Immunoecology of the Great Snipe (Gallinago media): Mate Choice, MHC Variation, and Humoral Immunocompetence in a Lekking Bird

Full text

(1)Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 1022. Immunoecology of the Great Snipe (Gallinago media) Mate Choice, MHC Variation, and Humoral Immunocompetence in a Lekking Bird BY. ROBERT EKBLOM. ACTA UNIVERSITATIS UPSALIENSIS UPPSALA 2004.

(2)

(3)

(4)

(5)

(6)

(7)

(8) !!" !#$% & ' ( & & )' '* +'

(9)

(10) ,

(11)

(12)

(13) ('* - .* !!"* /

(14) ( & ' 0 1

(15) 2

(16) 3* 4 ' 45 6

(17)

(18) 5 /

(19)

(20)

(21) 7--

(22) ( * 8

(23)

(24) *

(25)

(26)

(27)

(28)

(29)

(30)

(31)

(32)

(33) ! * %% * * /1 #9%%"9:!%;9; 8 '

(34) & '

(35) ( &

(36) 45 2 < ' 3 * +' &

(37)

(38)

(39) & =

(40)

(41) & (

(42)

(43)

(44) .

(45) & '

(46) &

(47) (

(48)

(49)

(50) (

(51) ' (

(52) * /

(53) ' ' / '

(54) (

(55)

(56)

(57) 45 // (

(58)

(59)

(60)

(61) (

(62)

(63) (

(64) '

(65) ' (

(66) 2

(67) 3 --

(68) (

(69) (

(70)

(71) '

(72) * +' , '

(73)

(74) ' 45 (

(75) & ' (

(76)

(77) ' >

(78) . ' , '

(79)

(80) (

(81) '

(82)

(83) (

(84) ' (

(85) * / &

(86) (

(87) &&

(88)

(89)

(90) ' 45 ,

(91) , ( ( ' (

(92) & ' (

(93)

(94) * ' ' ,

(95)

(96) '

(97) ' &

(98)

(99)

(100) (

(101) - ((

(102) ( ' &&

(103)

(104) 2

(105) ( &

(106)

(107) &

(108) 3

(109) (

(110) ' &&

(111) (

(112) * +' &

(113) & ,

(114) (

(115) <

(116) , ' ,

(117)

(118) (

(119) * 4 ' , '

(120) ' '('

(121) '

(122) '

(123) ('

(124) ( ((

(125) ( ' '

(126)

(127) & ' * 1' ' ( ' &&

(128) (

(129)

(130) '

(131)

(132) & &

(133) &

(134) * '

(135) ( , ' '

(136) ( &&

(137) & 45 (

(138) '

(139) ' ,

(140) ( ' &&

(141) (

(142) ' ,

(143) ( & * ' ' ' , &

(144)

(145) ' (

(146) * /

(147) & & , '

(148) 45 & ' ,

(149) 45 * /& '

(150) &

(151)

(152)

(153) (

(154) '

(155) '

(156) ,

(157) ' ' &&

(158) ( '

(159) '

(160)

(161) ( ' &

(162) *

(163) ' 4 < ' // 1

(164)

(165) 7- ! "

(166) #$" %

(167)

(168) # # % & ' % ( " )* %

(169) % #+,-. /0 %

(170)

(171) ? . - !!" /11 !"9 @ A /1 #9%%"9:!%;9;

(172) $

(173)

(174) $$$ 9"%B% 2' $CC

(175) *-*C D

(176) E

(177) $

(178)

(179) $$$ 9"%B%3.

(180) “Study this book; read a word then ponder on it. If you interpret the meaning loosely you will mistake the Way. […] Absorb the things written in this book. Do not just read, memorise or imitate, but so that you realise the principle from within your own heart study hard to absorb these things into your body.” - Miyamoto Musashi. To Anna and Albin.

(181)

(182) LIST OF PAPERS. This thesis is based on the following papers, which are referred to in the text by their Roman numerals: I. Ekblom R, Grahn M & Höglund J. (2003) Patterns of polymorphism in the MHC class II of a non-passerine bird, the great snipe (Gallinago media). Immunogenetics 54: 734-741.. II. Ekblom R, Sæther SA, Jacobsson P, Fiske P, Grahn M, Kålås JA & Höglund J. Spatial pattern of MHC class II variation in the great snipe (Gallinago media). Manuscript.. III. Ekblom R, Sæther SA, Grahn M, Fiske P, Kålås JA & Höglund J. MHC variation and mate choice in a lekking bird, the great snipe (Gallinago media). Accepted for publication in Molecular Ecology.. IV. Ekblom R, Sæther SA, Hasselquist D, Hannersjö D, Fiske P, Kålås JA & Höglund J. Female choice and male humoral immune response in the lekking great snipe (Gallinago media). Accepted for publication in Behavioral Ecology.. V. Ekblom R, Hasselquist D, Sæther SA, Fiske P, Kålås JA, Grahn M & Höglund J. Humoral immunocompetence in relation to condition, size, asymmetry and MHC class II variation in great snipe (Gallinago media) males. Manuscript.. Paper I is reprinted with kind permission from © Springer-Verlag. Cover photo by Gregory Lesniewski..

(183)

(184) CONTENTS. INTRODUCTION ..........................................................................................9 The study species...................................................................................9 The vertebrate immune system ............................................................11 The major histocompatibility complex ................................................13 Balancing selection at the MHC ..........................................................14 MHC and mate choice .........................................................................15 Choice of certain alleles and parasite resistance..................................16 Ecology and the immune defence........................................................17 The costs of the immune response.......................................................17 Immunocompetence and mate choice..................................................18 Aim ......................................................................................................18 GENERAL METHODS................................................................................19 Field methods ......................................................................................19 Immunisation procedure ......................................................................20 ELISA..................................................................................................20 MHC genotyping .................................................................................21 Statistical analyses ...............................................................................24 RESULTS AND DISCUSSION ...................................................................25 MHC class II B genes in the great snipe..............................................25 Nucleotide variation.............................................................................26 Gene organisation and comparison to other species ............................27 Geographical variation in the MHC ....................................................34 MHC and mate choice .........................................................................35 The nature of selection acting on the MHC genes...............................37 Antibody response to vaccination........................................................38 Immune response and mate choice ......................................................39 Reasons for variation in immune response ..........................................40 Conclusions and future prospects ........................................................41 SAMMANFATTNING PÅ SVENSKA .......................................................42 ACKNOWLEDGEMENTS..........................................................................45 REFERENCES .............................................................................................47.

(185) ABBREVIATIONS. AMOVA CDGE DGGE DMSO DNA ELISA Ig MHC Mĭ OD pbs PCR RFLP TH 1 TH 2. Analysis of molecular variance Constant denaturing gel electrophoresis Denaturing gradient gel electrophoresis Dimethyl solfoxide Deoxyribonucleic acid Enzyme-linked immunosorbent assay Immunoglobulin (antibody) Major histocompatibility complex Macrophage Optical density Peptide binding site Polymerase chain reaction Restriction fragment length polymorphism T helper cell type 1 T helper cell type 2.

