Physiological and Molecular Developmental Effects of a PPAR-agonist, GW7647, on zebrafish (Danio rerio)
Wenwan Dong Projektrapport från utbildningen i
EKOTOXIKOLOGI Ekotoxikologiska avdelningen
Nr 139
2
Contents
Acknowledgments……… 3
Abstract………4
1. I n t ro d u c t i o n … … … . . . 5
2. Ma teri a l s a n d Met h o d s … ……… …… …… … … … …… … ………… . . 9
2.1 Experimental solution……….9
2.2 Zebrafish and egg production………..………9
2.3 Exposure………...……….10
2.4 Determination of mortality………...……….10
2.5 Examination of heartbeat rate………10
2.6 RNA isolation and cDNA synthesis………..11
2.7 Quantitative real-time PCR………11
2.8 Data analysis………12
2.9 Statistics………12
3. R e s u l t s . . . 1 4 3.1 M o r t a l i t y. . . 1 4 3.2 Heartbeat rate...14
3.3 m R N A ex pr essi on . . . . .. . . .. . . .. . . .. . . .15
4. D i s c u s s i o n . . . 2 1 4.1 M o r t a l i t y. . . 2 1 4.2 H eartbeat rate... .. . ... ... ... .. ... ... .. ... .. ... ... . ... ... ... .. ... ... .. ... .. ... ... . .21
4.3 m R N A e x p r es s i o n . . . 2 3 5. Co n clu s i on . .. . . . .. . . . ... . . .. ... .. . ... . ... . .. . .. .. . .. .. . .. .. . .. .. . .. .. . . . .. .... . .. 2 7 References...28
3
Acknowledgments
I thank Prof. Björn Brunström for teaching and supervising of whole project. I also thank Dr. Jan Olsson for his technical advice, teaching of qPCR assays and analysis.
4
Abstract
Pharmaceuticals and their metabolites are emerging environmental contaminants.
Among these pollutants of concern, agonists to peroxisome proliferator-activated receptors (PPARs) are among those most frequently reported to be present in the environment. In contrast to knowledge about their environmental occurrence, little is known about their effects on organisms in the environment, especially on aquatic species. In this project, the aim was to analyze physiological and molecular effects of GW7647 in fish. GW7647 is known to be a selective PPARα agonist in humans.
Zebrafish (Danio rerio) embryos/larvae were exposed in 96-well plates to concentrations of 0.1 μM, 0.3 μM, 1 μM and 3 μM GW7647 for 8 days. After 3 days of exposure, the heartbeat rates of newly hatched larvae were determined. After 8 days of exposure, the fish larvae were analyzed for expressions of PPARs and three related genes by real-time quantitative polymerase chain reaction (real-time qPCR).
GW7647 caused a significant decline in heartbeat rate from 0.3 μM to 3 μM. There was no significant change in mRNA expression for any of the tested genes. The heartbeat decrease may be linked to activation of PPARs but the mRNA expression results did not indicate PPAR activation.
Keyword: zebrafish Danio rerio, GW7647, developmental stage, heartbeat rate, PPARs, acyl-CoA oxidase, liver fatty acid-binding protein
Abbreviation:
Peroxisome proliferator-activated receptors: PPARs;
Acyl-CoA oxidase: ACOX;
Liver fatty acid-binding protein: L-Fabp;
Enoyl-CoA hydratase/ L-3-hydroxyacyl-CoA dehydrogenase: Ehhdh;
Real-time quantitative polymerase chain reaction: real-time qPCR.;
Retinoid X Receptor: RXR
5
1. Introduction
Pharmaceuticals and their metabolites are emerging environmental contaminants and there is a growing use of pharmaceuticals in human and veterinary medicine.
Due to disposal of unused drugs, elimination from patient’s body, and discharge from the pharmaceutical industry, they are present in sewage treatment plant effluents and enter into the environment (Daughton and Ternes, 1999). Fibrates are among the most frequently reported pharmaceuticals contaminating aquatic environments. The concentrations of fibrates are up to μg/L levels in surface water and they are found in drinking water and some of them become persistent toxicants (Daughton and Ternes, 1999; Fent et al., 2005; Togola and Budzinski, 2007). Although the individual concentration of a drug may not cause acute toxicity in the environment, the combined effects of drugs and the sensitivities of nontarget organisms are unknown (Daughton and Ternes, 1999).
A variety of environmental contaminants including fibrates are classified as agonists of the peroxisome proliferator-activated receptors (PPARs). PPARs are nuclear receptors and fibrates exert their effects by activating these ligand-dependent transcription factors. Activated PPARs form heterodimers with the Retinoid X Receptor (RXR) and bind to specific regions of target DNA sequences to regulate the transcription of RNA. Therefore, activated PPARs induce transcription of peroxisomal enzymes, especially acyl-CoA oxidase (ACOX), and cause corresponding effects on lipid metabolism (Berger and Moller, 2002).
Since the PPAR (PPARα) was discovered in 1990 (Issemann and Green, 1990), the roles of PPARs in the regulation of metabolism, development and tumorigenesis have been studied. In this early study on PPARs, they were referred to increase the size and numbers of liver peroxisomes in rodent liver tissue (Issemann and Green, 1990).
