to the eosinophil biology are found. SNPs for IL-3, IL-4, IL-4R, IL-5, IL-13 and TNF-α genes are listed, analysed on 24 White and 25 African American individuals.. 15.

(25) Inflammatory disorders involving the eosinophil There are several dysregulatory events that might occur in the human body depending on genetic and environmental circumstances that engage cells of the innate immunity system (in close collaboration with the lymphatic immune system). Two conditions in which both the eosinophil and its granule protein ECP are involved are asthma/allergy and the lymphatic tumour disease Hodgkin lymphoma. In asthma, the increase of eosinophils is 50- to 100-fold more than neutrophils in the lungs, suggesting the importance of the cell (128). In Hodgkin lymphoma, other leukocytes are at least equally abundant as the eosinophils. However, in certain states of the disease eosinophils appear to be of consequence for the outcome (129,130). The eosinophil involvement is these disease states is visualised in figure 1. Hodgkin lymphoma One malignant disease with inflammatory cells (as eosinophils) involved is Hodgkin lymphoma (HL). The overall mortality of HL is low, about 20% and likely due to good treatment (168). In 1996, 7,400 new cases were reported in the United States and about 160 new cases in Sweden. The disease is heterogeneous and shows a bimodal age distribution with an onset either at young age (20–30 years) or at older age (55 years and above) (169). The disease in young adults might be described as infection-like, whereas the disease in the elderly more closely resembles conventional malignancy (169,170). Genetic predisposition might play a role, especially for the young adult form (171). Social factors might be high education, small housing, highly educated mothers, and climate. These factors seem to be valid until the age of 55 years (172,173). These factors fit with the idea of young-onset HL being infection-like (174). HL is an atypical tumour disease because the tumour cell number in the total tumour mass is low. The tumour arises in the lymphatic system, and the tumour cells are called Hodgkin and ReedSternberg (H-RS) cells. The RS cells are large and contain two or more lobular nuclei, whereas the H cells contain one nucleus. Both are clonally expanded (175-177). They constitute only 0.1 - 10% (usually less than 3%) of the total cell number (178), but their presence in the tumour is obligatory for diagnosis. The H-RS cells are surrounded by a large number of bystander cells, lymphocytes, eosinophils and mast cells. H-RS cells originate and expand clonally in or close to a follicular germinal centre. HL arises in lymph nodes in 90% of cases and in 70% is situated in the part of the body above the diaphragm. Most commonly the tumour arises in cervical nodes and in 7% in inguinal nodes (179). The tumour cells can spread, e.g., to mediastinal nodes (180,181) and might become bulky, causing compression of adjacent organs. The cells might invade the spleen and subsequently the liver and bone marrow (182,183). Systemic symptoms that might occur are fever, night sweats, and weight loss. These symptoms are referred to as B-symptoms. Severe itching also occurs but is not referred to as a Bsymptom. Systemic symptoms have been linked to an unbalanced production of cytokines and expression of distinct surface antigens on involved cells (184). Staging of the disease is made according to the Ann Arbor system (185). Stage I involves only one lymph node station. In the highest stage, IV, the lymphoma involves spread to extranodular sites. In most HL cases the tumour cells are believed to be of B-. 16.

