Generation of induced pluripotent stem cells (iPSCs) lines deficient for genes associated with neurodevelopmental diseases using CRISPR/Cas9 technology

Generation of induced pluripotent stem cells (iPSCs) lines deficient for genes associated with

neurodevelopmental diseases using CRISPR/Cas9 technology

Claudia De Guidi

Degree project in biology, Master of science (2 years), 2021 Examensarbete i biologi 45 hp till masterexamen, 2021

Biology Education Centre and Department of Immunology, Genetics and Pathology, Science for Life Laboratory, Uppsala University

Supervisor: Jens Schuster

External opponent: Josefin Johansson

Table of Contents

Abstract ... 3

List of abbreviations ... 4

1 Introduction ... 5

1.1 Characteristics and applications of Induced pluripotent stem cells (iPSCs). ... 5

1.2 Neurodevelopmental disorders ... 6

1.3 Aim of the study ... 7

2 Materials and methods ... 7

2.1 Culture of iPSC lines ... 7

2.2 Editing of iPSC lines with CRISPR/Cas9 technology ... 8

2.3 Single cells dilution: ... 8

2.4 Genomic DNA extraction ... 9

2.5 Screening of single-cell derived iPSC lines using PCR and Sanger sequencing ... 9

2.6 Genome integrity and cells authentication analysis. ...10

2.7 Quality assessment of iPSCs using Flow cytometry. ...11

2.8 Quality assessment of iPSCs using Immunofluorescence staining (IF). ...11

2.9 Assessment of differentiation potential of iPSC using embryoid body (EB) differentiation assay. ...12

2.10 RNA isolation, cDNA synthesis for characterization of iPSCs using TaqMan hPSC Scorecard. ...12

2.11 Mutation analysis with quantitative PCR (qPCR). ...12

2.12 POLR2A activity assay. ...13

2.13 Neural crest differentiation of iPSC ZEB2 knock-out line and its isogenic control. ...13

3 Results ... 15

3.1 Generation of iPSCs lines deficient for ZEB2, POLR2A, SCN1A and NCDN. ...15

3.2 Characterization of iPSC lines POLR2A K.D.2 and ZEB2 K.O.23. ...17

3.2.1 Quality assessment using Flow cytometry and IF ...18

3.2.2 Pluripotency and differentiation potential analysis ...19

3.2.3 Mutation analysis using qPCR ...20

3.3 POLR2A activity assay ...21

3.4 Neural crest cell (NCC) differentiation of ZEB2 K.O.23 iPSC line ...22

4. Discussion ... 23

Acknowledgments ... 26

References ... 27

Abstract

Induced pluripotent stem cells (iPSCs) can self-renew and differentiate into many other cell types. IPSCs are derived from somatic cells, and upon reprogramming, they share an expression profile similar to embryonic stem cells (ESCs). Among their many applications, iPSCs are an advantageous tool for disease modelling, offering an accurate system to study human molecular networks associated with specific phenotypes. Moreover, progress in genome editing technologies improved the possibilities for investigation of genotype-phenotype relationship for diseases characterized by defined genetic variants. Indeed, CRISPR/Cas9 edited iPSCs lines from healthy donors offer the possibility to investigate molecular networks with comparison to an isogenic control line. Furthermore, the ability of iPSCs to differentiate into neural cells, makes them a good model for studying neurodevelopmental diseases (NDDs). NDDs are characterized by heterogenous genetics and phenotypes.

Heterozygous gene variants in the alpha 1 subunit of the sodium-voltage gated channel

1.1 (SCN1A) and in Neurochondrin (NCDN) have been associated with epilepsy. While

many variants defining NDDs are associated with genes of transcriptional networks,

e.g. the zinc-finger E-box binding homeobox 2 transcription factor (ZEB2) or the RPB1

subunit of RNA polymerase II complex (POLR2A). Although published animal model

systems are available, there is a lack of human derived systems to investigate the gene

function in disrupted molecular networks in NDDs. In this project, IPSCs deficient for

evaluate the quality of the cell lines as iPSCs model, a POLR2A knock down (K.D.)

line carrying a 4 bp insertion and a ZEB2 knock out (K.O.) line carrying a 790 deletion

were characterized. Pluripotency and differentiation potential were confirmed by flow

cytometry analysis, immunostaining, and qPCR. Both lines maintained genome

integrity and editing in the top predicted off targets was excluded with PCR and Sanger

sequencing screening. Furthermore, ZEB2 is involved in induction of neural crest cells

(NCC); ZEB2 deficient line and the control behave similarly after a week of NCC

differentiation. In contrast, POLR2A variants suggest slowing of transcription

compared to the wild-type, therefore rate of transcription was measured performing an

activity assay. No relevant differences between POLR2A K.D. and control line were

observed in transcription rate of early pre-mRNA.