(186) INTRODUCTION. This thesis address questions concerning the genes involved in, and the function of, the immune system. The focus is on the ecological interactions and implications for mate choice. I will give a brief overview of the vertebrate immune system and discuss the function and properties of the major histocompatibility complex (MHC), a genetic region coding for some important genes involved in the immune defence. After this introduction the main methods and results from the papers constituting the thesis (Fig. 1) will be discussed. I will, however start by introducing the main actor or this work, my study species, the great snipe (Gallinago media).. Figure 1. Outline of this thesis. The included papers are indicated by roman numerals.. The study species All of the papers in this thesis deal with the same study species, the great snipe (see picture on the cover). This is a migrating wader bird, breeding in the northern parts of Europe and wintering in Africa. The breeding range is divided into two distinct regions (Fig. 2). In the western region the birds breed in the mountain area of Norway and Sweden. The habitat consists of wet areas on the mountain slopes, mainly around the tree limit (Kålås et al. 1997a). In the eastern region, consisting of Poland, Belarus, Russia and the 9.

(187) Baltic states, great snipes breed on flood plains and costal meadows in the lowland (Kuresoo & Leibak 1994; Kålås et al. 1997b). About 150 years ago, the species was much more common than today and had a more or less uniform distribution over a large part of northern Europe, including southern Sweden, Germany and Denmark. The rapid decrease in numbers and complete disappearance from many breeding localities started little more than hundred years ago and is thought to have resulted primarily from hunting and habitat destruction (drying out of wetlands) (Løfaldli et al. 1989; Kuresoo & Leibak 1994). Today, the number of breeding birds is estimated to be 10000 to 30000 in the western region (Svensson et al. 1999) and in the order of some 100 000 individuals in the eastern region, there is however large uncertainty in the number of breeding birds in Russia (Kålås et al. 1997c). The species is currently red listed as “Near Threatened” on a global level (BirdLife, International 2000).. 100 km. N. Figure 2. Map of the distribution of the great snipe in Europe (shaded areas), and a more detailed map of the main study area, Gåvålia, in Norway. Filled circles represent the two leks where most of the data were collected and open circles represent other leks in the area.. The main reason for studying this species is its’ rather unusual mating system, lekking (Höglund & Alatalo 1995). During nights, in May and June, males gather at traditional arenas (leks) to display and attract females. Here they defend small territories (around 100 m2), containing no obvious resources, except for the male himself (Höglund & Lundberg 1987). Females arrive to the leks at the end of May and beginning of June to choose a mate and to mate with him. Copulation takes place on the males’ territory on the 10.

(188) lek. Females usually come back to the same male to copulate repeatedly during several nights (Sæther et al. 2001). After this the female takes the sole responsibility for nesting, incubation and care of young, while the males stay on the lek to try to attract more females (Fiske & Kålås 1995). This means that females do not gain direct benefits like a good territory or a caring male by her mate choice decision. Instead the primary benefits from choosing a certain male is thought to be indirect, that is, his “good” genes will be inherited by the offspring. This aspect makes lekking systems particularly interesting when addressing ecological and genetic questions concerning mate choice (Andersson 1994). In the case of the great snipe, male – male interactions do not play a major role for the distribution of matings between territorial males, and female choice is the most important factor determining male mating success (Sæther et al. 1999). Furthermore it is relatively easy to monitor female mate choice since everything happens on a relatively small area and during a rather short period of time (most of the matings occur during one or two weeks). The male display consists of a peculiar bubbling sound, uttered in an erect posture (Lemnell 1978). It has been described as the sound of a nail being drawn over the teeth of a comb, combined with a simultaneous whistle of a discrete high-pitched melody (Swanberg 1965). The males also perform occasional jumps up to one meter high and defend their territories by attacking intruding neighbours. The display is energetically very costly and males loose around 7% of their weight during a night of display (Höglund et al. 1992a). To make up for this energy loss, the birds have to eat an energy rich diet consisting mainly of earthworms. The great snipe can therefore only be found in areas with rich and basic soil where the concentration of earthworms is high (Løfaldli et al. 1992; Kålås et al. 1997a).. The vertebrate immune system Vertebrates are vulnerable to parasites because of their long life span and highly regulated internal environment. They have therefore developed a series of complex mechanisms to deal with this threat (Wakelin 1997). I will here give a very simplified introduction to the vertebrate immune system, only discussing features of immediate interest for this thesis and leaving out many details. For a more complete picture of the immune defences, please consult a textbook on the subject, for example Roitt (1997) or Kuby (1997). The term “antigen” will be used for any substances with the ability to inflict an immune response. The vertebrate immune system can broadly be divided into acquired and innate responses. The latter constitutes a first line of defence against invading parasites and is responsible for inflammation and phagocytosis (when an 11.

(189) antigen is “eaten” by special kinds of immune system cells). This response has several characteristics in common with the simpler immune defence of invertebrates (see for example Vilmos & Kurucz 1998; Cotter et al. 2004). The acquired immune defence, unique to vertebrates, improves through the process of learning and this system is highly specific. Because of the immunological memory, these reactions will produce a much stronger response to a repeated exposure of the same pathogen (secondary immune response) compared to that of the first exposure (primary response). It should be noted that the acquired and the innate reactions work together to eliminate parasites and that these two systems are tightly linked to each other by many different pathways (Fearon & Locksley 1996). There are two major branches of the acquired defence, the cellular and the humoral responses. The cellular branch, also called TH1 (T-helper cell type 1) response because of the kind of cells involved, is regulated by T cells. A special kind of T cells (Cytotoxic T cells) are instructed to kill off cells infected with intra-cellular parasites and viruses. In contrast, the main actors of the humoral defence are antibodies produced by B cells. This branch is also called TH2 (T-helper cell type 2) response because a different kind of T cells are active in initiating this mechanism. Antibodies, working together with the innate defence, are mainly protecting against extra-cellular pathogens and parasites. There are also many links between the cellular and the humoral branch of the immune system.. Antigen peptide Į1 Į2. ȕ1 ȕ2 Cell membrane. Figure 3. Shematic structure of the MHC class II protein with the Į- and the ȕ-chain and an antigen peptide bound to the pbs.. 12.