(26) cell origin. H-RS cells might express several B- or T-cell markers and have rearranged Ig and TCR genes but none of those proteins expressed on the surface (178). Results from single-cell analysis suggest that H-RS cells, at the haematopoietic stem cell level, have several gene expression programs running simultaneously, resulting in this multifaceted cell (186). Moreover, H-RS cells express receptors of activated lymphocytes, CD30, CD25 (IL-2 receptor), HLA-DR and CD71 (transferrin receptor) (187,188). CD30 has the ligand CD30L expressed on T-cells, monocytes (189), neutrophils, mast cells (190) and eosinophils (191). Another receptor expressed by H-RS cells is CD40, a member of the TNF receptor family. The CD40 ligand (CD40L) is expressed on T-cells and activates the H-RS cells (192-194). Because the H-RS cells only constitute up to three percent of the tumour, a number of other cells are involved. Histocytes (H cells, tissue macrophages) are present in the tumour. Except for these cells, other inflammatory or lymphoid cells are present to various degrees in different forms of the disease. In the WHO classification (195) HL is divided into classical HL (CHL, 95%) and nodular lymphocyte predominant HL (NLPHL, 5%). Nodular sclerosing CHL (NSHL) is the most common form of HL, constituting approximately 70% of CHL cases and affecting young adults more often than the elderly. Tumour nodules are subdivided by collagen bundles. The H-RS cells are of lacunar type. This histologic subtype is often characterised by numerous eosinophils. Mixed cellularity CHL (MCHL) represents 20–25% of CHL cases. H-RS cells are more numerous than in other HL types. Interstitial fibrosis can be seen, but there are no broad bands of fibrosis as in NSHL. Eosinophils are usually present. The lymphocyte depletion CHL (LDHL) form of HL has the worst prognosis. However, under modern classification this histologic subtype is very rare. A lot of cases previously considered LDHL are now diagnosed as non-HL. H-RS cells are relatively predominant compared with the background lymphocytes. Lymphocyte rich CHL (LRCHL) is characterised by scattered H-RS cells in a nodular or diffuse background with an abundance of small lymphocytes. Neutrophils and eosinophils are usually absent. In NLPHL cases, lymphocytes, histiocytes, and epithelioid histiocytes are contained in nodules with few “popcorn-like” lymphocytic and histiocytic (L&H) cells. L&H cells express CD20, CD45, CDw45, and IgJ, unlike other forms, indicating the B-cell origin of tumour cells. L&H cells also lack CD15 and CD30 in almost all cases. Eosinophils are rarely present (130). Eosinophils in HL Several reports conclude that eosinophils are common in HL tumours and in some instances are predominant (129,202). The cell does not seem to be just an innocent bystander cell in the disease. IL-5 is found in the blood of HL patients accompanied with blood eosinophilia (203). In some instances bone marrow eosinophilia is associated with HL (204). Eosinophil presence in the tumour does not correlate, however, with elevated. 17.

(27) eosinophils in the blood (130). Eosinophilia in blood or bone marrow does not seem to correlate with a bad prognosis. Eosinophilia in the tumour, however, is common in HL. It was suggested earlier that eosinophilia is dependent on the presence of IgE in the tumour tissue and that those eosinophils were binding the Ig by CD23 (205). Eosinophils present in the tumour are related to bad prognosis especially in the NS form (129,130). H-RS cells are known to produce GM-CSF and IL-5, which attract and stimulate eosinophils (206). Eotaxin is also found in the tissues of NS patients and is correlating with eosinophilia (207). Fibroblasts in tumour are the producers of eotaxin, influenced by H-RS cells (208). The eosinophilia could be explained by prolonged survival of the cells (209). Two lines of evidence suggest that the cell is actively participating in the disease progression. Transforming growth factor-β (TGF-β) has been found in NS (210), and the source was both H-RS cells (211) and eosinophils (212). TGF-β is known to stimulate fibroblasts to synthesise and secrete proteins of the extracellular matrix (213) and to act as a chemoattractant for the cells (214). Secreted ECP from eosinophils also affects fibroblasts (116). Elevated levels of ECP measurable in serum in many HL patients correlate with NS and are probably secreted from the cells present in the tumour (215). Eosinophils also express CD30L (191,216,217) that can bind the H-RS CD30 and induce proliferation of those cells (218-220). This might explain why eosinophilia in NS tumours is associated with poor prognosis. CD30 cross-linking activates the transcription factor NF-kB via TRAF-2 (221). NF-kB activates cytokine secretion, proliferation and resistance to apoptosis of H-RS cells (222). In some variants of the disease the H-RS cells produce cytokines which attract eosinophils, which in turn stimulate the H-RS cells and affect fibroblasts. Eosinophils are also found in MCHL. The cells do not appear to be of similar importance for prognosis in this type of HL (130). MCLP is often associated with the Epstein-Barr virus (EBV) (223-225). EBV (226) and its oncogene product, latent membrane protein-1 (LMP-1) (224), have been found in H-RS cells and histiocytes in many cases of HL. LMP-1 does activate NF-kB and might be the cause of activation of H-RS cells (227). If EBV is not the cause for HL it at least accelerates its progression (228). Asthma/Allergy Asthma is a chronic inflammatory disease of the lower airways, characterised clinically by reversible airway obstruction and bronchial hyperresponsiveness (BHR). The mechanism responsible for BHR in asthma is unknown, but there is an indirect correlation between inflammatory reactions and BHR. The characteristic features of airway inflammation are leukocyte infiltration, epithelial shedding (131), basement membrane thickening, oedema and hyperplasia of mucus-secreting glands and hypertrophy of bronchial smooth muscle (132). Genetics plays a role in asthma development (133), and agents that cause symptomatic attacks are allergens (134), virus (135), and pollutants (136). Allergy involves a Th2 response, in which T helper (Th) lymphocytes have switched from the Th0 phenotype to Th2. This switch is mediated by IL-4. Characteristic for the response is that Th cells produce IL-4, IL-13 and IL-5. IL-4 and Il-13 stimulate the isotype switch of immunoglobulins (Igs) to IgE-type antibodies (137) in B lymphocytes and the maintenance of this production. IgE binds to the highaffinity IgE receptor (FcεRI) on mast cells, triggering the release of histamine and. 18.