List of abbreviations

ASD Autism spectrum disorder BMP Bone morphogenetic protein bp Base pairs

cDNA Complementary DNA chr chromosome

DNA Deoxyribonucleic acid

DRB 5,6-Dichloro-1-beta-Ribo-furanosyl Benzimidazole DS Dravet Syndrome

EB Embryoid body ESCs Embryonic stem cells

FACS Fluorescent activated cells sorting GFP Green fluorescence protein

gRNA guide-RNA

hPSCs Human pluripotent stem cells ID Intellectual disability

IF Immunofluorescence staining iPSCs Induced pluripotent stem cells K.D. Knock down

K.O. Knock out LN-521 Laminin-521 NCC Neural crest cells

NDD Neurodevelopmental disease/disorder NSC Neural stem cells

PCR Polymerase chain reaction qPCR Quantitative PCR

Rhoki Rho kinase inhibitor RNA Ribonucleic acid

SNP Single nucleotide polymorphism wp well cells culture plate

WT Wild Type

1 Introduction

1.1 Characteristics and applications of Induced pluripotent stem cells (iPSCs).

Induced pluripotent stem cells (iPSCs) are characterized by the ability to self-renew and the capacity to differentiate into a plethora of other cell types. They are derived from somatic cells by forced expression of a set of transcription factors to become pluripotent, a process termed reprogramming. Different approaches have been developed for cell reprogramming, to introduce a set of gene encoding transcription factors into the cells. Expression of these so-called reprogramming factors triggers a change in gene expression leading to an expression profile similar to embryonic stem cells (ESCs) (1). Established protocols use vectors carrying transcription factors OCT4, SOX2, KLF4, and MYC. Additional factors have been described. The first two factors (i.e. OCT4 and SOX2) promote expression of pluripotency genes and repress expression of differentiation-directing genes. The second two (i.e. KLF4 and MYC) participate in altering chromatin structure allowing OCT4 and SOX2 to bind to DNA (2). Moreover, the preferred technologies for introduction of reprograming factors into cells are transfection (non-viral) methods or transduction by non-integrating viruses, such as Sendai virus, respectively, to avoid possible integration of viral DNA into the cell’s genomic DNA (1).

IPSCs are an important tool for research owing to their multiple possible applications in different research fields. One example is the use of iPSCs as disease-modelling systems. As they possess the capacity to give rise to various types of differentiated cells, they enable the investigation of specific questions on the behavior of otherwise not accessible tissue cells, such as human brain cells. Although there are animal models established for different diseases, often these do not mirror the human molecular aspects behind a phenotype. Thus, iPSCs derived from patients’ somatic cells, with easier access, such as blood cells, are a useful source to study the mechanisms underlying specific diseases. They are also useful to test the efficiency of drugs for a specific patient, making iPSCs valuable for the field of precision medicine as well (1,3).

One problematic aspect about studying disease etiology in patient derived iPSCs is the genetic background of the specific individual. Patient derived iPSCs are compared to iPSCs lines derived from healthy individual as control. Thus, differences in the phenotype could be caused by line-to-line variations instead of the disease-causing variants. To overcome this problem, we can generate iPSCs from a healthy donor and introduce specific mutations with gene editing. In this way iPSC lines disrupted for the gene of interest, can be compared to defined isogenic control line that differs from the edited line at the edited site only but retains the same genetic background (1).

The progress on CRISPR/Cas9 technology offers a further advantage in the application of iPSCs for research focused on diseases defined by specific genetic variants (1,3).

Indeed, this technology allows the introduction of gene editing at specific sites, contributing to the generation of iPSCs lines edited for genes involved in specific disorders. Furthermore, these CRISPR/Cas9 edited iPSC lines can then differentiate into different cell types and enable the investigation of molecular network pathways in such models with comparison to a non-edited isogenic control line.

