Contents lists available atScienceDirect
Stem Cell Research
journal homepage:www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
Incontinentia pigmenti: Generation of an IKBKG deficient human iPSC line (KICRi002-A-1) on a 46,XY background using CRISPR/Cas9
Ambrin Fatima
a, Jens Schuster
a, Talia Akram
a,b, Carolina Maya González
a, Maria Sobol
a, Jan Hoeber
a, Niklas Dahl
a,⁎aDepartment of Immunology, Genetics and Pathology, Science for Life Laboratory, Uppsala University, 751 08 Uppsala, Sweden
bHuman Molecular Genetics Laboratory, National Institute for Biotechnology and Genetic Engineering (NIBGE), Faisalabad, Pakistan
A B S T R A C T
Incontinentia pigmenti (IP) is an X-linked dominant neuroectodermal dysplasia caused by loss-of-function mutations in the IKBKG gene. Using CRISPR/Cas9 technology, we generated an IKBKG knock-out iPSC line (KICRi002-A-1) on a 46,XY background. The iPSC line showed a normal karyotype, expressed pluripotency markers and exhibited capability to differentiate into the three germ layers in vitro. Off-target editing was excluded and no IKBKG mRNA expression could be detected. Our line offers a useful resource to elucidate mechanisms caused by IKBKG deficiency that leads to disrupted male fetal development and for drug screening to improve treatment of female patients with IP.
Resource table
Unique stem cell line identifier KICRi002-A-1 Alternative names of stem cell line UUIGPi012-A-1
10-I nemo K.O.7
Institution Uppsala University, Uppsala, Sweden Contact information of distributor Jens Schuster, jens.schuster@igp.uu.se
Niklas Dahl, niklas.dahl@igp.uu.se
Type of cell lines iPSCs
Origin Human
Cell Source Fibroblasts
Clonality Clonal
Method of reprogramming (Sendai virus for parental line KICRi002A)
Gene modification YES
Type of modification Targeted gene knock-out
Associated disease Incontinentia Pigmenti (IP; OMIM 308,300) Gene/locus IKBKG/ChrX: 153,770,459–153,793,261 Method of modification CRISPR-Cas9
Name of transgene or resistance N/A Inducible/constitutive system N/A Date archived/stock date November 2019
Cell line repository/bank https://hpscreg.eu/cell-line/KICRi002-A-1 Ethical approval The study was approved by the Regional Ethics
Committee of Uppsala (Registration #:
2009/319 and 2016/209).
Resource utility
Inactivation of the IKBKG gene causes Incontinentia Pigmenti (IP) and germline mutations are usually lethal in male fetuses (Smahi et al.,
2000;Maubach et al., 2017). The iPSC line KICRi002-A-1 offers a useful resource to study early molecular and cellular mechanisms caused by IKBKG mutations and for drug screening to improve treatment of pa- tients with IP.
Resource detail
Incontinentia pigmenti (IP; OMIM 308,300) is an X-linked dominant neuroectodermal disorder caused by loss-of-function mutations in the IKBKG (also named NEMO) gene (Smahi et al., 2000;Maubach et al., 2017;Narayanan et al., 2015). Germ-line IKBKG deficiency is lethal in hemizygous male fetuses whereas heterozygous females show a skewed X chromosome inactivation (~90%), with positive selection for the w.t.
allele (Parrish et al., 1996). Affected females present with characteristic skin features at birth that are transformed to hyper- and hypopigmented areas following Blaschko's lines. The most disabling manifestations are central nervous system disturbances and blindness. Defects of teeth, hair, skin and nails are common. IKBKG is a key regulator of canonical NF-κB-mediated signaling with downstream effects on the expression of multiple genes of importance for cell proliferation, cell survival and differentiation (Maubach et al., 2017).
To study molecular mechanisms behind male embryonic lethality associated with IKBKG deficiency, we generated an IKBKG gene knockout (KO) line (KICRi002-A-1) from the human male iPSC line KICRi002A (Uhlin et al., 2017) using CRISPR/Cas9 technologyTable 1.
We used two distinct guide (g)RNAs (Fig. 1A) that were cloned and transfected into KICRi002A to induce a targeted deletion within the
https://doi.org/10.1016/j.scr.2020.101739
Received 13 January 2020; Received in revised form 5 February 2020; Accepted 11 February 2020
⁎Corresponding author.
E-mail addresses:jens.schuster@igp.uu.se(J. Schuster),niklas.dahl@igp.uu.se(N. Dahl).