(28) synthesis and production of lipid mediators and cytokines (138). IgE also influences the immune response by binding the low-affinity IgE receptor (FcεRI) (139,140). The level of IgE regulates the number of low (139)- and high (141)-affinity receptors on cells, both in a positive and a negative feedback loop. The allergic response typically has an early phase and a late phase reaction. In the early phase reaction tissue-dwelling mast cells are involved which degranulate histamine and lipid mediators responsible for vasodilatation and smooth muscle contraction of blood vessels, and in the case of allergic asthma, mucus secretion and bronchial mucosa oedema are observed in the airways. In the late phase reaction 6–9 hr later, other cells of the innate immunity system, eosinophils, macrophages and neutrophils, are recruited to the area guided by chemokines. The airway reactivity is increased in the late phase (142). For the eosinophils, this recruitment is due to IL-5 produced by the mast cells (143), Th2 cells and eosinophils (144) but also by chemokines of the CC family produced by endothelial cells and fibroblasts. Early in the late response eotaxin is important (145), but at later stage RANTES, monocyte chemotactic protein-5 (MCP-5) and macrophage inflammatory protein-1α (MIP-1α)(146) are shown to be important (147). IL-5 promotes the migration of eosinophils to a specific site and induces the release of ECP, which may affect lung function (148,148). IL-5 is also produced in the bone marrow and involved in eosinophil production (149) [as eotaxin (46)]. IL-5 might also influence eosinophil precursors in the blood that migrate and differentiate directly in the lungs (150). IL-1, TNF-α, IL-4 and IL-13 produced in the inflamed region (151) upregulate adhesion molecules on endothelial cells of the blood vessels such as VCAM1, to which eosinophils adhere via VLA-4 and thereby promote eosinophil accumulation at the site (152,153). This influx of eosinophils correlates with allergen exposure (154). Eosinophils that have reached the inflammation focus will secrete cytotoxic proteins, such as ECP, and other inflammatory mediators such as leukotriene C4 and PAF and TNF-α (155), which may give rise to the symptoms of the late phase allergic response. There is a close correlation between the intensity of the eosinophil-related inflammation and the severity of asthma in patients (156).(157) ECP correlates with severity when measured in bronchoalveolar lavage (158) or in serum (159). The effects of eosinophils and other cells and their granule content in the lung result in tissue remodelling with epithelial cell damage (111) and thickening of the basal membrane (160). Subepithelial tissues contain more type I and type III collagen in asthmatics than in normal subjects (161). Damage of the epithelium might be caused by eosinophils entering the bronchi or by those found located in the subepithelial layers (162). In non-allergic asthma, eosinophils are not as prominent and the basement membrane layer is not thickened as in allergic asthma (163), suggesting that this disease is less eosinophil dependent. The eosinophil might contribute to airways remodelling by releasing transforming growth factor-β (TGF-β) (164), affecting fibroblasts (165) facilitated by ECP (116). The affected fibroblasts secrete extracellular matrix proteins, which are involved in the remodelling. Transcription factors of the NFAT family are known to be involved in inflammatory lung disease (166). NFATp and -c were found in eosinophils obtained by bronchoalveolar lavage, and NFATc was translocated to the nucleus by incubation of the cells with IL-4 and IL-5. The ECP promoter contains an NFAT binding site, but it is not known whether de novo synthesis of the protein occurs as a consequence of this translocation (167).. 19.