Then PPARs were identified as receptors to induce peroxisome proliferation in Xenopus frog cells (Dreyer et al., 1992). In the paper by Dreyer and co-workers, the
6
presence and functions of PPARs during development were firstly studied in Xenopus frog embryos.
Three subtypes of PPARs have been identified and named as PPARα, PPARβ (also called PPARδ) and PPARγ. The subtypes have different tissue distributions (Berger and Moller, 2002). It was demonstrated that all three distinct PPAR subtypes are present in zebrafish (Danio rerio). PPARα was expressed mainly in liver, proximal tubules of kidney, enterocytes, and pancreas. PPARβ showed a widespread distribution, e.g. in kidney, pancreas, intestine, skin epithelium, lymphocytes, and gonads. PPARγ was expressed weakly in pancreas, intestine, and gonads (Ibabe et al., 2002). Additionally, the three subtypes of PPARs are also expressed in early developmental stages of frog (Xenopus) and zebrafish (Dreyer et al., 1992, Ibabe et al., 2005). The expression levels of the PPAR subtypes differ in different developmental stages in zebrafish. In adult females, PPARα and PPARγ were reported to be strongly expressed in the early stage oocytes, and moderately in late stage oocytes. PPARβ expression was generally more intense in juveniles than in other stages. For the different developmental stages, PPARβ was distributed similarly to PPARα but showed much weaker expression than PPARα. The expression of PPARγ was higher in the early stages than in adults (Ibabe et al., 2005).
Since contaminants that modulate PPAR-mediated activities were found in the aquatic environment, the potential risk of PPARs regulators to aquatic organisms are of particular concern. Opposing to animals that at least spend some time in terrestrial settings, aquatic organisms are subject to continual lifecycle exposure (Daughton and Ternes, 1999). There are many papers showing that PPARs agonists induce peroxisome proliferation and peroxisomal enzymes in both fish cell culture and exposed fish. In an earlier study, an environmentally relevant waterborne concentration of gemfibrozil (1.5 μg/L) induced oxidative stress in goldfish liver and a higher concentration (1500 μg/L) of exposure for 28 days reduced PPARβ mRNA levels (Mimeault et al., 2006). Micromolar concentrations of clofibrate or gemfibrozil
7
induced an embryonic malabsorption syndrome in zebrafish, resulting in little yolk consumption and small-sized larvae (Raldua et al., 2008). Clofibric acid induced the PPAR-regulated enzyme ACOX activity in male fathead minnows after 21 days of exposure to 108.9 mg/L (Weston et al., 2009). Injection of ciprofibrate in rainbow trout caused dose-related increases in peroxisomal ACOX activity (Yang et al., 1990).
Fenofibrate was also reported to increase the peroxisome-related activities such like catalase and ACOX in rainbow trout (Du et al., 2004).
Knowing the regulation mechanism by PPAR-agonists and the effects of some PPAR-modulators in fish led us to investigate the physiological and molecular effects of a PPAR-agonist, GW7647, on a common experimental aquatic vertebrate species, zebrafish.
GW7647 is a potent and subtype-selective human PPARα agonist. It is a man-made urea-substituted thioisobutyric acid, which activates the human PPARα, PPARγ and PPARδ with EC50 values of 0.006, 1.1 and 6.2 μM, respectively (Brown et al., 2001).
In a similar assay on murine PPARα, PPARγ and PPARδ receptors, GW7647 was also highly selective having EC50s of 0.001, 1.3 and 2.9 μM, respectively (Brown et al., 2001). In the present study, the tropical freshwater species zebrafish was chosen as the experimental fish. Because zebrafish are small, easy and inexpensive to care for, and produce large numbers of transparent embryos that develop outside of the mothers, they are common and important model organisms for studies of development. In last few years, numbers of investigations of toxic side effects of pharmaceuticals used the zebrafish (Rubinstein, 2006). Due to the sensitivity during developmental stages, zebrafish embryos and larvae are also used to investigate the toxicity of environmental contaminants (Hill et al., 2005). For example, the impact of ibuprofen (an over-the-counter drug) on the development of zebrafish implicated the drug’s embryotoxicity at a high (>10 μg/L) dose level (Anuradha and Pancharatna, 2009).
8
In this report, GW7647 was used to expose early stages of zebrafish and physiological effects and effects on mRNA expression of the PPARs and the target genes ACOX, Liver fatty acid-binding protein (L-Fabp) and enoyl-CoA hydratase/
L-3-hydroxyacyl-CoA dehydrogenase (Ehhdh) were studied.
9
2. Materials and Methods
2.1 Experimental solution
GW7647 and DMSO (dimethylsulfoxide) were purchased from Sigma-Aldrich (St.
Louis, MO, USA). A stock solution of 15 mM GW7647 was prepared in DMSO. Groups of embryos were exposed to four concentrations of GW7647 (3 μM, 1 μM, 0.3 μM, 0.1 μM). All the exposure waters and the control water were prepared to the same final concentration of DMSO (0.02%). The water used for zebrafish embryo exposure was treated under the conditions as described in the OECD Guideline 210 (1992).
2.2 Zebrafish and egg production
Zebrafish were obtained from a local pet store (Kalhälls Akvarium AB, Stockholm, Sweden) and kept in the aquarium facility at Department of Environmental Toxicology, Uppsala University. Fish were raised and maintained under 14-hour light: 8-hour dark cycle in a tank with 40% water changed daily. Water quality and environmental conditions were according to The Zebrafish Book (Westerfield, 2000). Fish were fed Aquarium Nature Tropical S Fishfood once a day.