Moreover, iPSCs find a possible application in gene editing cell therapy and regenerative medicine (1). From a patient’s somatic cells, we can derive pluripotent stem cells and correct their disease causing variant using gene editing technologies.

Subsequently, edited stem cells are differentiated into the cell types of interest and these

are potentially transplanted back into the patient as healthy donor cells. Cell therapy

aims to repair damaged tissue through healthy cell grafts. Whereas ESCs have been subject for clinical use for many years, iPSCs offer a valid alternative, avoiding some previous limitations such as ethical issues and possibly cell graft rejection (4,5).

IPSCs must be subjected to a quality assessment to avoid drawbacks in each of the mentioned applications. Reprogramming and maintenance of stem cells can cause genetic alteration, such as abnormalities in the karyotype (1). To ensure genome integrity, karyotyping screening is employed. It is important that the derived cells retain the same genetic profile as the parental line, therefore short tandem repeats (STR) analysis is commonly used for authentication of cell identity.

Furthermore, CRISPR/Cas9 could produce off-targets effects, therefore screening for the predicted off-targets site is needed to guarantee the specificity of the editing and lack of unwanted mutations.

Finally, to assess the quality of iPSCs, cells need to be further characterized. Expression of pluripotency markers is analyzed to evaluate cell pluripotent properties. Likewise, iPSCs undergo differentiation and significant markers expression is measured to assess their differentiation potential.

1.2 Neurodevelopmental disorders

Neurodevelopmental disorders (NDD) are a group of genetically and phenotypically heterogeneous early onset conditions (6). NDDs affect >3% of children worldwide.

Some common features are autism spectrum disorder (ASD), intellectual disability (ID), seizures, behavioral and physical abnormalities. The genetic and phenotypic heterogeneity creates challenges in diagnosis and treatment of the disorders (6).

Therefore, the identification of genetic risk factors and their cellular function in disease onset, is a fundamental approach towards personalized medicine in NDDs.

Up to 1000 gene variants have been found to be associated with NDD, and a large number of these belong to genes involved in chromatin remodeling and transcriptional networks (7,8). One example is the Zinc finger family of transcription factors, which are known to play an important role in the regulation of cell differentiation, for example the development of neuronal cells from neural stem cells (NSC) (9).

Previous work in the research group of Niklas Dahl, using patient derived iPSCs, has studied several of these genes associated with NDD:

Mowat-Wilson syndrome (MWS), a rare NDD characterized by the display of severe ID, seizures, and dysmorphic features, is usually caused by de novo heterozygous loss of function variants in ZEB2, the gene encoding zinc-finger E-box binding homeobox 2 transcription factor. Its role as transcription factor is both to promote and repress transcription. Additionally, ZEB2 is important in the induction of early developmental fate choice and differentiation of the neural crest (7). Although, studies using mice models, both deficient of Zeb2 (Zeb2 -/-) and heterozygous (Zeb2 +/-) (10,11), and mice ESCs (12) highlighted the functional role of ZEB2 in neurogenesis, there is a lack of work with human derived model systems. The Niklas Dahl’s group generated iPSCs from MWS patients carrying heterozygous ZEB2 variant to investigate effects of the gene haploinsufficiency in neural transcriptional networks (13).

De novo variants in POLR2A, the gene encoding the RPB1 subunit of RNA polymerase

II complex (pol II) were identified in 16 individuals with NDDs characterized by

infantile onset hypotonia, developmental delay (14). According to the authors, missense

heterozygous variants for POLR2A might result in aberrant pol II function, resulting in

correct transcription initiation but decreased elongation rate.

Moreover, variants in genes associated with neuronal communication (NC) are found in NDDs onset (15). As mentioned, one phenotypic feature in NDDs is seizures.

General epilepsy has been linked to mutations in SCN1A, the gene encoding the alpha 1 subunit of the sodium-voltage gated channel 1.1. More than 500 variants in this gene, both gain of function and loss of function, have been identified to be linked to epileptic phenotypes (16). In some cases, epileptic episodes might cause cerebral dysfunction and neurologic regression. One example is Dravet Syndrome (DS) or severe myoclonic epilepsy of the infancy (SMEI), a disease characterized by cognitive impairment and onset of epileptic seizures within the first year of life, which progress to epileptic encephalopathy. 70% of individuals affected by DS present SCN1A variants (17–20).