(29) Figure 1. The eosinophil involvement in Hodgkin lymphoma and Asthma/Allergy. The eosinophil matures in the bone marrow and is subsequently transported to the blood. Guided by different signals encounters the cell the inflammatory focus of the disease. CD34+ : progenitor cell. Th2: T-helper lymphocyte type 2, F: Fibroblast, H-RS: Hodgkin Reed Sternberg cell.. 20.

(30) The Aims of the Present Investigation. The eosinophil cationic protein has previously been shown to be present in cells other than the eosinophil. Aim 1 To evaluate circulating monocytes, alveolar macrophages and circulating neutrophils for the presence and possible production of ECP. If a cell contains the protein but does not produce the protein; continue to further evaluate whether the cell might take up the protein. Heterogeneity in size and function of native ECP purified from a large number of blood donors has been found.. Aims 2 & 3 To evaluate whether part of the size difference is related to differences on the genetic level. To evaluate whether one genetic polymorphism found in the ECP gene is related to the course and clinical findings of diseases previously shown to involve the eosinophils and ECP. Such diseases are allergy and asthma and Hodgkin lymphoma.. 21.

(31) Materials and Methods Subjects Cells used for different investigations were mainly obtained from healthy volunteers. Alveolar macrophages were obtained from patients with allergic and non-allergic asthma. Bronchial biopsies were taken from non-atopic smokers DNA was prepared from peripheral blood obtained from healthy volunteers and from asthmatic patients after their written consent. DNA from patients with Hodgkin lymphoma was obtained from frozen tumours. Cell separation procedures Granulocytes Eosinophils were isolated by negative magnetic immunoselection, as previously described (229-231). Mononuclear cells were separated from red blood cells and granulocytes by centrifugation on 67% Percoll (Pharmacia-Biotech, Uppsala, Sweden). Red blood cells were then lysed with water and granulocytes were washed. For eosinophil purification, the granulocyte mixture was incubated for 1 hr with magnetic beads coated with anti-CD16 antibody (Miltenyi Biotech, Bergisch-Gladbach, Germany). For neutrophil isolation, the granulocytes were incubated for 30 min with anti-CD9 antibody (Immunotech, Marseilles, France). The excess of antibodies was washed off, and the granulocytes were incubated with magnetic beads coated with antiIgG antibody (Miltenyi Biotech) for 1 hr. Subsequently the cells were resuspended and loaded on a separation column, which was placed in a strong magnetic field. In case of eosinophil isolation the mixture of granulocytes was directly applied to the column. Non-retained cells were eluted and counted, centrifuged on Cytospin slides and stained with May Grünewald-Giemsa. The purity of eosinophils or neutrophils was on average >98%. Purified cells were used immediately. To prepare mRNA from neutrophils for RT-PCR, the aim was to obtain neutrophils as close as possible to 100% purity. For this purpose, 40 mL of blood was drawn from an individual with low blood eosinophil counts. Neutrophils were then purified by the MACS system as described above, but the procedure was repeated twice more using 1.6 times higher concentration of the CD9 antibody. Each time, the amount of remaining eosinophils was determined by counting 20 000 cells on Cytospin slides. After the first and second rounds of purification, contaminating eosinophils were 0.5% and 0.07%, and in the third round when cells had been eluted in two portions, 0.02% and <0.005% (no eosinophils in 20 000 cells counted).. 22.