A stainless steel cage with a mesh size of 1-2 mm was hanged into an aquarium as a breeding chamber. The cage was placed about 10 cm above to the bottom of the tank, thus allowing the eggs to be collected on the bottom and to be protected from predation by the adults. Artificial plants were put into the cage as breeding stimulant and substrate and the water temperature was about 28oC. Twenty-two adult fish (the ratio of male: female was about 1:1) were placed into the cage before the onset of darkness. Within 30 min after the onset of light in the next morning, all adults were removed with the cage and the eggs were collected.
10
2.3 Exposure
In order to start exposure with minimum delay, the collected eggs were divided evenly in five groups and transferred immediately into 100 mm crystallization dishes containing different test concentrations (3 μM, 1 μM, 0.3 μM, 0.1 μM), and control solution, respectively. An inverted microscope with magnification of 160× was used to distinguish fertilized eggs. The fertilized eggs were transferred into a 96-well plate with the same concentration of GW7647 that they were exposed to before. One fertilized egg was placed in each well. The embryos were reared in a dark incubator at 27oC. Half the volume of solution in each well was renewed every day. The whole exposure period was 8 days (from the spawning day to the fifth day after hatching), under food deprivation condition.
2.4 Determination of mortality
After selection of fertilized eggs, the embryos in each treatment were counted and the number noted. All the fertilized eggs per treatment were used to assess mortality in the different groups. The lethal endpoint included coagulation, tail-not-detached, no-somite-formation and no-heart-beat. Eggs were checked every 24 hours and the deaths were noted as “died before hatching” or “died after hatching”. The mortalities were expressed as a percentage.
2.5 Examination of heartbeat rate
After three days of exposure, the surviving hatched larvae were examined for heartbeat rate. Sixty individuals in each treatment or control were collected randomly to examine the heart rate. Twenty heartbeats for each larva was timed by stopwatch and noted. The data were used to calculate the number of heartbeats per minute. The final results for the different treatments were expressed as average heartbeat rate in one minute (beats/min).
11
2.6 RNA isolation and cDNA synthesis
After 8 days of exposure, 25 surviving larvae per concentration were considered as one sample and transferred into a micro tube; five samples were prepared for each concentration. All the samples of larvae were killed by instant freezing in liquid nitrogen.
RNA was isolated from the samples using the Aurum Total RNA Fatty and Fibrous Tissue kit according to the manufacturer’s instruction (Catalog #732-6830, Bio-Rad, Laboratories, CA, US). Once the RNA was bound and purified on the RNA binding column, it was eluted by nuclease-free water instead of the elusion solution in the kit.
The concentrations and purities of the RNA samples were assessed using a NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies Inc., DE, US). A standard volume of RNA (1 µg per sample) was reverse transcribed to cDNA using iScript cDNA Synthesis kit (Catalog #170-8891, Bio-Rad). cDNA was then diluted 1:100 in nuclease-free water.
2.7 Quantitative real-time PCR
Quantitative PCR reactions were conducted on a Rotor-Gene 6000 (Corbett Research, Sydney, Australia) using SYBR green technology. The reagents were acquired from Bio-Rad. The reactions were carried out using the iQ SYBR Green Supermix kit (Catalog #170-8885, Bio-Rad). The thermal profile for the SYBR green reactions was 3 min at 95 oC followed by 45 cycles of 15s at 95 oC, 15s at annealing temperature (51oC, 54 oC or 57 oC, different for different primers), and 20s at 68 oC. Data were collected during the 68 oC extension period.
Primers for each gene were published before or they were designed with Primer3 (v.
0.4.0) and evaluated with NetPrimer from PREMIER Biosoft (CA, USA). The primer
12
sequences are shown in Table 1.
Table 1: Nucleotide sequences for the primers used in the quantitative real-time PCR reactions.
Name Sequence (5’-3’) Accession number
DR* Forward TCTGGAGGACTGTAAGAGGTATGC NM 212784 Rpl13α Reverse AGACGCACAATCTTGAGAGCAG
DR Forward AAGGAAGCCGCTGAGATG ENSDART EF1α Reverse AGCACAGCACAGTCAGCC 00000023156
(Lin et al., 2009) DR Forward CTTCTTGGGTATGGAATCTTGC BC154531 β-actinB2 Reverse GTACCACCAGACAATACAGTG (Drew et al., 2008) DR Forward CATCTGCTGTGGAGACCGTC DQ 017612 PPARα Reverse CTTCTGTCTTGTTGATCTCCTGC
DR Forward GTCGCCGCAATCATCC XM 694808 PPARβ1 Reverse GCGTTCTCCGTCACCAG
DR Forward ATGACGCAATAAGGTACGG NM 131468 PPARδb Reverse CAGGTAGGCTGTGTTGACG
DR Forward CGCATACACAAGAAGAGCC NM 131467 PPARγ Reverse CGGTGACTTCGCTGATGG
DR Forward GAGGAGTTTCTCAGAGCCATCTC AF254642 L-Fabp Reverse TCCATAGTGGTGATTTCAGCCT
DR Forward GATTCTGTGGAGGTGCTGAC NC 007120 Ehhdh Reverse CAATGCGGTAATGACAGACTA
DR Forward AATAGAAGGAGAGAAATAGAGTC NM 001005933 ACOX Reverse CAACAGTCTTGTAGGAGTAGAT
* DR = Danio rerio (zebrafish)
2.8 Data analysis
Quantitative PCR data were analyzed using the Rotor-Gene 6000 application software.