Specifically, studies on DS patient derived iPSCs defined by a heterozygous SCN1A gene variant, showed a correlation between SCN1A haploinsufficiency and abnormalities in GABAergic neurons function (20,21).

Moreover, epilepsy and neurodevelopmental delay was observed in individuals presenting mono and bi-allelic NCDN variants (22). NCDN is the human gene coding for Neurochondrin, a cytoplasmatic protein, that seems to be involved in the regulation of Ca2+/calmodulin-dependent protein kinase II CaMKII phosphorylation and is important for adult hippocampal neurogenesis (23). Neurochondrin complete knock out mice fail to survive while conditional knockout in the brain shows spatial learning impairment and epileptic phenotype, leading to believe that NCDN variants might have a role in seizures display. However, it is not yet clear how different NCDN mutations participate in molecular networks that lead to a NDDs like phenotype. Some studies found NCDN variants to cause dysregulation of metabotropic glutamate receptor 5 (mGluR5) signaling, resulting in onset of epilepsy (24).

Finally, one of the preferred models in NDDs studies are iPSCs. IPSCs derived from patients offer an in vitro system for generation of neuronal cells that can be used to investigate specific questions on the disease. Alternatively, iPSCs can be derived from healthy controls and edited with CRISPR/cas9 technology for genes found to be dysregulated in NDDs, as proposed in this study.

1.3 Aim of the study

The project aims to generate induced pluripotent stem cell (iPSC) knock-out (K.O.) and knock-down (K.D.) lines, respectively, using CRISPR/cas9 technology to enable investigations of disrupted transcriptional networks in neurodevelopmental disorders (NDD).

To this end, this study aims to:

- generate iPSC lines deficient for ZEB2, POLR2A, SCN1A and NCDN using CRISPR/Cas9 genome editing.

- asses the quality of generated iPSC lines for full pluripotency.

- conduct functional assays to investigate the impact of specific gene deficiencies.

2 Materials and methods

2.1 Culture of iPSC lines

To culture the induced pluripotent stem cell lines, we used 6-, 12-, 24- and 96-well cell

culture plates (wp). The plates were coated with Laminin-521 (BioLamina, cat no: LN-

521) diluted 1:20 in 1X DPBS and incubated at 37°C for at least 2 hours. Cells were

cultured in Essential-8

medium (ThermoFisher Scientific, cat no: A1517001), containing 1X Pen Strep (Gibco). The lines cultured in this study are iPSC control line, iPSCs Ctl10-1, iPSCs edited using CRISPR/cas9 for the genes ZEB2, POLR2A, NCDN and SCN1A, in specific a knock-out line for ZEB2, iPSCs 10-1 ZEB2 K.O.23, and three knock down lines for NCDN, POLR2A and SCN1A, respectively iPSCs 10-1 NCDN K.D., iPSCs 10-1 POLR2A K.D.2 and iPSCs 10-1 SCN1A K.D.

2.2 Editing of iPSC lines with CRISPR/Cas9 technology

A parental iPSC line Ctl10-I was edited using CRISPR/Cas9 to generate single gene knock out and knock down iPSC lines. Two gRNAs were designed for each target gene, using the CRISPR-direct tool (https://crispr.dbcls.jp/; Table 1). We designed gRNAs for early exons of the genes, which were predicted to give mutations most likely to result in a dysfunctional gene. The selected gRNAs (Table 1) were highly specific for exons 5 and 6 of ZEB2 gene, exons 2 and 5 for POLR2A gene, exons 11 and 12 for

introduced into a vector also expressing green fluorescent protein (transfection control;

GFP; Addgene plasmid #48138) and Cas9. The resulting vectors were verified by Sanger sequencing and then transfected into the parental iPSC line by nucleofection using an Amaxa nucleofector and Lonza Stem cell Nucleofection kit (program B-016).

The cells were plated into culture dishes coated with LN-521 and after 24h were harvested and sorted using fluorescent activated cell sorting (FACS). Cells that were sorted for expressing GFP were seeded into 96 wp previously coated with LN-521, in Essential-8

medium supplemented with 10 μM Rho kinase inhibitor Y27632. Single cell derived colonies were expanded and screened for successful editing (see below).