(32) Monocytes/macrophages Monocytes were isolated by either of three alternative methods (I–III). I) A mononuclear cell fraction was obtained after Ficoll gradient centrifugation of whole blood. The monocytes in this cell preparation were further purified by adherence to plastic for 2 hr. The purity of the monocytes was 79%, and the contaminating eosinophils constituted 0.75% of the cells. II) The mononuclear cell fraction was obtained after Ficoll gradient centrifugation after which the cells were incubated with anti-CD14-microbeads. The incubate was loaded on a magnetic column (MACS, Miltenyi Biotech), and the CD14-negative cells were eluted. After thorough washing of the column, the magnet was removed and the CD14-positive cells were obtained. Less than 0.03% eosinophils remained in the purified monocyte fraction, which was confirmed by counting 10 000 cells on Cytospin slides. III) Monocytes were separated on a discontinuous metrizamide gradient (232,233). Peripheral blood leukocytes were separated on a 16%, 18%, 20% and 23% w/v metrizamide gradient (Nyegaard & Co, Oslo, Norway). After separation the purity of the monocytes on top of the 16% metrizamide was 82 ± 6% (n = 6) with lymphocytes constituting the only contaminating cells, as estimated by light microscopy and staining for non-specific esterase. Alveolar macrophages were obtained from bronchoalveolar lavage fluid from patients with allergic or non-allergic asthma. In some experiments all cells were extracted for the preparation of RNA. In these preparations the macrophage content was 84–92% and the eosinophil content 0.3–2%. In other experiments the cells were suspended in culture medium and subjected to adherence to plastic dishes for 2 hr as described previously (234). In these latter experiments the content of eosinophils was <0.01% and the content of macrophages 96%. Cell line culture The human myeloid cell lines U-937-1 (U-937), HL-60, THP-1 and Mono Mac 6 were cultured at 37°C with 5% carbon dioxide in a humidified incubator. Monocytic differentiation of the U-937 cells was induced by addition of 12-O-tetradecanoylphorbol diester (TPA, Sigma), all-trans retinoic acid or vitamin D3 to the culture media. Immunohistochemistry Sections of bronchial biopsies were fixed with undiluted Ortho Permeafix™ (Ortho Diagnostics, Raritan, NJ, USA) for 40 min and subsequently incubated with marker for eosinophils, Mab EG2, and macrophages, Mab α-CD68 (KP1, Dako, Glostrup, Denmark). Sections were incubated with the monoclonal antibodies at room temperature in a humid chamber for 1 hr, and the biopsies were processed as previously described (163). Subsequent sections were used for the two different stainings.. 23.

(33) Microscopic techniques Light and Confocal Microscopy Samples were treated as previously described (235). Peripheral EDTA-blood, Venoject (Terumo, Leuven, Belgium) was incubated in Permeafix™ diluted 1:1 in distilled water. The suspension was mixed by gently pipetting it in and out. This procedure was repeated every 10 min during the fixation period of 40 min. The suspension was centrifuged and the pellet was resuspended in PBS-1.5% BSA-5% FCS and repeatedly mixed as described above. After 10 min, the cell suspension was centrifuged again and the leukocyte pellet was resuspended in PBS-0.2% BSA. a) Immunocytochemistry: Cells were centrifuged onto polylysine-coated microscope slides (Histolab, Gothenburg, Sweden) with a cytocentrifuge (Cytospin, Shandon, Astmore, UK). The slides were rinsed and incubated with the primary anti-ECP antibody EG2. Incubations were performed for 30 min in a humid chamber at room temperature and terminated by washing with PBS-0.2% BSA. The antigen-antibody complex was detected with the APAAP kit and fast red substrate (K 670, Dako, Glostrup, Denmark). The primary antibody was omitted in negative controls. After counterstaining with Mayer’s haematoxylin (Merck, Darmstadt, Germany) for 6 min, coverslips were mounted using fluorescence mounting medium (Dako, Glostrup, Denmark) and examined in a Leica DRMB microscope. b) Confocal microscopy: Cell samples, processed as a suspension, were incubated with FITC-labelled EG2 antibody. After 30 min at room temperature, the samples were washed twice with PBS. A drop of 20 µl of each cell sample was applied onto a polylysine-coated coverslip and mounted as described above. Confocal microscopy was performed with a confocal laser-scanning microscope originally designed and built in EMBL (Heidelberg, Germany) and later modified in the Laboratory of Biophysics, University of Turku, Finland. The system was implemented around a Zeiss Axiovert 10 inverted microscope. Immunoelectron microscopy EDTA-blood was used (Vacutainer system, Becton Dickinson, Meylan Cedex, France) and leukocytes were separated from red blood cells by sedimentation on Ficoll Hypaque (Pharmacia Biotech AB, Uppsala, Sweden). After 30 min at room temperature, red blood cells sedimented to the bottom of the tube. The leukocyte-containing plasma was collected and diluted with PBS and centrifuged for 5 min. The cells were washed twice with PBS and fixed with 4% paraformaldehyde and 0.5% glutaraldehyde in cacodylate buffer for 2 hr on ice. After washing with Ringer buffer and subsequent dehydration in ethanol (50 %, 75%, 90%, 95% and twice absolute ethanol, respectively), the cells were embedded in Lowicryll (KM4) (Agar Aids). Polymerisation was performed by UV light (360 nm) at –20°C. Samples were sectioned to a thickness of 50 nm with an Ultrotome V (LKB, Bromma, Sweden) provided with a diamond knife (Diatome, Bienne, Switzerland). The sections were mounted on Formavar-coated golden grids. The sections were first incubated in 1% BSA in PBS and then with primary antibody MAb 611 for 1 hr, at room temperature. After rinsing with PBS-0.2% BSA, goat antimouse IgG antibody conjugated to 10-nm gold particles (British BioCell International, Cardiff, UK) was added and incubated for 30 min. Control samples were incubated with secondary antibody only, or alternatively the primary antibody was replaced by a non-. 24.