The difference in target gene mRNA abundance between dosed samples and the DMSO control was calculated using the 2-ΔΔCt equation (Schefe et al., 2006).
2.9 Statistics
Statistical data analysis was performed by Microsoft Excel (Microsoft Corporation, Washington, USA) and GraphPad Prism 5 Demo (Ver. 5.3, GraphPad Software Inc., CA,
13
USA). Statistical differences between exposed groups and the DMSO control were calculated by a one-way analysis of variance (ANOVA) followed by Dunnett’s T-test.
Differences were considered significant if P<0.05.
14
3. Results
3.1 Mortality
After the selection of fertilized eggs, the exposed embryos were 174, 144, 160, 144 and 180 in concentrations of 3 µM, 1 µM, 0.3 µM, 0.1 µM and control, respectively.
Before hatching, there were 6, 2, 3, 3 and 4 dead embryos in these treatments. After hatching to the end of exposure, the numbers of dead larvae were 5, 2, 1, 2 and 2, respectively. Therefore, the total mortalities during the whole exposure period were 6.3%, 2.8%, 2.5%, 3.5% and 3.3% from the group exposed to the highest concentration to the control.
Besides the exposure from 0.1 µM to 3 µM of GW7647, an initial experiment was done using the same conditions but different exposure concentrations. Mortality among embryos exposed to 10 µM GW7647 was significantly higher (64.6%) than in the control group (3.1%). This concentration was excluded in the later experiment.
3.2 Heartbeat rate
After 72h of exposure, the heartbeat frequency of hatched larvae was examined. In each group, data from 60 larvae was collected randomly to calculate the mean value of heartbeats in 1 minute (See Fig 1). Generally, the control larvae had the fastest heartbeat rate (161 per min in average), while the heartbeat rate in the group exposed to 0.3 µM GW7647 was lowest (132 per min).
The heartbeat rate of larvae in 0.1 µM was faster (154 per min) than in other exposed groups, but the highest exposure concentration (3 µM) did not lead to the slowest heartbeat rate (140 per min).
Comparing with the control, there were significant differences for the groups
15
exposed to 0.3 µM, 1 µM and 3 µM. The P value was less than 0.0001 for the One-way Analysis of Variance and less than 0.0001 for Dunnett’s Multiple Comparison Test.
Fig1: Mean heartbeat numbers in 1 minute after 72 hours (from fertilization to hatching) of exposure to different concentrations of GW7647. Means were calculated from 60 individuals in one treatment. Variation is shown as standard error.
***P<0.0001 based on one-way ANOVA and Dunnett’s T-test.
3.3 mRNA expression
Ct values were obtained for three reference genes and seven test genes. Gene Rpl13α, EF1α and β-actinB2 were considered as reference genes and their expressions in the different groups were examined. Exposure of zebrafish early stages to GW7647 in different concentrations did not alter the Rp13α mRNA expression level compared to the control (data not shown). Therefore, the Rp13α was chosen for use in the later result analysis because it was expressed more stably than the other two genes.
For all genes examined (four PPARs genes and three PPARs-regulated genes) no significant difference in expression was observed between the undosed larvae and
16
the larvae exposed to GW7647 (see Fig 2).
The relative mRNA expressions of all the PPARs genes in the treatment groups were higher than in the control but the differences were not significant (See Fig. 2a-d).
Without considering the variations, the mean expressions in the treated groups for PPARα were approximately 2.5- fold, 2- fold, 1.7- fold and 1.5- fold the control value, respectively (Fig. 2a). For PPARβ1, the mean mRNA expression increased with increasing concentration, from 2 times higher (0.1 µM) to 2.5 times (3 µM) higher than the mean expression in the control (Fig. 2b). For PPARδb, mean values of mRNA expressions in the treatment groups were from approximately 3- fold (0.1 µM and 1 µM) to 2- fold (3 µM) the control value (Fig. 2c). For PPARγ, the relative mRNA expressions were approximately 4- to 5- fold in dosed larvae compared with the average value of the controls (Fig. 2d).
The variances were high and therefore differences were not significant in spite of large differences in mean values.
In GW7647-exposed groups, ACOX was nominally higher than the control value but no significant differences were found. When comparing the averages of all exposed groups to control, they were approximately 2.2- fold, 1.8- fold and 2.0- fold higher, respectively (Fig. 2e). Embryos exposed to 0.1 µM and 3 µM of GW7647 showed a slightly higher Ehhdh transcript abundance than the mean of the control (Fig. 2f), while embryos exposed to 0.3 µM and 3 µM showed a slightly higher L-Fabp transcript abundance than the control (Fig. 2g).
For all genes studied, the lowest variance always occurred in the control (see Fig. 2).
It indicates that control larvae may grow and develop more stably than dosed larvae.
17
Fig. 2(a): Mean (+S. E.) mRNA expression of PPARα after 8 days (from embryo to larvae stage) of exposure to GW7647. Means were calculated using data from five independent larva replicates and each replicate included 25 individuals.