Table 1 Sequences of gRNAs targeting specific genes involved in NDDs

gRNAs name Targeted

gene

gRNAs sequences

ZEB2 gRNA1 ZEB2 Top CACCgCATTGGCCTCTGGCGTGCCA Bottom AAACTGGCACGCCAGAGGCCAATGc ZEB2 gRNA2 ZEB2 Top CACCgTTGTAGCCCCGGTCGCAGTA

Bottom CACCgTTGTAGCCCCGGTCGCAGTA POLR2A gRNA1 POLR2A Top CACCgAGGGAGGCCGCCCCAAGCTT

Bottom AAACAAGCTTGGGGCGGCCTCCCTc POLR2A gRNA2 POLR2A Top CACCgGCCTAGAGTTGTATGCGGAA

Bottom AAACTTCCGCATACAACTCTAGGCc SCN1A gRNA1 SCN1A Top CACCgCGTCTCTCTCCGTGTCGTCG

Bottom AAACCGACGACACGGAGAGAGACGc SCN1A gRNA2 SCN1A Top CACCgACTCATTGCTCGTTGCCTTT

Bottom AAACAAAGGCAACGAGCAATGAGTc NCDN gRNA1 NCDN Top CACCgTGCCAAGACCCTCTACGAGG

Bottom AAACCCTCGTAGAGGGTCTTGGCAc NCDN gRNA2 NCDN Top CACCgCCTCGCTTCTGTGCAAGTAT

Bottom AAACATACTTGCACAGAAGCGAGGc

2.3 Single cells dilution:

In order to obtain a clonal population of iPSCs targeted with CRISPR/Cas9 single cells dilution was conducted.

Cells previously sorted (FACS), expanded and screened (Sanger sequencing) for the

desired editing, were cultured in a 12 wp as described previously. 1 well was taken for

single cells dilution using the following protocol: 500 μl of TrypLe Express (Gibco)

were added to the well for 5 minutes incubation at 37°C, to dissociate the cells. 500 μl of Defined Trypsin Inhibitor (1X DTI, Gibco) was added to the well to inhibit TrypLe.

Cells were collected and centrifuged for 3 minutes at 300x g. Supernatant was discarded and the cells were counted and resuspended in culture media at a concentration of 10.000 cells/ml. A 1:100 dilution was prepared, and cells were seeded adding 10 μl to each well of a LN-521 coated 96 wp containing 75 μl of Essential-8

medium with Rho kinase inhibitor.

Single cell colonies were expanded by adding or changing Essential-8

medium every 2 days. When the colonies reached an optimal size, they were passaged to a 24 wp and subsequently expanded in a 12 wp. Each clone was sampled for DNA isolation to perform screening experiments.

2.4 Genomic DNA extraction

Genomic DNA of iPSCs clones was isolated using NucleoSpin Tissue kit (Macherey- Nagel), following the manufacturer instructions. Briefly, the cells were harvested by centrifugation and lysed adding 180 μl T1 buffer and 25 μl of proteinase K, after mixing 200 ul of B3 buffer were added and the samples were incubated for 10 minutes at 70°C.

Afterwards, 210 μl of pure ethanol were added and the samples were vortexed briefly and loaded into spin columns and centrifuged at 11000 rpm for 1 minute. Columns were washed twice and centrifuged at 11000 rpm for 1 minute, using 500 ul of washing buffer BW first and 600 ul B5 second. After discarding the flowthrough samples were again centrifuged at 11000 rpm for 1 minute in order to dry the membranes. Finally, DNA was eluted from the column centrifuging the samples at 11000 rpm for 1 minute in 40 μl Elution Buffer BE. DNA was quantified and the quality of DNA was assessed using Nanodrop.

2.5 Screening of single-cell derived iPSC lines using PCR and Sanger sequencing

Single cell derived iPSC lines were screened using PCR and Sanger sequencing, in order to confirm editing of the genes of interest. Once the clones were identified as K.O. or K.D., CRISPR/Off-targets sites were predicted using CRISPR-direct tool (https://crispr.dbcls.jp/). The top three predicted off-targets sites (Table 2) were analyzed similarly to assess the specificity of CRISPR/Cas9 editing.