(190) The major histocompatibility complex At the centre of the acquired immune response are a group of cell surface proteins called MHC molecules. These bind small pieces of pathogen proteins (antigen peptides) and present them to T cells. This presentation activates the T cell and triggers the immune response (Edwards & Hedrick 1998). There are two major types of MHC molecules (class I and class II), acting in different ways. Class I molecules are expressed on all nucleated cells and present peptides derived from inside the cell. If the cell is infected by for example a virus, some viral peptides will be presented by the MHC class I molecules on the surface and this will be bound by a T cell. This T cell will than activate the cellular branch of the immune system and the virus-infected cell will be destroyed. MHC class II molecules on the other hand are only expressed on certain cells involved in the immune system for example macrophages (MɎ), B cells and dendritic cells. An extra cellular pathogen may for example be identified by a MɎ. Following phagocytosis, the MɎ will digest the pathogen and express peptides from it on the cell surface by MHC class II proteins (Fig. 3). Again this MHC/antigen peptide complex will be recognised by a T cell and this time the humoral branch will be activated. This will eventually lead to a B cell starting to produce antibodies working specifically against the invading pathogen (Roitt 1997).. Figure 4. Three dimensional protein structure of the MHC class II molecule seen from above. The antigen binding groove consisting of a ȕ-sheet and two Į-helixes is seen. The grey parts are the ȕ-strand on which the different domains are indicated. The black points represent antigen binding amino acids. Picture from She et al. (1990).. 13.

(191) The MHC class II protein consists of two amino acid chains called the Įand the ȕ-chain respectively. Both of these have a cytoplasmatic tail, a transmembrane region and two loops on the outside of the cell membrane called Į1, Į2, ȕ1 and ȕ2 (Fig. 3). The groove where the antigen is bound consists of a ȕ-sheet surrounded by two Į-helix structures and is formed by the Į1 and the ȕ1 domains together (Fig. 4), each contributing with half the sheet and one helix (Hughes & Yeager 1998). The antigen peptide is bound by specific residues on the sheet and the helixes called contact residues or peptide binding sites (pbs) (Edwards et al. 1995a). Two different but linked genes (MHC class II A and MHC class II B) encoded the Į- and the ȕ-chains. The most variable part of these genes is the second exon of the B gene, coding for most of the peptide binding sites (Fig. 5) (Hughes & Hughes 1995). 100 bp 34F. 326. Ex 3F2. Int 1A LP. E1 420 rev. E2. TM. 3' UT. Int 2A 325 Int 2B. Ex 3R. Int 2C. Figure 5. Schematic illustration of the MHC class II B gene. The position of the primers used in this study is indicated with arrows. Boxes represent exons and the shaded box is the polymorphic second exon witch codes for the antigen binding sites. LP = leader peptide, TM = transmembral region, CY = cytoplasmatic tail, 3’ UT = 3’ untranslated sequence.. Balancing selection at the MHC The MHC genes are among the most variable genetic regions known, with several hundreds of alleles present at some loci in for example humans (Robinson et al. 2000). It is generally assumed that this polymorphism is maintained by balancing selection imposed by parasites and pathogens (Hedrick 1999) but the exact nature of that selection remains debated (Hughes & Nei 1992; Slade & McCallum 1992). When the function of the MHC became clear, it was proposed that MHC heterozygotes are able to present peptides from a wider range of parasites to the immune system than homozygotes, thereby increasing the fitness of the individual (Doherty & Zinkernagel 1975). This mechanism for increasing polymorphism is gener14.

(192) ally referred to as overdominance or heterozygote advantage (Hughes & Yeager 1998). Some authors suggest that there may be disadvantages with having too many different MHC alleles because of the thymic selection process (Nowak et al. 1992; Milinski 2003, but see Borghans et al. 2003), and that there is instead an optimal number of expressed MHC alleles for the individual. Another hypothesis for maintaining the polymorphism at MHC genes is frequency dependent selection (Bodmer 1972). The idea behind this hypothesis is that there is a coevolutionary arms race between hosts and their parasites (Haldane 1949). If parasites adapt to common MHC alleles, individuals carrying rare, or new, alleles will have an evolutionary advantage. This will lead to an increase in the frequencies of these alleles and the parasites will, in turn, evolve to avoid presentation by them. In this way common alleles will always have a disadvantage because the parasites will have had time to adapt to them (Meyer & Thomson 2001). A third and less often quoted evolutionary mechanism that could enhance MHC polymorphism is diverging selection pressures in time and/or space (Hill 1991). If different areas have unique parasitic faunas, different MHC alleles will be beneficial in these areas. If gene flow is restricted between the areas this will lead to differences in frequencies of specific alleles between these populations and an increased number of alleles globally. A similar line of reasoning could be applied to temporal variation of parasite prevalence. It is also known that many parasites occur in a cyclic fashion, and that different parasitic strains replace each other (Bensch & Åkesson 2003). Maternal – foetal interactions (Clarke & Kirby 1966) and MHC dependent mate choice (Penn & Potts 1999) are two other mechanisms that have been proposed to enhance MHC polymorphism.. MHC and mate choice Since the report of Yamazaki and coworkers (1976) of MHC dependent mate choice in male mice (Mus domesticus), the generality and importance of this phenomenon has been highly debated. It has been shown that both male and female mice in laboratory settings respond differently to odours of other mice depending on their MHC haplotype (Reviewed in Jordan & Bruford 1998; Penn & Potts 1999). Potts et al. (1991a) also observed MHC dependent mate choice in a semi-natural setting and showed that this mechanism enhanced MHC polymorphism (Potts et al. 1991b). MHC dependent mate choice has most often been reported in rodents and there is a large uncertainty how widespread such mating preferences are among other vertebrate groups (Bernatchez & Landry 2003). Most controversial are reports of such mate choice in humans (Ober et al. 1997) first reported by Wedekind et al. (1995). These studies have been criticised and other studies have failed to 15.

(193) find similar results (Hedrick & Loeschcke 1996; Hedrick & Black 1997). Other vertebrate groups where this phenomenon has been found include reptiles (Olsson et al. 2003) and fish (Landry et al. 2001). When it comes to birds, very few published studies have tested the existence of an MHC-based mating preference (Zelano & Edwards 2002). This may possibly be due to a publication bias against negative results. The most cited study of MHC and mate choice in birds was done on the ring necked pheasant (Phasanius colchicus). In this species, MHC genotype influences survival and spur length of males (von Schantz et al. 1996), traits that have also been shown to be important determinants for female mate choice (von Schantz et al. 1997). There is some evidence for MHC dissasortative pairing in Savannah sparrows (Passerculus sandwichensis) and the similarity of the MHC in a pair predicts the amount of female extra pair matings (FreemanGallant et al. 2003). MHC dependent mate choice has also been investigated in the great reed warbler (Acrocephalus arundinaceus), but no evidence for MHC disasortative mating or female preference for heterozygous males was found (Westerdahl 2003). In most cases the MHC dependent mating preferences seem to be disassortative. That is, individuals prefer mates that have a different set of MHC alleles than their own (Tregenza & Wedell 2000) or alleles that differ as much as possible in amino acid composition (Landry et al. 2001). Such mate choice would give the offspring highly diverse MHC genes with high heterozygosity, something that might enhance the possibility to fight off a large number of parasites (Penn et al. 2002). There is also a possibility that MHC variation is used as a cue for mate choice to avoide inbreeding. Thus such mate choice pattern would lead to more outbred offspring in general (Blouin & Blouin 1988; Grob et al. 1998). Other kinds of MHC dependent mate choice that has been proposed is choice for rare alleles (Thornhill et al. 2003) and choice for heterozygous partners (Brown 1997).. Choice of certain alleles and parasite resistance Some MHC alleles may confer resistance or susceptibility to certain parasites and diseases (reviewed in Bernatchez & Landry 2003). The first finding of such a relationship was found in chicken (Gallus domesticus), where some strains are resistant to Marek’s disease (a tumour disease caused by a herpes virus) due to their MHC haplotype (Briles et al. 1977; Pinard et al. 1993). Furthermore, the outcome of several infectious diseases such as malaria (Hill et al. 1991) and HIV (Carrington et al. 1999) depends on MHC genotype in humans (Thorsby 1997), and there are also some examples from fish (Langefors et al. 2001; Lohm et al. 2002). If certain MHC alleles confer resistance to parasites that are common in the population, choosing mates 16.