Fig. 2(b): Mean (+S. E.) mRNA expression of PPARβ1 after 8 days (from embryo to larvae stage) of exposure to GW7647. Means were calculated using data from five independent larva replicates and each replicate included 25 individuals.
18
Fig. 2(c): Mean (+S. E.) mRNA expression of PPARδb after 8 days (from embryo to larvae stage) of exposure to GW7647. Means were calculated using data from five independent larva replicates and each replicate included 25 individuals.
Fig. 2(d): Mean (+S. E.) mRNA expression of PPARγ after 8 days (from embryo to larvae stage) of exposure to GW7647. Means were calculated using data from five independent larva replicates and each replicate included 25 individuals.
19
Fig. 2(e): Mean (+S. E.) mRNA expression of ACOX after 8 days (from embryo to larvae stage) of exposure to GW7647. Means were calculated using data from five independent larva replicates and each replicate included 25 individuals.
Fig. 2(f): Mean (+S. E.) mRNA expression of Ehhdh after 8 days (from embryo to larvae stage) of exposure to GW7647. Means were calculated using data from five independent larva replicates and each replicate included 25 individuals.
20 Fig. 2(g): Mean (+S. E.) mRNA expression of L-Fabp after 8 days
(from embryo to larvae stage) of exposure to GW7647. Means were calculated using data from five independent larva replicates and each replicate included 25 individuals.
21
4. Discussion
Developmental toxicity is a very important area of toxicology, since the development of embryos involves many organs and physiological processes. Effects can include low birth weight, malformations, behavioral deficits or even death of the newborn (Bailey, 2008). Studies in developmental toxicology show the potential adverse effects of chemicals during sensitive life stages and may be useful to predict the hazard of chemicals.
4.1 Mortality
Exposure to GW7647 in early stages might interfere with survival of zebrafish larvae.
Combining the results of mortality data from the two experiments, the mortalities in controls were stable and acceptable, only about 3% (3.33% and 3.13%). The mortality in the group exposed to 3 µM of GW7647 was about twice the mortality in the control (6.32%) and mortality when the embryos were exposed to 10 µM was 64.62%.
This result suggests that the LC50 (50% lethal concentration) of GW7647 is between 3 µM and 10 µM.
The purpose of counting number of dead embryos/larvae during the exposure was to find a suitable range of doses. Therefore, 0.1 µM, 0.3 µM, 1 µM and 3 µM were chosen as exposure concentrations since most individuals (more than 90%) survived and there were no marked malformations at these doses.
4.2 Heartbeat rate
The heartbeat rate of dosed larvae significantly declined from 0.1 µM to 3 µM compared with the control. This effect may involve activation of PPARs because all PPAR subtypes play an important role in controlling transcriptional expression of enzymes, for instance those involved in glucose metabolism (Marx et al., 2004; Xiao
22
et al., 2009). The regulation of cardiac PPARα by GW7647 was proved in a study of Yue et al. (2003). In this study, GW7647 was reported to attenuate the downregulation of PPARα and fatty acid oxidation enzymes in mice when myocardial injury from ischemia/reperfusion was induced. In PPARα-null mice, GW7647 did not protect the heart (Yue et al., 2003). Down-regulation of PPARα signaling could preserve heart function against pressure overload, while cardiac PPARα overexpression led to lipid accumulation and might cause a diabetic heart (Marx et al., 2004).
All three subtypes of PPARs are expressed in vascular smooth muscle cells in heart.
As a highly selective and potent PPARα agonist, GW7647 was demonstrated to stimulate glucose uptake in cardiac muscles. In isolated papillary muscles cells exposed to 5 μM, 10 μM and 20 μM of GW7647 for 30 min a significant increase in glucose uptake was found (Xiao et al., 2009). In addition, the glucose uptake was demonstrated to lead to hemodynamic change. In rabbits treated with glucose, their heartbeat rate was remarkably decreased (Farias et al., 1986).
Heartbeat of zebrafish could be affected by factors like exposure to chemicals, or special living conditions (Padilla and Roth, 2001; Langheinrich et al., 2003). During the study, all zebrafish embryos and larvae were raised under the same living condition without contamination with other chemicals than GW7647. Therefore, I suggest that zebrafish exposure to GW7647 activated the PPARα mainly in cardiac muscle cells. By the transcriptional expression, activated PPARα induced cardiac metabolism involved in glucose uptake. An unusual cardiac metabolism might cause hemodynamic change and lead to significant decrease of the heartbeat rate.
However, there was no evidence to demonstrate directly that the slow heartbeat rates in exposed zebrafish larvae were caused by GW7647 via regulation of PPARs.
Further studies are needed to prove the mechanisms of GW7647 interaction with the cardiovascular system of zebrafish larvae.
23
Studies in animal models suggest that PPARα agonists may be used in clinical modulations to protect from cardiovascular disease in the future (Yue et al., 2003;
Xiao et al., 2009). Therefore, understanding of their function has important clinical implications.
4.3 mRNA expression
The main objective of the study was to determine the effect of GW7647 exposure in zebrafish larvae by focusing on proteins involved in lipid metabolism. As a PPARs activator, GW7647 is expected to affect mRNA levels of PPARs and their related target genes.