Table 2 Three predicted off target sites The table lists the predicted off target sites that were analyzed for POLR2A and ZEB2 edited cell lines.

Targeted gene Off target site

POLR2A off target 1 chr9:136728696-136728710 ZEB2 off target 1 chr7:78787361-78787375 ZEB2 off target 2 chr1:234993240-234993254

PCR master mix was prepared using Phusion high-fidelity DNA polymerase

ThermoScientific kit, and contained per sample 6 μl of 5X GC Buffer, 0.9 μl dNTPs 10

μM, 0.9 μl of DMSO, 2.25 μl of each Primer, Forward and Reverse 10 μM¸ 0.3 μl of

DNA polymerase Phusion, 5 ng of DNA template and water to a volume of 30 μl. PCR

was performed using AppliedBiosystem 2720 Thermo Cycler with the following

conditions: 5 minutes denaturation at 98°C, 3 cycles with 20 seconds annealing at 64°C

and 1 minute extension at 72°C, 3 cycles with 20 seconds annealing at 61°C and 1 minute extension at 72°C, 3 cycles with 20 seconds annealing at 58°C and 1 minute extension at 72°C, 30 cycles with 20 seconds annealing at 57°C 1 minute extension at 72°C, and a final 5 minutes extension at 72°C.

PCR products were visualized by gel electrophoresis on a 1% agarose gel, and the bands of interest were purified with NucleoSpin Gel and PCR clean up kit (Macherey-Nagel), following the manufacturer instructions. Briefly, for 100 mg of gel, 200 μl of T1 buffer were added and the samples were incubated at 58°C for 10 minutes. The samples were then loaded in spin columns and centrifuged for 30 seconds at 11000 rpm. The columns were washed twice with 600 μl of N3 buffer by centrifugation at 11000 rpm for 30 seconds. Membranes were dried by centrifuging the columns at 11000 rpm for 1 minute and DNA was eluted in 15ul of elution buffer NE. The samples were sent for Sanger sequencing with appropriate primers using Eurofins Mix2Seq kit.

Sequence chromatograms were analyzed with Snapgene Viewer and sequences were blat to a reference genome in UCSC (

).

Pairs of primers used for each gene are shown in Table 3:

Table 3 Primers list for screening PCR

Primer´s name Target Forward and reverse primers (5´-3´)

SCN1A Scr Sodium Voltage-Gated Channel Alpha Subunit 1

TGCACTATTCCCAACTCACAA TTTAGAGGGCGAGCAAAGGA SCN1A Scr2 Sodium Voltage-Gated

Channel Alpha Subunit 1

AACCCCTAACAGAAATGCTTTG TGCAAAATGAAATCACATTCAA NCDN Scr Neurochondrin CACCACGCTAAGCTCATGTC

GGGGCTGGCTATGTCTACTC NCDN Scr2 Neurochondrin ACATGCTAGGTGCTGGGTTC GGGGCTGGCTATGTCTACTC NCDN Scr3 Neurochondrin GTGGGGTCAGAGAAGCAGAA

CTTCCCTGTTGCTGCACTAG POLR2A Scr RNA Polymerase II

Subunit A

CTTAGTCCAGAGCTCCCCAG/

CCCAGCACAAAACACTCCTC ZEB2 Scr new Zinc finger E-box-binding

homeobox 2

CCAGGCATGTAGTGCATTTG GTACCTTCAGCGCAGTGACA ZEB2 off target 1 Off target site GACTTGCCAACTATAGGGATCC

CCATCCTAGGCAATTGTCAGC ZEB2 off target 2 Off target site CGTTTTCGGAGGCTAAGGTG

TCTCCCTACTCCCTCCAGAC POLR2A off

target 1

Off Target site GAACCGGAGACAGAGAGGAG CTTCATCAGCTGCTCGTGAC

2.6 Genome integrity and cells authentication analysis.

IPSCs were analyzed using G-banding karyotyping to assess genome stability of cells.

Cells’ chromosomes fixed in metaphase were stained with Giemsa (G) solution.

Analysis of G-banding was carried out with Metafer slide scanning platform and Ikaros software, MetaSystems.