Available online 20 February 2020
1873-5061/ © 2020 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
T
IKBKG gene. Transfected cells were sorted for GFP expression followed by clonal expansion of single cells. Successful editing was shown in the clone KICRi002-A-1 by Sanger sequencing that revealed a 765 bp de- letion (chrX:153,780,293–153,781,057 del) encompassing part of exon 2 extending into intron 2 of IKBKG (Fig. 1A). The deletion results in a frameshift and creates a premature stop codon (p.Val26Metfr*52). Loss of IKBKG gene expression in the KICRi002-A-1 line was confirmed by gel separation and quantitative real-time (q)RT-PCR, respectively (Fig. 1B). Moreover, the top four predicted off-target sites showed wild type sequences in the edited KICRi002-A-1 line after PCR followed by Sanger sequencing (data available from the authors).
The established and clonal iPSC line KICRi002-A-1 showed typical iPSC morphology, i.e. tight colonies, high nucleus-to-cytoplasm ratio and defined luminescent borders visualized by bright field microscopy (Fig. 1C; scale bar 100 µm). Furthermore, endogenous expression of pluripotency markers SOX2 and NANOG (Fig. 1D; scale bar 100 µm), SSEA4 and TRA-1–60 (Fig. 1E) was confirmed in the iPSC line by im- munofluorescence and flow cytometry, respectively.
Genomic integrity was assessed by karyotyping using G-banding.
The iPSC line showed a normal male 46,XY karyotype without detect- able aberrations or rearrangements (Fig. 1F). Additionally, DNA pro- filing confirmed that all 16 analyzed polymorphic sites matched the parental and isogenic iPSC line KICRi002A. Scorecard analysis verified an expression profile of pluripotency markers and undifferentiated state comparable to a reference set of 23 human pluripotent control cell lines (Fig. 1G).
Subsequently, we validated the potential of the iPSC line to differ- entiate into all three germ layers using an embryoid body (EB) differ- entiation assay followed by scorecard analysis. Expression of specific markers for ectoderm, mesoderm and endoderm after three weeks of EB differentiation confirmed that the KICRi002-A-1 iPSC line was capable of forming all three germ layers (Fig. 1G).
Materials and methods Cell culture
The iPSCs were cultured in Essential-8™ medium (ThermoFisher
For embryoid body formation, the iPSCs were dissociated with ac- cutase (Sigma cat no: A6964) seeded into an AggreWell™400 plate (Stem Cell Technologies, cat no: 34,421) in AggreWell™ medium (Stem Cell Technologies, cat no: 05,893) supplemented with 10 µM Rho-ki- nase inhibitor Y27632 (Stem Cell Technologies, cat no: 72,304) ac- cording to protocol. Next day, cells were transferred to non-adherent culture plates and further differentiated for three weeks.
CRISPR/Cas9-mediated IKBKG gene editing
The CRISPR-direct tool (https://crispr.dbcls.jp/) was used to design two gRNAs with high specificity to IKBKG target sites with the least number of predicted off-targets. The gRNA sequences were cloned into pSpCas9 (BB)−2A-GFP (PX458), (Addgene, plasmid #48,138)Table 2.
The resulting vector containing sequences for the two IKBKG gRNAs and Cas9 was nucleofected into the parental iPSC line KICRi002A using an Amaxa Nucleofector II (Lonza; program B-016) and replated on LN521 coated culture dishes. Cells were harvested 24 h post nucleo- fection and GFP expressing single cells were isolated using fluores- cence-activated cell sorting (FACS; BD Aria II) and plated in individual wells of LN521 coated 96-well plates in E8 medium supplemented with 10 µM Y-27,632. Colonies derived from single cells were passaged at day 10, expanded and subsequently analyzed for gene editing by Sanger sequencing.
Immunofluorescence
Cells were fixed with 4% formaldehyde for 5 min at room tem- perature (RT) and blocked with 1xPBS, 1%BSA, 0,3% TritonX100 at RT.
Primary antibodies were diluted in pre-incubation buffer and incubated at 4°C overnight. Secondary antibodies diluted in pre-incubation buffer were incubated at room temperature for 60 min Table 2. Nuclear marker, DAPI (1 μg/ml; Sigma, cat no: D8417) was incubated for 5 min at room temperature and cells were mounted onto microscope slides using ImmuMount (ThermoFisher Scientific, cat no: 9,990,402). Cells were imaged using an AxioImager (Zeiss) at 20X resolution (N.A. 0.8).