Our study indicates that GW7647 had no significant effect on these mRNA expressions even at the highest concentration of 3 µM. There are some evidences that a high concentration of GW7647 (3 mg/kg/d) regulated mRNA expression of PPARα and RXRα in rodents (Yue et al., 2003). Furthermore, after incubation for 24 hours with 1 µM of GW7647, all three subtypes of PPARs were activated in human cell lines (Seimandi et al., 2005). No data was reported on effects of GW7647 in zebrafish.
GW7647 is a potent and selective activator of PPARα in humans and rodents and it shows >100-fold and >1000-fold selectivity for PPARα over PPARβ and PPARγ in humans and mice, respectively (Brown et al., 2001). The relative PPARγ mRNA expression in the present study was slightly higher than that of the other PPAR subtypes. This is supported by former studies on PPARs expression in different developmental stages of zebrafish showing that PPARγ expression is higher in the early stages than in adults (Ibabe et al., 2005).
As a PPARα-selective agonist, GW7647 should affect fatty acid metabolism as do
24
other PPARα agonists such as fenofibrate and bezafibrate. The relative gene expression changes in common may indicate the genes regulated by PPARα stimulation. From the expression data obtained from rodents and dogs, it was reported that PPAR agonists induced the peroxisomal enzymes ACOX and Ehhdh (Guo et al., 2006; Guo et al., 2007).
Acyl-CoA oxidase (ACOX) is a target gene regulated by PPARs. In this study, relative mRNA expression of the ACOX gene was tested to evaluate its regulation by activation of PPARα. The ACOX gene did not change significantly by treatment with GW7647. In many previous studies, ACOX regulation by peroxisome proliferators was shown by measuring ACOX activity. The activity was assessed by using a method that measures the H2O2 production upon oxidation of leucodichlorofluorescein catalysed by ACOX (Small et al., 1985).
Exposure of fish to peroxisome proliferators sometimes led to significant effects on ACOX, but some papers also reported lack of effect on ACOX after exposure. It was demonstrated that 1 mM clofibric acid or 1 mM bezafibrate administered to salmon (Salmo salar) hepatocytes in culture, resulted in a significant increase of PPARs mRNA expression and of ACOX activity (Small et al., 1985). However, when fathead minnows (Pimephales promelas) were exposed to bezafibrate at concentrations up to 106.7 mM, no effect was observed. When exposed to clofibric acid, only the fathead minnows at the highest tested concentration (108.9 mM) showed induced activity of ACOX and there was no increase in expression of PPARs mRNA (Weston et al., 2009).
In addition, in rainbow trout (Onchorynchus mykiss) exposure to another peroxisome proliferator, gemfibrazil, led to activity change of ACOX after injection daily for 14 days with the doses 46, 87 or 152 mg/kg/day (Scarano et al., 1994). However, when goldfish (Carassius auratus) were exposed to gemfibrazil (up to 1.5 mM) for the same duration (14 days), there was no significant change of ACOX activity (Mimeault et al., 2006). It thus seems that even after exposure to the same lipid regulators, the experimental results could be different. One explanation to this may be differences in
25
sensitivity between fish species, but the exposure pathway is also important for the results. Exposure in cell culture may give a sensitive response and injection is a more direct pathway than to expose fish to the chemical via the water. In the studies referred to above, most peroxisome proliferators tested did not activate ACOX or regulate PPARs mRNA expression by exposure via the water, which is in agreement with my result.
After exposure to PPARα agonists, the activation of PPARα firstly results in induction of the enzyme ACOX and then Ehhdh is induced as the next enzyme in the cascade (Guo et al., 2006). Ehhdh was not significantly increased in my project, but Ehhdh can be activated by a novel PPARα and γ coagonist, LY465608, in rodent and dog cells (Guo et al., 2007). Also, treatment of mouse primary hepatocytes with bezafibrate and fenofibrate can elevate the Ehhdh mRNA expression level (Guo et al., 2006).
Human and rodent data provide evidence that L-Fabp interacts with PPARα and PPARγ but not with PPARβ, by protein–protein contacts. During activation, L-Fabp is considered as a co-activator in PPAR-mediated gene control (Wolfrum et al., 2001).
There was no effect on L-Fabp in my study, but in rat hepatocytes cultured in presence of bezafibrate, the L-Fabp mRNA expression was clearly higher than in non-drug-treated cells (Besnard et al., 1993). Following exposure of PPARα-deficient mouse hepatocytes to the classical peroxisome proliferators, clofibrate and Wy-14,643, the L-Fabp level did not change and there was no fatty acid metabolism (Lee et al., 1995). These studies show that PPARα mediates the induction of L-Fabp. It was reported that in most cases the expression pattern is similar in all mammals but may be different in fish (Haunerland and Spener, 2004). In a recent study on fish, it was demonstrated that under complex environmental stresses, the PPARβ and L-Fabp mRNA expressions in livers of goldfish (Carassius auratus) were significantly higher than in control (Wang et al., 2008). So L-Fabp may be linked to all three PPARs subtypes in fish.
26
In this study, it seems there was no evidence that GW7647 activated the PPARs or affected the expression of these receptors. There were very few studies on exposure of fish to GW7647 before. Many studies where fish were exposed to other PPARs agonists showed a lack of effects on mRNA expression (Mimeault et al., 2006; Wang et al., 2008; Weston et al., 2009). Therefore, my and other studies may imply that activation of PPARs is not very easy and has high individual or species differences.
