Supporting information
Warming effects on wood decomposition depend on fungal assembly history
Mattias Edman*, Saba Hagos and Fredrik Carlsson Department of Natural Sciences,
Mid Sweden University SE-851 70 Sundsvall, Sweden
Figure S1. a) Schematic outline of the experimental design showing the number of jars with wood discs inoculated with different initial species (assembly histories) in each temperature treatment. The temperature chambers include the same subunits in a complete randomized factorial design; b) schematic illustration of wood-disc replicates from above, exemplified by Antrodia sinuosa (As) as pre-inoculated species, showing the arrangement of strains. Species acronyms as in Table 1.
As 1
Fr 1
Pc 1 Cb 1
Ax 1
Gs 1 Pf 1 Fp 1
As 2
Fr 2
Pc 2 Cb 2
Ax 2
Pf 2 Fp 2 Normal
temperature n = 64
Elevated temperature
n = 64
As Ax Cb Fp Fr Gs Pf Pc
Strain 1
Strain 2
Strain 3
Strain 4
Strain 5
Strain 6
Strain 7
Strain 8
2 temperature levels
8 assembly history levels
8 strains per initial species
a.
b.
As 3Pc 3 Cb 3
Ax 3
Gs 3 Pf 3 Fp 3
…Etc.
Fig. S2. Schematic illustration of a wood-disc from above, showing the locations for drilling and re-isolation (black dots). Dotted lines indicate where the discs were split into eight pieces.
Species acronyms as in Table 1.
Fr
Pc
As Ax Cb
Gs Pf
Fp
Fig. S3. Number of remaining species (mean ± SE) under elevated (dark, n = 8) and normal (grey, n = 8) temperature treatments. The pre-inoculated species are indicated under the bars.
Different letters above bars indicate significant (P < 0.05) differences in species richness between assembly histories. Upper and lower case letters refer to different temperature treatments. Asterisks indicate significant differences between temperature treatments (*P <
0.05, **P < 0.01 and ***P < 0.001).
0 1 2 3 4 5 6 7 8
A. sinuosa A. xantha C. borealis F. pinicola F. rosea G. sepiarium P. ferrugineofuscus P. centrifuga
Final species richness
Initial species
B
B B
B
B
B
A A b
a a
a a
a a a
***
**
Fig. S4. Relationship between fungal species richness and wood mass loss after 9 months.
Data points represent means for assembly history treatments (n = 8). Light and dark grey circles indicate normal and elevated temperatures, respectively. Species acronyms of initial species as in Table 1.
0 1 2 3 4 5 6 7
10 12 14 16 18 20 22 24 26
Species richness
Wood mass loss (%)
Pc
Pc As
Pf Fr
Gs
Gs Fr Fp
Fp Cb
Cb Ax
Ax Pf As
R2 = 0.13, P < 0.001
Table S1. Cultured reference strains (and adherent Genbank and CBS accession nr.) used to verify species identity of 58 strains isolated from fruit bodies.
Species GenBank CBS
Antrodia sinuosa JQ518273 CBS132522
A. xantha DQ491424 -
Climacocystis borealis - -
Fomitopsis pinicola JQ518283 -
F. rosea DQ491410 -
Gloeophyllum sepiarium JQ518282 -
Phellinus ferrugineofuscus JQ518285 CBS132519
Phlebia centrifuga JQ518272 -
Table S2. Temperature treatments of the represented months showing average monthly temperatures used. The normal temperature is based on observed temperatures in northern inland Sweden (mid- to northern boreal zone) during the period 1961-1990 and the elevated temperature is based on the RCP 8.5 scenario for the years 1991-2100 in the same region.
Month Normal temperature Elevated temperature
August 12 17
September 8 14
October 4 10
April 1 6
May 7 13
June 12 17
July 13 18
Table S3. Results of a two-way ANOVA with fungal growth rate of pre-inoculated fungi as dependent variable and temperature and species identity as factors. Initial growth rate was measured two weeks after inoculation, expressed as the radial extension (mm) from the edge of the agar inoculum towards the center of the wood disc. Temperature was emulating normal (+12°) and expected elevated (+17°) average August temperatures.
Source Type III Sum
of Squares
df Mean
square
F P-value Eta
squared
Temperature 4.32 1 4.32 204.57 0.000 0.45
Species 2.46 7 0.35 16.62 0.000 0.25
Temp x Species 0.54 7 0.08 3.67 0.001 0.06
Error 2.36 112 0.02
Corrected Total 9.68
Table S4. Results of a two-way ANOVA with wood mass loss as dependent variable and temperature and initial species (assembly history) as factors.
Source Type III Sum
of Squares
df Mean
square
F P-value Eta
squared
Temperature 0.07 1 0.07 41.03 0.000 0.21
Assembly history 0.04 7 0.01 3.52 0.002 0.13
Temp x History 0.02 7 0.00 2.10 0.049 0.08
Error 0.19 112 0.00
Corrected Total 0.33
Appendix S1
To confirm the accuracy of the method we also performed a molecular analysis of 40
randomly selected sawdust samples. Each sample consisted of three pooled samples from one piece of wood. 0.25 g sawdust was ground in liquid nitrogen and thereafter transferred to a 2- ml screw-cap tube with glass beads and homogenized using a Fast prep shaker (Precellys 24 Bertin Technologies) while being kept frozen. DNA was extracted using PowerSoil DNA Isolation Kit (MoBio, Carsbad, Ca, USA). We developed species-specific primers targeting different parts of the ITS region, and their theoretical specificity was confirmed using the BLAST tool (NCBI, GenBank) (Table S5). Primers were then tested to rule out nonspecific binding of the species included. Testing was done by using different concentrations of DNA.
PCRs were performed according to the manufacturer’s recommendations (including cycle programming and reagent concentration). We used the lowest primer concentration suggested (Kapa Biosystems Taq PCR Kit). With this setup we were able to detect all species in a mix with 10 ng DNA, resulting in a successful reaction with all primers.
List of species-specific primers. Three of the primer pairs are not completely exclusive for the desired species. Itsaxa matches with one unspecified sequence on GenBank, itsfpin amplifies F. ochracea and itsgsep amplifies G. striatum. None of the unspecific species matches interferes with the experiment.
Species Primer name Oligo Ta Product
A. xantha itsaxanf aactttcagcaacggatctc 51.2 128
itsaxanr gaataccaaggagcgcaag
C. borealis itscborf tgcacacttcgcttcatcc 54.6 378
itscborr gccagcataaacctccacatc
F. pinicola itsfpinf cattatccatctcacacacctg 53.7 397
itsfpinr ttcaagaggagccgatcac
F. rosea itrfrosf ttgaaaggggttgttgctg 54.1 438
itsfrosr agaggagccgaaacaataaag
G. sepiarium itsgsepf ctactcaatccaaccttacacc 54.1 523
itsgsepr agttcagcgggtaatcctac
P. ferrugineofuscus itspferf gttttgaaagtgggctttgatg 51.9 101
itspferr gggaccgacaaacaaacttc
P. centrifuga itspcenf ctcatccactctcatacccc 53 333
itspcenr agcccaccaaatcaacaaag
A. sinuosa itsasinf ccctgctcatccattctacc 54.6 487
itsasinr agcaaatccctcaacacaac