Karyotyping Table 1
KICRi002-A-1 line characterization and validation.
Classification Assay Results Data
Morphology Photography KICRi002-A-1 appears normal Fig. 1panel C
Phenotype Qualitative analysis (Immunofluorescence) Positive for pluripotency markers NANOG and SOX2 Fig. 1panel D Quantitative analysis (TaqMan® hPSC Scorecard™) KICRi002-A-1 is pluripotent
And undifferentiated as Compared to reference set Fig. 1panel F Quantitative analysis (Flow Cytometry) KICRi002-A-1 is positive for surface markers TRA–1–60
(96,6%) and SSEA4 (99,8%) Fig. 1panel E
G-band analysis Karyotyping (G-banding) 46,XY (resolution 400 bphs) P28 Fig. 1panel G
Identity STR analysis (AmpFLSTR™ Identifiler™ PCR
Amplification Kit) DNA profile of all 16 polymorphic sites matched Available with the authors Mutation analysis Sanger Sequencing KICRi002-A-1 carries a 765 bp deletion in exon 2 of
IKBKG gene Fig. 1panel A
Quantitative real-time RT-PCR IKBKG mRNA expression is not detectable in the
KICRi002-A-1 iPSC line Fig. 1panel B
Southern Blot OR WGS N/A
Differentiation potential Embryoid body formation and differentiation followed by
Scorecard analysis Expression of all three germ layers detected after 3
weeks of differentiation Fig. 1panel F
Microbiology and virology Mycoplasma testing by luminescence (MycoAlert
Mycoplasma Detection Kit) Negative Supplemental File 1
Donor screening (OPTIONAL) HIV 1 + 2
Hepatitis B, Hepatitis C N/A
Genotype Blood group genotyping N/A
additional information HLA tissue typing N/A
Fig. 1. Characterization of the IKBKG deficient human iPSC line KICRi002-A-1.
Giemsa-stained chromosomes was performed on 20 fixed metaphases using the Metafer slide scanning platform and Ikaros software, MetaSystems.
STR analysis
Cell authentication was performed on KICRi002-A-1 derived DNA (NucleoSpin® tissue kit, Macherey-Nagel, cat no:740,952.250) using AmpFLSTR™ Identifiler™ PCR Amplification Kit (ThermoFisher Scientific, cat no: 4,322,288). Data was analyzed with GeneMapper™
Software 5.
Quantitative real-time PCR (RT-PCR)
Total RNA was isolated using RNeasy micro kit (Qiagen, cat no:
74,004) and cDNA was synthesized using High Capacity cDNA Synthesis kit (ThermoFisher Scientific, cat no: 4,368,814) from 1 μg of total RNA. Real-time PCR was performed using SYBR® Green Real-Time PCR Master mix (Sigma, Cat no: 4,913,850,001) on StepOnePlus™ Real- Time PCR System (Applied Biosystems). IKBKG gene expression was normalized to the expression of GAPDH. Additionally, PCR products (expected sizes IKBKG: 336 bp, GAPDH: 226 bp) were visualized by 1%
gel electrophoresis. Ladder (M): GeneRuler 1 kb DNA ladder (ThermoFisher Scientific, cat no: SM0314)Table 2.
Scorecard analysis
software athttps://apps.thermofisher.com/hPSCscorecard/home.
Mycoplasma testing
Absence of mycoplasma was confirmed in KICRi002-A-1 line cell culture supernatants using MycoAlert™ Mycoplasma Detection kit (Lonza, cat no: LT07-318).
Declaration of Competing Interest
The authors declare that they have no competing interests.
Acknowledgements
We thank prof. Anna Falk for the parental iPSC line KICRi002A. This work was supported by the Swedish Research Council 2015-02424 (to ND), and Hjärnfonden FO2019-0210 (to ND). Image acquisition and flow cytometry were performed at the BioVis Platform and scorecard processing at the Genome centre platform, Science for Life Laboratory at Uppsala University.
Supplementary materials
Supplementary material associated with this article can be found, in the online version, atdoi:10.1016/j.scr.2020.101739.
References Table 2
Reagents details.