The high variation values for the mRNA expressions of the exposed fish in the present study may confirm the individual differences.
To investigate PPAR-regulated genes, besides studying the mRNA levels of PPARs, ACOX, L-Fabp and Ehhdh, the relative mRNA expression of Retinoid X Receptor (RXR) should be examined since all PPARs need to heterodimerize with it to bind to the response elements on DNA. So RXR expression and activation are important in PPARs regulated processes and need to be studied.
27
5. Conclusion
Determining the physiological effects and molecular actions of PPARs agonists in fish species is important for environmental risk assessment. This study shows that exposure to a selective PPARα agonist in humans, GW7647, is capable of regulating the heart function and leads to the slow heartbeat as response. This effect may be caused by GW7647 regulation of PPARs but the mRNA expression results cannot support this hypothesis. However, abnormal heartbeat rates are induced by GW7647 and the mechanism needs further study. As in previous studies, exposure of fish to PPARs modulators in the aquatic environment seems not to activate the PPARs.
Future studies are needed to show whether PPARα-dependent expression can be induced in fish larvae.
Besides studying the PPARα agonist GW7647, future studies can also be expanded to include PPARs agonists found in the environment, such as fibrates, and their effects on fish.
28
References
Anuradha D, Pancharatna K. 2009. Developmental anomalies induced by a non-selective COX inhibitor (ibuprofen) in zebrafish (Danio rerio). Environ Toxicol Pharmacol 27: 390-395
Bailey J. 2008. How well do animal teratology studies predict human hazard? – Setting the bar for alternatives. Physicians Committee for Responsible Medicine http://alttox.org/ttrc/toxicity-tests/repro-dev-tox/way-forward/bailey/
Berger J, Moller D E. 2002. The mechanisms of action of PPARs. Annu Rev Med 53:
409–435
Besnard, P, Mallordy A, Carlier H. 1993. Transcriptional induction of the fatty acid binding protein gene in mouse liver by bezafibrate. FEBS Lett 327: 219–223
Brown, J P, Stuart L W, Hurley P K, Lewis C M, Winegar A D, Wilson G J, Wilkison O W, Ittoop R O, Willson M T. 2001. Identification of a subtype selective human PPARα agonist through parallel-array synthesis. Bioorg Med Chem Lett 11: 1225-1227
Daughton G C, Ternes A T. 1999. Pharmaceuticals and personal care products in the environment: agents of subtle change? Environ Health Perspect 107, Suppl 6:
907-938
Drew E R, Rodnick J K, Settles M, Wacyk J, Churchill E, Powell S M, Hardy W R, Murdoch K G, Hill A R, Robison D B. 2008. Effect of starvation on transcriptomes of brain and liver in adult female zebrafish (Danio rerio). Physiol Genomics 35:
283–295
Dreyer C, Krey G, Keller H, Givel F, Helftenbein G, Wahli W. 1992. Control of the
29
peroxisomal beta-oxidation pathway by a novel family of nuclear hormone receptors. Cell 68: 879–87
Du Z Y, Demizieux L, Degrace P, Gresti J, Moindrot B, Liu Y J, Tian L X, Cao J M, Clouet P. 2004. Alteration of 20∶5n−3 and 22∶6n−3 fat contents and liver peroxisomal activities in fenofibrate-treated rainbow trout. Lipids 39: 849-855
Farias A L, Willis M, Gregory A G. 1986. Effects of fructose-1, 6- diphosphate, glucose, and saline on cardiac resuscitation. Anesthesiology 65: 595-601
Fent K, Weston A A, Caminada D. 2006. Ecotoxicology of human pharmaceuticals.
Aquat Toxicol 76: 122–159
Guo L, Fang H, Collins J, Fan X H, Dial S, Wong A, Mehta K, Blann E, Shi L, Tong W, Dragan Y P. 2006. Differential gene expression in mouse primary hepatocytes exposed to the peroxisome proliferator-activated receptor α agonists. BMC Bioinformatics 7, Suppl 2: S18
Guo Y, Jolly R A, Halstead B W, Baker T K, Stutz J P, Huffman M, Calley J N, West A, Gao H, Searfoss G H, Li S, Irizarry A R, Qian H, Stevens J L, Ryan T P. 2007. Underlying mechanisms of pharmacology and toxicity of a novel PPAR agonist revealed using rodent and canine hepatocytes. Toxicol Sci 96: 294-309
Haunerland H N, Spener F. 2004. Fatty acid-binding proteins - insights from genetic manipulations. Prog Lipid Res 43: 328–349
Hill A J, Teraoka H, Heideman W, Peterson R E. 2005. Zebrafish as a model vertebrate for investigating chemical toxicity. Toxicol Sci 86: 6-19
Ibabe A, Grabenbauer M, Baumgart E, Fahimi H D, Cajaraville P M. 2002. Expression
30
of peroxisome proliferator-activated receptors in zebrafish (Danio rerio). Histochem Cell Biol 118 :231-239
Ibabe A, Bilbao E, Cajaraville P M. 2005. Expression of peroxisome proliferator-activated receptors in zebrafish (Danio rerio) depending on gender and developmental stage. Histochem Cell Biol 123:75–87
Issemann I, Green S. 1990. Activation of a member of the steroid hormone receptor superfamily by peroxisome proliferators. Nature 347 : 645–650
Lee S S, Pineau T, Drago J, Lee E J, Owens J W, Kroetz D L, Fernandez-Salguero P M, Westphal H, Gonzalez F J. 1995. Targeted disruption of the alpha isoform of the peroxisome proliferator-activated receptor gene in mice results in abolishment of the pleiotropic effects of peroxisome proliferators. Mol Cell Biol 15: 3012-3022
Lin C, Spikings E, Zhang T, Rawson D. 2009. Housekeeping genes for cryopreservation studies on zebrafish embryos and blastomeres. Theriogenology 71:
1147–1155
Marx N, Duez H, Fruchart J C, Staels B. 2004. Peroxisome proliferator-activated receptors and atherogenesis: regulators of gene expression in vascular cells.