Moreover, Short tandem repeats (STR) analysis was employed to evaluate cell authentication of edited and control iPSCs lines. MpFLSTR™ Identifiler™ PCR Amplification Kit, ThermoFisher Scientific was used to amplify genomic DNA and products were separated on a SeqStudio Genetic Analyzer, Applied Biosystems.

Results were analyzed using GeneMapper™ Software v5.

2.7 Quality assessment of iPSCs using Flow cytometry.

Flow cytometry was used to analyze the quality of iPSCs. Expression of two pluripotency markers SSEA-4 and TRA-1-60 is assessed.

iPSCs were cultured in 6wp, washed with 2 ml of DPBS, 1 ml of TrypLE was added and cells were incubated for 4 minutes. Cells were collected by centrifugation in a Flow tube and washed adding 3 ml of 1%BSA/1xPBS/0.05 mM EDTA. Cells were centrifuged for 5 minutes at 300g. The supernatant was discarded, and the pellet resuspended in 100 μl of primary antibody solution (1:100 SSEA-4 mouse IgG Thermo Fisher Scientific Cat#41-4000, and TRA-1-60 mouse IgM Thermo Fisher Scientific Cat#41-1000), the tubes were incubated at room temperature in the dark for 20 minutes.

Afterwards, 3 ml of 1%BSA/1xPBS/0.05 mM EDTA were added, and cells were collected again by centrifugation for 5 minutes at 300g. The supernatant was discarded, and the pellet resuspended in 100 μl of secondary antibody solution (1:200 goat anti- mouse IgG Alexa488 Thermo Fisher Scientific Cat# A11001 and goat anti-mouse IgM Alexa 555 Thermo Fisher Scientific Cat# A21426) for 15 minutes incubation at room temperature in the dark. Again, cells were washed by adding 1%BSA/1xPBS/0.05 mM EDTA and centrifuged for 5 min at 300g, the supernatant was removed, and the pellet resuspended in 400 μl 1%BSA/1xPBS/0.05 mM EDTA. Samples were analyzed on a LSR Fortessa Flow cytometer and results visualized with DIVA software.

2.8 Quality assessment of iPSCs using Immunofluorescence staining (IF).

Additionally to the flow cytometry analysis, immunostaining was performed targeting pluripotency markers SOX2 and NANOG to assess the quality of the edited cell lines.

Cells cultured in 24 wp on glass coverslips, were fixed as follows. Culture medium was removed, and the cells were washed with 1X DPBS. After removing DPBS the cells were fixed on the coverslips by adding 500 μl of 4% paraformaldehyde (PFA) for 10 minutes incubation at room temperature. 4% PFA was then removed and DPBS was added for washing.

Coverslips were dried and 50 μl of Blocking solution (1xPBS, 0.1%TritonX100 and 1% BSA) was added for 45 minutes at room temperature. Coverslips were dried and incubated with 50 μl of primary antibody solution (1:200 IgG goat anti-SOX2 (R and D Systems Cat# AF2018) and 1:500 IgG mouse anti-NANOG (Millipore Cat#MABD24) overnight at 4°C. The next day coverslips were dried and washed in 1X PBS, and then incubated with 50 ul of secondary antibody solution (donkey anti-goat Alexa 488 (Thermo Fisher Scientific Cat# A11001) and donkey anti-mouse Alexa 647 1:1000 (Thermo Fisher Scientific Cat# A31571) for 1 hour and 30 minutes at room temperature. Finally, coverslips were washed in 1X PBS and incubated with 50 μl DAPI (1μg/ml) for 10 minutes, washed again and placed on a microscope glass slide with one drop of mounting media (SlowFade Gold Antifade Mountant (Thermo Fisher).

Specimen were viewed on a AxioImager M2 microsope.

2.9 Assessment of differentiation potential of iPSC using embryoid body (EB) differentiation assay.

In order to analyze the differentiation potential of the iPSC lines, cells were dissociated using TrypLE Express and plated on a 96 ultra-low attachment well plate, in DMEM F12 medium supplemented with 20% knock out serum replacement, 0.3% FBS, 2mM GlutaMAX™, 1x non-essential amino acids and 1% penicillin/streptomycin, and 10 μM Rho-kinase inhibitor Y27632, Stem Cell Technologies (cat no: 72304). Cells were centrifuged for 3 minutes at 300g and the next day EBs were transferred to a low attachment plate where they were left to differentiate for three weeks. Medium was changed twice a week. After differentiation, EBs were collected for RNA extraction and TaqMan hPSC Scorecard analysis, to evaluate the expression profiles (paragraph 2.10).