(194) with such alleles would be beneficial. If the parasitic fauna varies in space and time, different alleles would be preferred in different areas and the preference would fluctuate over time.. Ecology and the immune defence The immune response is tightly linked to ecology and population biology. There are many costs involved in mounting an immune response and these must always be traded off against other important traits such as growth or expression of secondary sexual characters (Hamilton & Zuk 1982; Folstad & Karter 1992; Sheldon & Verhulst 1996; Norris & Evans 2000). The findings of these interactions during the last decades have led to the emergence of a new field of research termed immunoecology. The ability of an individual to mount an immune response against an antigen is often referred to as “immunocompetence” (Owens & Wilson 1999, but see also Siva-Jothy 1995; Ryder 2003), and this meaning is used here.. The costs of the immune response There could be several different kinds of costs involved in the mounting of an immune response, for example such activation may be energetically costly (Ots et al. 2001; Martin II et al. 2003, but see Svensson et al. 1998). This means that there is a trade off for resources with other energetically expensive functions such as growth (Soler et al. 2003), expression of sexual ornaments (Saino & Møller 1996) or reproductive effort (Gustafsson et al. 1994; Deerenberg et al. 1997). Another potential cost is the production of harmful oxidative substances by the immune defence. To avoid these harmful effects there is a need to balance this by utilizing antioxidants that break down these dangerous compounds (von Schantz et al. 1999). Another great risk is that the immune system starts attacking the bodies’ own tissues. This is termed autoimmune reactions or immunopathology and this may be very harmful (Råberg et al. 1998). Because of the costs involved, only individuals in good condition may afford to mount a strong immune defence against invading parasites (Møller et al. 1998). Such condition dependence of the immune response has been found in a number of studies (see for example Brinkhof et al. 1999; Cicho´n 2000; Reid et al. 2003).. 17.

(195) Immunocompetence and mate choice In making the decision about whom to mate with, the great snipe females probably need to take many traits into consideration, in order for the offspring to inherit as good genes as possible from the male. One of these traits that may be important is the males’ ability to fight off parasites (Møller et al. 1999). A healthy male may have genes that code for a well working immune defence and this should increase his chances of gaining matings. This argument is further strengthened by the finding that there is a heritable component to the strength of the immune response (Coltman et al. 2001; Råberg et al. 2003). Another benefit for females mating with such a male is that she is less likely to contract sexually transmitted diseases during courtship and copulation (Sheldon 1993).. Aim The aim of this project was to investigate MHC variation and immunocompetence in the great snipe and to relate this to mate choice and ecology. More specifically MHC variation was studied in the most variable part of the MHC class II B gene, the second exon, responsible for antigen binding. Humoral immunocompetence was investigated by measuring the specific antibody response to two novel antigens. These properties were than compared to behavioural and morphological data such as, mate choice of females and mating success and condition of males. I also investigated geographical variation in MHC genetics using samples from a large part of the species distribution.. 18.

(196) GENERAL METHODS. Field methods Most of the field work was performed during May and June between 2000 and 2003. For papers I and II, blood samples were also collected in the years (1993-1999). Some mate choice data from these earlier years is also included in paper III. The main study area, Gåvålia, is situated near Kongsvoll (62º17’N, 9º36’E), Dovrefjell in Norway (see map in Fig. 2). The leks are situated on fens at mountain slopes around the tree line, about 1000m above sea level. In the area three to five leks were monitored at nights during the active displaying period, but mainly data from the two largest leks are used in this thesis (for a more detailed description of the field site see Løfaldli et al. 1992). For paper II, blood sampling was also performed in other localities in Norway as well as in Sweden, Estonia and Poland. Birds were caught during nights on the leks, using mist nets. Each bird received a metal ring and three additional coloured plastic rings for individual recognition. To facilitate individual recognition of females, who are much more difficult to observe and identify than males, such also received a coloured mark on the back. Blood samples were taken from the wing vein and morphological data were recorded (Höglund et al. 1990). The birds were aged as being one year old or older according to Sæther et al. (1994) and sexed based on weight, size and behaviour (Höglund et al. 1990). Individual behaviour of great snipes on the leks was monitored from elevated hides during the period of the night, when the birds are active (approximately 23.00 – 03.00). For each lek one to four observers were active simultaneously, recording position of territories, display ratios, female visits, solicitations, copulations etc. using tape recorders. Flashlights and binoculars were used to locate and recognise individual birds. For a general description of the field methods see Fiske & Kålås (1995). A female was considered to have chosen a male if she was seen soliciting to or copulating with him. If a female is seen soliciting to a male but no copulation takes place, this means that she is very likely to have already mated with him on a previous night (Sæther et al. 2001). Male mating success was measured as the minimum number of females mating with or soliciting to a male in one year (Sæther et al. 2001). For males observed in more 19.

(197) than one year, mean mating success over those years was used in some analyses. Males without mating success observed on less than five nights around the peak of the mating activities were discarded from analyses because of insufficient information. The number of vocal displays and jumps were recorded in 2-minute intervals during the most intensive display period (23.45 – 02.15 hours). The mean number of 2 to 11 such display counts is used as a measure of the individual males display ratio.. Immunisation procedure In papers IV and V we were interested in measuring the function of the humoral immune response. To do this we injected males with diphtheria/tetanus vaccine in the beginning of the field season of 2001 and 2002. Before injection, a control blood sample was taken from the birds. The blood sample was treated with heparin to avoid clotting, and after centrifugation the clear blood plasma on top was collected and used for analysis of antibody content (see below). After around 12 nights the birds were re-caught and a second blood sample (response sample) was taken and treated in the same way as the control sample. We were able to re-catch about half of the vaccinated birds, yielding a total sample size of 51 for the two years of this study.. ELISA We used a method called enzyme-linked immunosorbent assay (ELISA) to measure the amount of specific antibodies produced against the two antigens injected into the birds (Fig. 6). First 96-well plates are treated with the antigen of interest, so that this sticks to the walls of the wells. Then the collected blood plasma, with antibodies produced by the bird, is added to the well. The specific antibodies produced by the birds against the injected antigen will bind to the antigen on the well walls and stay in the well, while all other antibodies will be washed away. A so called, secondary antibody is added, this is specially made to bind specifically to all bird antibodies, furthermore it has an enzyme bound to it and it is possible to measure the activity of this enzyme via a colour signal. The activity of the linked enzyme is recorded in a Vmax (Molecular Dynamics, Sunny vale) kinetics ELISA reader and differences in the amount of specific antibodies in the plasma sample will be reflected in the strength of this signal. Antibody concentrations are given as the slope of the substrate conversion over time, measured in the unit 10-3 u optical density per minute (mOD/min) (analyzed using KineticCalc software, 20.