Circulation Res 94: 1168-1178
Mimeault C, Trudeau V L, Moon T W. 2006. Waterborne gemfibrozil challenges the hepatic antioxidant defense system and down-regulates peroxisome proliferator-activated receptor beta (PPARbeta) mRNA levels in male goldfish (Carassius auratus). Toxicology 228: 140-150
OECD guideline for testing of chemicals: No. 210: Fish, Early-life Stage Toxicity Test.
Adopted by the Council in 1992. Downloaded from “http://www.oecd.org/”
31
Padilla P A, Roth B M. 2001. Oxygen deprivation causes suspended animation in the zebrafish embryo. Proc Natl Acad Sci USA 98: 7331–7335
Raldua D, Andre M, Babin J P. 2008. Clofibrate and gemfibrozil induce an embryonic malabsorption syndrome in zebrafish. Toxicol Appl Pharmacol 228: 301-314
Rubinstein A L. 2006. Zebrafish assays for drug toxicity screening. Expert Opin Drug Metab Toxicol 2: 231-240
Ruyter B, Andersen Ø, Dehli A, Farrants O A-K, Gjøen T, Thomassen S M. 1997.
Peroxisome proliferator activated receptors in Atlantic salmon (Salmo Salar): effects on PPAR transcription and acyl-CoA oxidase activity in hepatocytes by peroxisome proliferators and fatty acids. Biochim Biophys Acta 1348: 331–338
Scarano J L, Calabrese J E, Paul T K, Baldwin A L, Leonard A D. 1994. Evaluation of a rodent peroxisome proliferator in two species of freshwater fish: rainbow trout Onchorynchus mykiss and Japanese Medaka Oryzias Iatipes. Ecotoxicol Environ Saf 29: 13-19
Schefe H J, Lehmann E K, Buschmann R I, Unger T, Funke-Kaiser H. 2006.
Quantitative real-time RT-PCR data analysis: current concepts and the novel “gene expression’s CT difference” formula. J Mol Med 84: 901–910
Seimandi M, Lemaire G, Pillon A, Perrin A, Carlavan I, Voegel J J, Vignon F, Nicolas J-C, Balaguer P. 2005. Differential responses of PPARα, PPARδ, and PPARγ reporter cell lines to selective PPAR synthetic ligands. Anal Biochem 344: 8–15
Small M G, Burdett K, Connock J M. 1985. A sensitive spectrophotometric assay for peroxisomal acyl-CoA oxidase. Biochem J 227: 205-210
32
Togola A, Budzinski H. 2007. Analytical development for analysis of pharmaceuticals in water samples by SPE and GC–MS. Anal Bioanal Chem 388: 627–635
Wang J, Wei Y, Wang D, Chan L L, Dai J. 2008. Proteomic study of the effects of complex environmental stresses in the livers of goldfish (Carassius auratus) that inhabit Gaobeidian Lake in Beijing, China. Ecotoxicology 17: 213–220
Westerfield M. 2002. The zebrafish book: A guide for the laboratory use of zebrafish (Danio rerio). 4th ed., Univ. of Oregon Press, Eugene.
Weston A, Caminada D, Galicia H, Fent K. 2009. Effects of lipid-lowering pharmaceuticals bezafibrate and clofibric acid on lipid metabolism in fathead minnow (Pimephales Promelas). Environ Toxicol Chem 28: 2648-2655
Wolfrum C, Borrmann M C, Borchers T, Spener F. 2001. Fatty acids and hypolipidemic drugs regulate peroxisome proliferator-activated receptors alpha- and gamma-mediated gene expression via liver fatty acid binding protein: a signaling path to the nucleus. Proc Natl Acad Sci USA 98: 2323-2328
Xiao X, Su G, Brown N S, Chen L, Ren J, Zhao P. 2010. Peroxisome proliferator-activated receptors γ and α agonists stimulate cardiac glucose uptake via activation of AMP-activated protein kinase. J Nutr Biochem 21: 621-626
Yue T-l, Bao W, Jucker M B, Gu J-l, Romanic M A. 2003. Activation of peroxisome proliferator–activated receptor-α protects the heart from ischemia/ reperfusion injury. Circulation 108: 2393-2399
Yang J H, Kostecki P T, Calabrese E J, Baldwin L A. 1990. Induction of peroxisome proliferation in rainbow trout exposed to ciprofibrate. Toxicol Appl Pharmacol 104:
33
476-482