Marker type Antibody Dilution Company Cat # and RRID
Pluripotency Markers Mouse IgG anti-NANOG 1:100 Millipore Cat# MABD24, RRID:AB_11,203,826
Pluripotency Markers Mouse IgG anti-SSEA4 1:100 Thermo Fisher Scientific Cat# 41–4000 RRID:AB_2,533,506
Pluripotency Markers Mouse IgM anti–TRA–1–60 1:100 Thermo Fisher Scientific Cat# 41–1000 RRID:AB_2,533,494
Pluripotency Markers Goat IgG anti-SOX2 1:500 R and D Systems Cat# AF2018
RRID:AB_355,110
Secondary Antibodies AF488 Goat anti-mouse IgM 1:1000 Thermo Fisher Scientific Cat# A-11,001
RRID:AB_2,534,069
Secondary Antibodies AF555 Goat anti-mouse IgG 1:1000 Thermo Fisher Scientific Cat# A-21,426 RRID:AB_2,535,847 Secondary Antibodies AF647 donkey anti-mouse IgG 1:1000 Thermo Fisher Scientific Cat# A-31,571 RRID:AB_162,542 Secondary Antibodies AF488 donkey anti-goat IgG 1:1000 Thermo Fisher Scientific Cat# A-11,055 RRID:AB_2,534,102 Primers
Target Forward/Reverse primer (5′−3′)
IKBKG/gRNA-1 (sgRNA, cloning) Inhibitor Of Nuclear Factor Kappa B Kinase Regulatory Subunit Gamma
Top: CACCgGCAGCAGATCAGGACGTACT Bottom: AAACAGTACGTCCTGATCTGCTGCc IKBKG/gRNA-2 (sgRNA, cloning) Inhibitor Of Nuclear Factor
Kappa B Kinase Regulatory Subunit Gamma
Top: CACCgGCCCTGAACCCATGACGACC Bottom: AAACGGTCGTCATGGGTTCAGGGCc CNBD1 (off-target, PCR) Cyclic Nucleotide Binding
Domain Containing 1 GCCTGCAAAGCTCTACATGG/ GGCTCAAGTAGTACTCTGGA
FAM3D (off-target, PCR) Family With Sequence
Similarity 3 Member D GGCCCCACTGCAGATTTTAA/ GCACATCTCCCAGACTTTGC
CLIC2 (off-target, PCR) Chloride Intracellular
Channel 2 ACAAAGACACAATGTACCGGA/ AGGGATTGACTTCTTCCTGTGT
F8 (off-target, PCR) Coagulation Factor VIII TAACCCAGGGCAATGCAGAG/ CGGAGGTGAAGGCTGACT
CAND2 (off-target, PCR) Cullin Associated And
Neddylation Dissociated 2 CCTGATGAGCTTAACCCCATG/ AAGCCTTTACCACCTTGATGT
WWC1 (off-target, PCR) WW And C2 Domain
Containing 1 CTGTAATCGCAGCTACTTGGG/ GAGTTCCATTCCAAATGTTCAGA
IKBKG (qPCR) Inhibitor Of Nuclear Factor
Kappa B Kinase Regulatory Subunit Gamma
CAACTGTGTGAGATGGTGCA/ CTGCTCCTTCTGCCTCTTCA GAPDH (qPCR) Glyceraldehyde-3-phosphate dehydrogenase (normalization) GAAGGTGAAGGTCGGAGTC/ GAAGATGGTGATGGGATTTC
R.A., Nelson, D.L., 2000. Genomic rearrangement in NEMO impairs nf-kappab acti- vation and is a cause of incontinentia pigmenti. The International Incontinentia Pigmenti (IP) Consortium. Nature 405, 466–472.
Maubach, G., Schmadicke, A.C., Naumann, M., 2017. NEMO links nuclear factor-kappab to human diseases. Trends Mol. Med. 23, 1138–1155.
Narayanan, M.J., Rangasamy, S., Narayanan, V., 2015. Incontinentia pigmenti (Bloch- Sulzberger syndrome). Handb. Clin. Neurol. 132, 271–280.
Parrish, J.E., Scheuerle, A.E., Lewis, R.A., Levy, M.L., Nelson, D.L., 1996. Selection against mutant alleles in blood leukocytes is a consistent feature in incontinentia pigmenti type 2. Hum. Mol. Genet. 5, 1777–1783.
Uhlin, E., Ronnholm, H., Day, K., Kele, M., Tammimies, K., Bolte, S., Falk, A., 2017.
Derivation of human iPS cell lines from monozygotic twins in defined and xeno free conditions. Stem Cell Res. 18, 22–25.