(198) Winooski), with a higher slope indicating a higher concentration of antidiphtheria or anti-tetanus antibodies in the sample. Antibody response was defined as antibody titer in the response sample minus antibody titer in the control sample. For more details about the immunisation procedure and the antibody analysis, see paper IV and Hasselquist et al. (1999, 2001). 2) Add blood plasma. 1) Add antigen. Wash. 3) Add labelled anti Ig. Wash. 4) Measure label. Wash. Figure 6. Schematic illustration of enzyme-linked immunosorbent assay (ELISA). A method for measuring the amount of specific antibodies against a certain antigen.. MHC genotyping DNA extraction About 100µl of blood was collected from the birds and stored in salt saturated DMSO (dimethyl sulfoxide). 50µl of the blood/DMSO solution was digested with Proteinase K (280µg/ml) and DNA was extracted using the Phenol/Clorophorm method (Sambrook et al. 1989), salt purification protocol (Paxton et al. 1996) or DNeasy Tissue Kit (Qiagen). PCR Polymerase chain reaction (PCR) was used to amplify specific parts of the MHC class II B gene. In paper I, a large number of primers were used to amplify different parts of this gene (exon 2 and 3, and intron 1 and 2). In papers II, III and V, primers situated in the introns surrounding exon 2 were used to amplify the whole of this exon (Edwards et al. 2000a). For position of the different primers used see Fig. 5, and for primer sequences see Table 1. For PCR conditions and other details see paper I and III.. 21.

(199) Table 1. Sequences of the PCR and sequencing primers used in the studies of this thesis. Standard IUB codes are used for degenerate primers. Name 34F Int1a Gint1a 326. Sequence 5’ ĺ 3’ CTGGTRGCACTGSTGGYGCTG TGACATCCCCATGTCTGCACA GCGGCCGCATCCCCATGTCTGCACA GAGTGYCAYTAYYTNAAYGGYAC. Ex3F2 420rev 325. GGCTCCCTGCCCCAGACCGAC CCCCAGGTCGCTGTCGAAGTG GTAGTTGTGNCKGCAGTANSTGTCCAC. Int2a Int2agc Int2b Int2c Int2cgc Int2s Ex3R. CTCCTGGGGAAATGTTCTGCC CCGGCGGGCGGGGTGGGGGCTCCTGGGGAAATGTTCTGCC GTGAGGGCTGTGAGCACCTTG CCAGGCCACCACATGGGCCAC CCGGCGGGCGGGGTGGGGGCCAGGCCACCACATGGGCCAC AACCTTCTGCCCCGCACTCAC CACCAGCAWCTGGTAWGTCCAKKC. Reference I I, II, III, V II, III, V Edwards et al. (1995a), I I I Edwards et al. (1995a), I I, II, III, V III, V I I II, III, V II, III, V I. Cloning Because more than one locus may have been amplified and many individuals are likely to be heterozygous it was crucial to separate different PCRproducts before sequencing. In paper I this was accomplished by ligating the PCR products into bacterial plasmids (pCR 2.1) and cloning these with a TA-cloning kit (Invitrogen). Individual products were than re-amplified and sequenced with m13 primers. DGGE/CDGE In papers II, III and V PCR products were separated using a combination of DGGE (denaturing gradient gel electrophoresis) and CDGE (constant denaturant gel electrophoresis) (Wu et al. 1999). By this method it is possible to separate PCR products that have the same length but differs in DNA sequence (Fig. 7). The PCR product is run on a polyacrylamide gel with an increasing amount of denaturing agents (urea and formamide), kept at a constant temperature in a water tank. The PCR product will denature at a certain point on the gel during the run. Where this is depends on the DNA sequence and when this happens the product will stop migrating in the gel. A very GC rich region (GC-clamp) was added to one of the primers stopping the two DNA strands from separating completely from each other after the denaturation. See paper III for more details about the method. After the run the gels were stained with ethidium bromide and visualised on a UV-table (Fig. 7).. 22.

(200) The pattern of the gel was recorded and individual bands were cut out and re-amplified before sequencing.. Figure 7. Picture of a DGGE/CDGE gel. Bands of different lengths represent different MHC class II B alleles. The different lanes all represent different individuals. To be able to compare individuals on different gels, ladders with known products are run each fourth lane.. Sequencing All PCR fragments were sequenced from both directions using specially designed sequencing primers situated closer to the exon than the original PCR primer or by using the same primer as in the original PCR. Sequencing reactions were set up using RR100 (Applied Biosystems, ABI PRISM BigDye) and sequencing was performed on an ABI 310 automated sequencer. Sequence analysis Sequence data was analysed using BioEdit version 5.0 (Hall 1999). Alleles that were only found in one individual were confirmed by performing a second typing of that individual. Sequences were checked for PCR recombination and sequences possibly resulting from such artefacts were removed. Statistical analysis of sequence data was performed in MEGA version 2.1 (Kumar et al. 2001), ARLEQUIN version 2.0 (Schneider et al. 2000) and GenePop (http://wbiomed.curtin.edu.au/genepop; Raymond & Rousset 1995). The minimum spanning network (MSN) was constructed with the program MINSPNET (Laurent Excoffier, Population genetics lab, Zoology Institute, University of Bern).. 23.

(201) RFLP and Southern blot In paper I we studied restriction fragment length polymorphism (RFLP) in order to get a general idea of the number of different MHC class II loci in the study species. Genomic DNA was cut with one of two restriction enzymes (PvuII and BglII), and digestions were run on an agarose gel and blotted onto a nylon membrane. This was hybridised with P32 marked probes made from PCR products of the second and third exon of the MHC class II B gene (see paper I for details).. Statistical analyses Statistical analyses were performed using SPSS version 11.5, R version 1.8.1 and GeneStat version 4.2. Randomizations for paper III and IV were done in ResamplingStats version 4.0.7. Data on mating success and antibody response was not normally distributed and nonparametric statistics or log transformations were used to analyse this data. All significance levels are two-tailed if not stated otherwise.. 24.