(34) relevant anti-human murine IgG (Dako Pats, Glostrup, Denmark). The samples were analysed in a Hitachi 100 electron microscope. Flow cytometry for detection of protein inside cells, already present or taken up in vitro Mononuclear cells and granulocytes were isolated from citrated or heparinised blood, respectively, by Percoll gradient centrifugation. In experiments performed to detect possible ECP uptake in granulocytes, 1 × 106 granulocytes were mixed with 4.5 µg of purified ECP (80). The protein-cell mixture was incubated for 30 min at 37°C. Subsequently the cells were washed four times with PBS. The different cell suspensions were separately fixed with an equal volume of 4% paraformaldehyde (PFA) for 5 min at 4ºC followed by a wash with PBS-0.5% BSA. Subsequently the samples were premeabilised for 5 min by PBS-0.1% saponin-0.5% BSA. Each sample was incubated for 30 min with either FITC-labelled monoclonal anti-ECP antibodies clone 612, clone 652, EG2 or monoclonal anti-EPO antibody clone 673 (Pharmacia & Upjohn Diagnostics, Uppsala, Sweden), or a negative control (Dakopatts, Glostrup, Denmark) (236). After washing, the cell samples were resuspended and analysed with an EPICSXL (Coulter Company, Hialeah, FL, USA) flow cytometer. Monocytes and lymphocytes were identified by their forward/side scatter pattern in combination with staining of monocytes with PE-labelled anti-CD14. Neutrophils and eosinophils were separated by use of forward/side scatter pattern induced by permeabilisation (237). The mean fluorescence intensity (MFI) of monocytes, lymphocytes, and eosinophils labelled with the different monoclonal antibodies and the negative control was measured. The MFI of neutrophils incubated with and without ECP was measured, and the values of mean fluorescence intensity were converted to mean equivalents of soluble fluorochromes (MESF) by the use of DAKO FluoroSpheres (DAKO, Glostrup, Denmark). Subcellular fractionations Granulocytes were suspended hypotonic sucrose (6% w/w sucrose in 10 mM PIPES) and incubated on ice for 15 min. Subsequently the cells were sonicated (Soni Prep sonicator) for 15 sec at an amplitude of 8 µm. Tonicity of the solution was restored by addition of 34% (w/w) sucrose. Remaining intact cells and nuclei were spun down, obtaining a post-nuclear supernatant (organelle-containing cell cytoplasm). Sucrose gradients were prepared by overlaying consecutively a 60% (w/w) sucrose cushion with 55, 50, 46, 42, 38 and 34% (w/w) sucrose solutions in 10 mM PIPES, pH 7.4. To produce continuous gradients, sucrose diffusion was allowed for 3 hr at room temperature. The gradients were overlaid with post-nuclear supernatants and subjected to overnight centrifugation at 85 500 g (rav), in a Beckman ultracentrifuge (SW28.1 rotor), at 4°C. Forty fractions were collected from the top of the gradients by upward displacement with 60% sucrose and stored at –20°C until analysis. Fraction densities were determined by using a refractometer (Bellingham & Stanley Ltd, UK). The peak densities corresponding to the two subpopulations of neutrophil primary. 25.