(202) RESULTS AND DISCUSSION. MHC class II B genes in the great snipe I investigated MHC class II B genes from a total number of 253 great snipe individuals and found 59 different alleles (I, II, III, V). Six of these alleles (Game 1- Game 6) were found when using primers situated within the second exon (exon primers) and only five individuals were typed with these primers. The rest of the alleles (Game 7 – Game 63) were found when typing with primers situated in the introns surrounding the second exon of the gene (intron primers). All the 253 individuals were typed with these primers. There are reasons to believe that the six alleles encountered using the exon primers originate from a different locus than the rest of the alleles. First these alleles were never encountered using the intron primers, even when typing the same individuals (I). Second these alleles formed a separate cluster, differing from the other in a Neighbour Joining tree (Fig. 8). Furthermore, only one or two different alleles were found in each of the five individuals when typed with the exon primers (I). When using intron primers I found one to four different alleles per individual. This could be because two different loci were amplified with the intron primers or that there has been a recent duplication of the locus affecting some of the individuals. That there is variation between individuals within a species in the number of MHC genes has previously been found in chicken (Zoorob et al. 1993) and humans (Robbins et al. 1997). Taken together this means that there is evidence for at least three different loci, at least in some individuals, in this species. RFLP data from three individuals suggest that the true total number of MHC class II B genes may be higher than this. When hybridising with a probe made from the more conserved third exon, 7 to 15 different bands were observed, depending on the individual and the restriction enzyme (I). Similar analyses in passerine bird species generally reveal very complex patterns with a large number of bands, indicating the presence of many genes (see for example Wittzell et al. 1999a; Freeman-Gallant et al. 2002). Compared to this we found a smaller number of bands, suggesting that the number of loci in the great snipe is smaller, resembling the considerably less complex pattern in the chicken (Kaufman et al. 1999). 25.

(203) 100 Coturnix coturnix (Y-LbIII). Gallus gallus (Y-LBIII). 37. Rfp-Y locus. Gallus gallus (BL-BII) 27. Phasianus colchicus. 100. Galliformes. B locus. Eudyptula minor. Spheniscidae. Pygoscelis papua. 67. Pygoscelis antarctica. 88 36. Game 10. 45. Gallinago media Intron primers. Game 9. 34. Game 11. 84. Game 7. 51. Game 8 Game 5. 98 48. Game 2. Gallinago media Exon primers. Game 3. 46. Game 6. 71. Game 4. 64. Game 1. 76. 99 31. Platyspiza crassirostris Certhidea olivacea. 22. Aphelocoma coerulescens Acrocephalus arundinaceus Passerculus sandwichensis. 33 99. 30. Carpodacus mexicanus. Passeriformes. Agelaius phoeniceus Lonchura striata. 20. Geospiza fortis. 20 95. Geospiza scandens. Homo sapiens 0.05. Figure 8. Neighbour-joining tree of 11 great snipe alleles, together with MHC class II B sequences (exon 2) from three chicken-like (Galliformes), three penguin (Spheniscidae) and 10 passerine (Passeriformes) bird species constructed using Kimura’s two-parameter model. Numbers represent percentages of bootstrap values (1000 replicates) and the scale bar represents genetic distance. A human sequence is used as an outgroup.. Nucleotide variation The nucleotide sequences of the 59 MHC class II B alleles are shown in Fig. 9, the sequences have also been deposited in GeneBank (accession numbers: AF485407-AF485417, AY620003-AY620023 and AY694384-AY694409). Out of 270 nucleotide sites (the whole of exon 2) 48 were variable and in each of these there were never more than two different nucleotides. After aligning the alleles to the B-LBII sequence of the chicken (Zoorob et al. 1990) it was possible to obtain the putative amino acid sequences for the alleles. The 59 nucleotide sequences resulted in 54 unique amino acid sequences, since three pairs and one triplet of alleles shared the same amino acid sequence. Codons supposedly involved in antigen binding (Brown et al. 1993) had a higher rate of nonsynonymous substitutions (nucleic substitutions resulting in an amino acid shift) than synonymous substitutions (nucleic substitutions not affecting the amino acid sequence) (Fig. 10). But this 26.

(204) was not the case for other codons (Fig. 10). A higher rate of nonsynonymous substitutions compared to the rate of synonymous substitutions is rare in other parts of the genome but common to find in the peptide binding region of expressed MHC genes (Hughes & Nei 1989; Edwards et al. 1995a,b) and is usually interpreted as a strong evidence for the presence of balancing selection (Hughes & Yeager 1998, but see also Garrigan & Hedrick 2003).. Gene organisation and comparison to other species When comparing the MHC alleles of the great snipe to sequences of the same gene from other bird species it was clear that the snipe sequences formed a well-defined cluster, separate from both passerine and other nonpasserine species (Fig. 8). In birds it is rather common to find that alleles from different loci cluster together within a species (Edwards et al. 1995b) and this may be the result of concerted evolution or of recent gene duplications (Hess & Edwards 2002). The situation is rather different in mammals where the same locus from different species generally cluster together in similar analysis (Edwards et al. 1999), and it is even common to find the same allele in closely related species, so-called trans-species polymorphism (Figueroa et al. 1988). It seems that the genetic organisation and number of loci of the bird MHC differs considerably between different species and this is one of the reasons why ecological interactions with MHC genes have been so little investigated in birds compared to the situation in mammals (Edwards et al. 1999; Wittzell et al. 1999b, I).. Figure 9 (next 5 pages). Nucleotide sequences of the second exon of class II B alleles from the great snipe. All 59 alleles found in this study are shown. Dots represent identity to the consensus sequence shown on top, and question marks represent unknown sequence at the two ends of the exon in the 6 alleles amplified using exon primers. The sequence marked “chicken” is the B-LBII sequence (Zoorob et al. 1990). The translated amino acid sequence of the consensus sequence is shown on top and codons in the putative peptide binding region (Brown et al. 1993) are indicated by a cross while traditionally conserved amino acid sites (II) are underlined.. 27.

(205) Game 1 Game 2 Game 3 Game 4 Game 5 Game 6 Game 7 Game 8 Game 9 Game 10 Game 11 Game 12 Game 13 Game 14 Game 15 Game 16 Game 17 Game 18 Game 19 Game 20 Game 21 Game 22 Game 23 Game 24 Game 25 Game 26 Game 28 Game 29 Game 30 Game 31 Game 32 Game 33 Game 34 Game 35 Game 36 Game 37 Game 38 Game 39 Game 40 Game 41 Game 42 Game 43 Game 44 Game 45 Game 46 Game 47 Game 48 Game 50 Game 51 Game 53 Game 54 Game 55 Game 56 Game 57 Game 58 Game 60 Game 61 Game 62 Game 63 Chicken. 28. 11 111 111 112 12 345 678 901 234 567 890 Y F Q F Q F GG TAT TTC CAG TTC CAG TTT + + ?? ??? ??? ??? ??? ??? ??? ?? ??? ??? ??? ??? ??? ??? ?? ??? ??? ??? ??? ??? ??? ?? ??? ??? ??? ??? ??? ??? ?? ??? ??? ??? ??? ??? ??? ?? ??? ??? ??? ??? ??? ??? .. ... ... ... ... ... ... .. ... ... ... ... ... ... .. ... ... ... ... ... ... .. ... ... ... ... ... ... .. ... ... ... G.. ... ... .. ... ... ... ... ... ... .. ... ... ... G.. ... ... .. ... ... ... ... ... ... .. ... ... ... G.. ... ... .. ... ... ... ... ... ... .. ... ... ... G.. ... ... .. ... ... ... ... ... ... .. ... ... ... ... ... ... .. ... ... ... ... ... ... .. ... ... ... G.. ... ... .. ... ... ... ... ... ... .. ... ... ... G.. ... ... .. ... ... ... ... ... ... .. ... ... ... ... ... ... .. ... ... ... G.. ... ... .. ... ... ... ... ... ... .. ... ... ... ... ... ... .. ... ... ... ... ... ... .. ... ... ... ... ... ... .. ... ... ... ... ... ... .. ... ... ... G.. ... ... .. ... ... ... ... ... ... .. ... ... ... ... ... ... .. ... ... ... G.. ... ... .. ... ... ... G.. ... ... .. ... ... ... ... ... ... .. ... ... ... ... ... ... .. ... ... ... ... ... ... .. ... ... ... G.. ... ... .. ... ... ... G.. ... ... .. ... ... ... G.. ... ... .. ... ... ... G.. ... ... .. ... ... ... G.. ... ... .. ... ... ... G.. ... ... .. ... ... ... ... ... ... .. ... ... ... ... ... ... .. ... ... ... G.. ... ... .. ... ... ... ... ... ... .. ... ... ... G.. ... ... .. ... ... ... G.. ... ... .. ... ... ... G.. ... ... .. ... ... ... ... ... ... .. ... ... ... G.. ... ... .. ... ... ... G.. ... ... .. ... ... ... ... ... ... .. ... ... ... ... ... ... .. ... ... ... G.. ... ... .. ... ... ... ... ... ... C. .TC ... TTC .G. GGT GCG. 222 123 K AAG + ??? ??? ??? ??? ??? ??? ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .TA. 222 222 333 333 333 344 444 444 445 555 5 456 789 012 345 678 901 234 567 890 123 4 G D C Y F S N G T E GGG GAC TGT TAC TTC AGC AAC GGC ACC GAG C ??? ??? ??? ??? ??? ??? .CC ... ... .CC ... ... ... ... ... .CC ... ... .CC .CC ... .CC ... .CC ... .CC .CC ... .CC ... .CC ... ... ... ... ... ... ... .CC ... ... ... ... ... ... ... ... .CC .CC ... ... .CC ... .CC ... ... ... ... ... TCC. ??? ??? ??? ??? ??? ??? ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..G. ??? ??? ??? ??? ??? ??? ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..C. ??? ??? ??? ??? ??? ??? ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... C... ??? ??? ??? ??? ??? ??? ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .A.. ??? ??? ??? ??? ??? ??? ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... CTG. ??? ??? ??? ??? ??? ??? ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .... ??? ??? ??? ??? ??? ??? ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .... ??. ??. ??. ??. ??. ??. ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ... ..T ... ... ... ... ... ... ... ... .... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... A.. ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ..

(206) Game 1 Game 2 Game 3 Game 4 Game 5 Game 6 Game 7 Game 8 Game 9 Game 10 Game 11 Game 12 Game 13 Game 14 Game 15 Game 16 Game 17 Game 18 Game 19 Game 20 Game 21 Game 22 Game 23 Game 24 Game 25 Game 26 Game 28 Game 29 Game 30 Game 31 Game 32 Game 33 Game 34 Game 35 Game 36 Game 37 Game 38 Game 39 Game 40 Game 41 Game 42 Game 43 Game 44 Game 45 Game 46 Game 47 Game 48 Game 50 Game 51 Game 53 Game 54 Game 55 Game 56 Game 57 Game 58 Game 60 Game 61 Game 62 Game 63 Chicken. 55 555 666 666 666 677 777 56 789 012 345 678 901 234 R V R F V A R GG GTG AGG TTT GTG GCC AGG + .. ... ... ... ... ... ... .. ... ... C.. ... .AG ... .. ... ... ... ... .A. ... .. ... ... ... ... ... ... .. ... ... C.. ... .AG ... .. ... ... .A. ... .AG ... .C ... ... .A. T.. ... ... .. ... ... C.. ... ... ... .. ... ... C.. ... ... ... .. ... ... ... ... ... ... .C ... ... .A. T.. ... ... .. ... ... C.. ... ... ... .. ... ... ... ... ... ... .. ... ... C.. ... ... ... .C ... ... .A. T.. ... ... .C ... ... C.. ... ... ... A. ... ... ... ... ... ... .. ... ... C.. ... ... ... .C ... ... .A. T.. ... ... .. ... ... ... ... ... ... .. ... ... ... ... ... ... .C ... ... C.. ... ... ... .. ... ... ... ... ... ... .C ... ... C.. ... ... ... .C ... ... .A. T.. ... ... .. ... ... ... ... ... ... .. ... ... ... ... ... ... .. ... ... C.. ... ... ... .C ... ... .A. T.. ... ... .. ... ... C.. ... ... ... .. ... ... ... ... ... ... .C ... ... .A. T.. ... ... .. ... ... C.. ... ... ... .. ... ... C.. ... ... ... .C ... ... .A. T.. ... ... .. ... ... ... ... ... ... .. ... ... C.. ... ... ... .. ... ... C.. ... ... ... .. ... ... C.. ... ... ... .. ... ... .A. T.. ... ... .C ... ... .A. T.. ... ... .. ... ... C.. ... ... ... .C ... ... .A. T.. ... ... .C ... ... .A. T.. ... ... .C ... ... .A. T.. ... ... .C ... ... .A. T.. ... ... .. ... ... C.. ... ... ... .. ... ... C.. ... ... ... .. ... ... ... ... ... ... .. ... ... C.. ... ... ... .C ... ... .A. T.. ... ... .. ... ... C.. ... ... ... .. ... ... C.. ... ... ... .. ... ... ... ... ... ... .. ... ... C.. ... ... ... .. ... ... ... ... ... ... .. ... ... C.. ... ... ... .C ... ... .A. T.. ... ... .. ... ... C.. ... ... ... .. ... ... .A. C.. CAA .... 777 567 Y TAC + ... ... ... ... ... ... CT. ... ... ... CT. ... ... ... CT. ... ... ... CT. ... ... ... ... ... ... ... ... ... CT. ... ... ... ... ... CT. ... ... CT. ... CT. ... CT. CT. ... ... CT. ... CT. ... ... ... ... ... ... ... ... ... ... ... .... 778 888 888 888 890 123 456 789 I Y N R ATC TAC AAC CGG + ... C.. ... ... ... ... ... ... ... ... ... ... ... C.. ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .... 11 999 999 999 900 012 345 678 901 E Q Y A GAG CAG TAC GCA + + ... ... CT. CTG .G. ... ... .TG ... ... ... .TG .G. ... ... .TG ... ... ... .TG .G. ... ... .TG .G. ... ... ... ... ... ... ... ... ... ... .TG ... ... ... ... ... ... A.. .TG ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .TG ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... A.. .TG ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .G. ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... A.. .TG ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... A.. .TG .G. ... ... ... ... ... ... ... ... ... ... ... ... ... A.. .TG ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .G. ... ... ... ... ... ... ... ... ... ... ... ... ... ... .TG ... ... ... ... ... ... ... ... .G. ... ... ..G ... ... ... ... C.. ... .T. A.G. 111 000 234 H CAC. 111 000 567 F TTC. 1 0 8. ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. G. 29.