(35) granules [1.21 and 1.23 g/mL (238)] and to eosinophil-specific granules [1.25 g/mL (48)]. Subcellular localisation of internalised ECP a) Subcellular fractionation studies Granulocyte suspensions (92.2% neutrophils) were incubated for 30 min without or with ECP (9 or 90 µg/mL) at 37°C, in a total volume of 0.05 mL. [125I]ECP was then added, and incubations continued for 1 hr. b) Chase experiments Granulocytes (97% neutrophils) were first incubated for 30 min at 37°C with [125I]ECP and then cold ECP (final concentration 45 µg/mL) or PBS (controls) was added. Incubations were continued for 5 or 30 min. c) Temperature dependency of internalisation Granulocytes (93% neutrophils) were incubated with 90 µg/mL ECP for 30 min at either 4°C or 37°C. [125I]ECP was then added, and incubations were continued for 1 hr at the same temperatures as before. d) Secretion experiments Granulocytes (98% neutrophils) were incubated for 30 min with 90 µg/mL ECP at 37°C. [125I]ECP was then added, and incubations were continued for 1 hr. Cells were washed, and one portion was left on ice and used later as a control. Another portion was resuspended to a final concentration of 1 × 106/mL with HBSS-extra. Serum-opsonised Sephadex G-15 particles were added to a final concentration of 55.5 mg/mL (239). After 20 min at 37°C, the cells were washed with PBS. Cells from all fractionation experiments, including controls, were washed, disrupted by sonication and subcellularly fractionated on sucrose gradients as described above. Protein measurements The monocytes analysed were purified by metrizamide gradient centrifugation. Approximately 5.0 × 106 cells were lysed in 0.5% or 1% N-cetyl-N,N,N-trimethylammonium bromide (CTAB) at room temperature for 1 hr. Cell debris was spun down, and the supernatant was stored at –20°C or at –70°C. ECP and MPO were measured with a commercially available radioimmunoassay (RIA) (Pharmacia & Upjohn Diagnostics, Uppsala, Sweden) according to the instructions supplied by the manufacturer (101). Undiluted gradient fractions were assayed by RIA. Total protein was measured with the BCA method (Pierce, Rockford, IL). RNA preparation Total RNA was extracted from the various cells with Trizol (Invitrogen, Groningen, The Netherlands). Concentrations were measured at 260 nm on a spectrophotometer. 26.

(36) (SPECTRAmax 250, Molecular Devices, USA), and integrity of the RNA was confirmed by agarose gel electrophoresis. DNA preparation EDTA-blood was used for DNA preparations as has been described previously (240) with minor modifications. The blood was mixed with TE (Tis-EDTA), with low EDTA concentration, and centrifuged for 10 sec at 15 000 g, and the supernatant was discarded. This procedure was repeated two additional times, until all red blood cells were lysed. From this step on the white blood cell pellets (papers III and IV) and the tumour sections (paper III) were treated similarly. Thus the preparations were resuspended in proteinase K buffer and incubated at 56°C for 2 hr. Subsequently the samples were heated to 95°C for 10 min to inactivate the proteases. DNA concentration and purity were measured at 260 and 280 nm in a spectrophotometer. Reverse transcriptase and polymerase chain reaction Total RNA (0.1 or 0.5 µg) was used in the reverse transcriptase (RT) reaction with MMLV reverse transcriptase and oligo-dT from Invitrogen (Groningen, The Netherlands). Reactions were incubated for 1–1.5 hr at 37°C. After heat inactivation at 95°C for 5 min, the cDNA reaction was precipitated and dissolved in distilled water. One hundred nanograms of DNA was used for DNA amplification. Primer concentrations were 20 pmol/reaction, and Taq polymerase (Invitrogen) was used at 1 U/reaction. Primers E1 & E2 (see Table 1) were used for ECP mRNA amplification; E1 & E3 were used for probe production. X1 & X2 were used for EPX/EDN amplification. B-actin primers B1 & B2 were used for control amplification of mRNA, whereas G1 & G2 produced a control fragment used in Northern blotting. For ECP gene amplification two primer pairs, E4&E5 and E6&E7, were used. One of each pair was biotinylated for sequencing reactions with ALF express (Amersham Biosciences, Uppsala, Sweden). The following PCR profile was repeated 30 cycles for PCR subsequent to RT: 30 sec at 96°C, 30 sec at 53°C and 1 min at 74°C, followed by an extension period of 5 min at 74°C using a thermocycler (Rapid Cycler, Idaho Technology, Idaho Falls, ID, USA). The same PCR profile was used for amplification from DNA but with an annealing temperature of 51°C. Five microliters of the amplification product was electrophoresed in a 1% agarose gel containing 0.2 µg/ml ethidium bromide and visualised by UV light and photographed. Digestion of PCR fragments containing the ECP gene The EPX/EDN gene is highly homologous to the ECP gene. To check the specificity of the ECP gene amplifying primers PCR product was digested with the ECP gene specific restriction enzyme ClaI (10 U; Invitrogen). Digestion was performed overnight at 37°C. The enzyme was heat inactivated, and 10 µl were analysed on a 1.5% agarose gel containing 0.2 µg/ml ethidium bromide. DNA samples from asthmatic and HL patients were amplified with primers E4&E5, producing a 644-bp fragment. The PCR product was incubated with 10 U of PstI in an appropriate digestion buffer (Invitrogen). The. 27.