(207) Game 1 Game 2 Game 3 Game 4 Game 5 Game 6 Game 7 Game 8 Game 9 Game 10 Game 11 Game 12 Game 13 Game 14 Game 15 Game 16 Game 17 Game 18 Game 19 Game 20 Game 21 Game 22 Game 23 Game 24 Game 25 Game 26 Game 28 Game 29 Game 30 Game 31 Game 32 Game 33 Game 34 Game 35 Game 36 Game 37 Game 38 Game 39 Game 40 Game 41 Game 42 Game 43 Game 44 Game 45 Game 46 Game 47 Game 48 Game 50 Game 51 Game 53 Game 54 Game 55 Game 56 Game 57 Game 58 Game 60 Game 61 Game 62 Game 63 Chicken. 30. 11 01 90 D AC. 111 111 123 S AGC. 111 111 456 D GAC. 111 111 789 L CTG. 111 222 012 G GGG. 111 222 345 H CAC. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..T ... ... ... ... ... ... ... ... .... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .... G.. ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... G... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .... T.. ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... T.. ... ... ... ... ... ... ... T.. ... ... ... ... ... ... T.. ... ... ... ... ... ... A.A. 111 222 678 Y TAC + ... .T. .T. ... .T. ... .T. ... .T. .T. ... ... .T. ... ... ... ... ... .T. ... ... .T. .T. ... .T. .T. .T. ... ... ... .T. ... .T. ... ... .T. ... .T. ... ... .T. .T. ... ... .T. .T. ... ... ... ... .T. ... .T. .T. ... ... ... .T. ... .TT. 111 233 901 V GTG. 111 333 234 A GCT. 111 333 567 D GAC. 111 334 890 T ACC. 111 444 123 P CCC. 111 444 456 L CTG. 111 444 789 G GGG. 111 555 012 K AAA. ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .... .G. .G. ... .G. ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..C. ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..T. ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... T.A. ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..G. ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..T. ..G ..G ..G ..G ..G ..G ... ... ... ... ..G ... ..G ... ..G ... ... ... ... ... ... ... ..G ... ..G ... ... ... ... ... ... ... ..G ..G ..G ..G ... ... ... ..G ..G ... ..G ..G ... ... ..G ... ... ..G ... ... ... ..G ..G ... ... ..G ... G.G. 111 555 345 P CCT + ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..G. 111 555 678 D GAT. 111 566 901 A GCT. 1 6 2. TC. ... TC. TC. ... AC. AC. AC. ... ... ... AC. ... ... ... ... ... ... AC. ... ... ... ... AC. ... ... ... ... AC. AC. ... ... ... ... ... ... ... AC. AC. ... ... ... ... ... ... AC. ... ... ... ... AC. ... AC. ... ... ... ... ... AC. C.A. ... ..C ... ... ..C ... ... ... ... ... ..C ... ..C ... ..C ... ... ..C ... ... ... ... ..C ... ..C ... ... ... ... ... ... ... ..C ..C ..C ..C ... ... ... ..C ..C ... ..C ..C ... ... ... ..C ..C ..C ... ... ... ..C ..C ... ... ..C ... .... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. G.

(208) 11 66 34 D AC Game 1 Game 2 Game 3 Game 4 Game 5 Game 6 Game 7 Game 8 Game 9 Game 10 Game 11 Game 12 Game 13 Game 14 Game 15 Game 16 Game 17 Game 18 Game 19 Game 20 Game 21 Game 22 Game 23 Game 24 Game 25 Game 26 Game 28 Game 29 Game 30 Game 31 Game 32 Game 33 Game 34 Game 35 Game 36 Game 37 Game 38 Game 39 Game 40 Game 41 Game 42 Game 43 Game 44 Game 45 Game 46 Game 47 Game 48 Game 50 Game 51 Game 53 Game 54 Game 55 Game 56 Game 57 Game 58 Game 60 Game 61 Game 62 Game 63 Chicken. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .A. 111 666 567 Y TAC + ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .... 111 667 890 W TGG + ... ... ... ... ... ... .TT .TT ... ... ... .TT ... .TT ... ... ... ... .TT ... ... .TT ... .TT ... ... .TT ... .TT ... ... ... ... ... ... ... ... .TT .TT ... ... ... ... ... ... .TT ... ... ... ... .TT ... .TT ... ... ... .TT ... .TT .... 111 777 123 N AAC. 111 777 456 S AGC. 111 777 789 Q CAG. ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... A.C. 111 888 012 P CCA + ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... G.C. 111 888 345 E GAA. 111 888 678 V GTA. ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ..G. A.. ... ... A.. ... AC. ... A.. ... ... ... ... ... ... ... ... ... AC. ... ... ... ... ... ... A.. ... ... ... ... ... ... ... ... ... A.. A.. ... ... A.. ... ... A.. ... ... ... ... ... AC. AC. ... AC. A.. ... ... ... ... ... ... ... C.T. 111 899 901 L CTG + ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .... 111 999 234 E GAG ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .... 111 999 567 R AGG + .AT ..C .AT GAT .AT GAT ... ... ... ... ... GAT ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... GAT GAT ... ... ... ... ... ... ... ... ... ... .AC. 112 990 890 K AAA + GC. .G. GC. GC. GC. GC. ... ... ... ... ... GC. ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... GC. GC. ... ... ... ... ... ... ... ... ... ... CG.. 222 000 123 R CGG. 222 000 456 A GCT. ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... AT.. ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... AA.. 222 000 789 E GAG + .CC .CC .CC .CC .CC .CC ... .CC ... ... ... .CC ... .CC ... .CC ... ... ... ... ... .CC ... .CC ... ... .CC ... ... .CC .CC ... ... ... ... ... .CC .CC .CC ... ... ... ... ... ... ... ... .CC .CC ... ... ... .CC ... ... ... .CC ... .CC ..A. 222 111 012 V GTG. 222 111 345 D GAC. 2 1 6. ??? ??? ??? ??? ??? ??? ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .... ??? ??? ??? ??? ??? ??? ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .... ? ? ? ? ? ? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. A. 31.

No results found