(37) samples were digested overnight and subsequently analysed on an 1.5% agarose gel containing ethidium bromide. Table 1. Primers ECP gene (GenBank no. X16545) E1: 5´ primer, 5´-gccacagctcagagactgggaaaca-3´ (bp 302–321 and 597–602, spanning two exons) E2: 3´primer 5´-acaggagcttagatggtgg-3´ (bp1046–1028) E3: 3´primer 5´-ggacagttgctgatacccagagtac-3 (bp 1138–1114) E4: 5´ primer, 5´-gtgtgtcataaccgagaccggatag-3´ (bp 495–519) E5: 3´ primer, 5´-ggacagttgctgatacccagagtac-3´ (bp 1138–1114) E6: 5´primer 5´-atggttccaaaactgttcacttccc-3´ (bp 556–580) E7: 3´primer 5´-agattgtcactaaatgacagcagagcggccgag-3´(bp 1241–1273) E8: 5´sequence primer 5´-Cy5-tctgcttcttctgttggggcttatg-3´ (bp 588–612) E9: 3´sequence primer 5´-Cy5-gatcttggctatgattgaggagctt-3´ (bp 1101–1077) EPX/EDN gene (GenBank no. X16546) X1: 5´-tctcacaggagctacagcgcg-3´ (bp 326–346) X2: 5´-gaatcatctaagctcctgtatcag-3´ (bp 1065–1088) β-Actin gene (GenBank no. M10277) B1: 5’-tgacggggtcacccacactgtgcccatcta-3’ (bp 2133–2162) B2: 5´- ggattctaatacgactcactataggaacagctagaagcatttgcggtggacgatggaggg -3´ (bp 3000– 2971) including T7 polymerase binding site (30 bp) GAPDH gene (GenBank no. M17851) G1: 5'-agaagactgtggatggcccc-3' (bp 587–606) G2: 5'-gaggtccaccaccctgttgc-3' (bp 995–1014). Northern Blotting DNA probes PCR fragments (ECP 605 bp and GAPDH 427 bp) were produced as described above and were ligated into the SmaI restriction site of the pBluescript plasmid. Ligase and plasmid were purchased from Amersham Pharmacia-Biotech. Five units of SmaI (Stratagene, La Jolla, CA) was included in the ligation reaction that was performed over 1 hr at 16°C. The CaCl2 competent E. coli strain XL1 blue was transformed with the plasmids, and the bacteria were subsequently plated on agar plates supplemented with 50 µg/ml ampicillin + IPTG/X-GAL. White colonies were screened, insert positive colonies were grown overnight in 1 ml of 1× LB and plasmids were prepared with a plasmid minipreparation kit (Qiagen). Subsequently plasmids were sequenced to verify cloning of the right insert with a sequencing kit (Autoread, Amersham Pharmacia-Biotech). Sequencing was performed as described below. The sequence was analysed by BLAST homology search on the National Center for Biotechnology Information (NCBI) website (www.ncbi.nlm.nih.gov).Probes used for Northern blotting were produced with a digoxigenin-based random hexamer labelling kit (Boehringer Mannheim GmbH, Mannheim, Germany). PCR fragments were produced with M13 universal and reverse. 28.

No results found