2.10 RNA isolation, cDNA synthesis for characterization of iPSCs using TaqMan hPSC Scorecard.

To assess both the pluripotency of the edited iPSC lines and the differentiation potential of their EBs, Scorecard assay was used. Scorecard is a TaqManArray® measuring expression of a set of 96 marker genes for self-renewal, and the three germ layers ectoderm, mesoderm, and endoderm. Total RNA was extracted from 1 well of 6 wp using RNeasy Mini kit (QIAGEN) following the protocol provided by the manufacturer. The cells were resuspended in 700 μl of Qiazol reagent. After 5 minutes incubation at room temperature, 140 μl of chloroform were added and the sample was vortexed and again incubated at room temperature for 3 minutes. The solution was centrifuged at 4°C at 12000g for 15 minutes. The aqueous transparent phase was transferred to a new tube and 525 ul of pure ethanol were added. The solution was mixed by pipetting and loaded onto a spin column, which was centrifuged at 8000 g for 15 seconds. The columns were washed three times with 700 μl RWT buffer, 500 μl RPE and 500 μl 80% ethanol, respectively. After drying the columns by centrifuging at maximum speed for 5 minutes with open lids, RNA was eluted in 14 μl RNase free water.

The quality of the RNA was assessed with

6000 Nano Chip and Agilent BioAnalyzer. cDNA was then synthetized using High-capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific) with RNase Inhibitor. 1 μg of RNA was mixed to 2X RT master mix, containing per well: 5 μl of 10x TaqMan RT Buffer, 2 μl of 25X dNTP mix, 5 μl of 10X Random Primers, 2.5 μl of Multiscribe Reverse Transcriptase 50 U/ul, 2.5 μl RNase inhibitor 20 U/μl and 8 μl of RNase free water.

The samples had a final volume of 50 ul and were placed in a thermal cycler using the following conditions: 10 minutes at 25 °C, 120 minutes at 37°C, 5 minutes at 85 °C.

After cDNA synthesis, the samples were diluted to 70 ul final volume and mixed to 70 μl of 2X TaqMan Gene Expression Master Mix. The TaqMan hPSC Scorecard Panel 384w was used (cat no: A15872/A15870). The panel was run on a thermal cycler using the following conditions: 2 minutes hold at 50 °C, 10 minutes hold at 95°C, 40 cycles of 15 seconds melting at 95 °C and 1 minute annealing and extension at 60°C. The data were analyzed using the hPSC Scorecard Analysis Software (available at

2.11 Mutation analysis with quantitative PCR (qPCR).

Loss of the targeted gene in edited iPSC lines was evaluated with qPCR. Aberrant

mRNA transcripts are eliminated by Nonsense-mediated mRNA decay (NMD) to

prevent translation of deleterious protein. Furthermore we investigated the expression

of the edited gene, in both CTL10-I and edited iPSC lines, using primers targeting exons. To this aim, total RNA was isolated and quantified (paragraph 2.10); 1 ng of RNA was added for cDNA synthesis to a master mix containing 2 μl 10x TaqMan RT Buffer, 0.8 μl of 25X dNTP mix, 2 μl of 10X Random Primers, 1 μl of Multiscribe Reverse Transcriptase 50 U/ul, 1 μl RNase inhibitor 20 U/ul and 3.2 μl of RNase free water prepared using High-capacity cDNA Reverse Transcription Kit with RNase Inhibitor (ThermoFisher Scientific). Applied Biosystem 2720 Thermo Cycler was employed to run the reverse transcriptase reaction as described in paragraph 2.8. A 1:20 dilution of obtained cDNA was used as a template for qPCR. FastStart Universal SYBR green Master ROX (Roche) was used for amplification. Master mix reaction contained 10 μl of 1X FastStart Universal SYBR green Master ROX, 6.8 μl of ddH

O, 0.6 μl of each primer, forward and reverse, 2 μl of cDNA template. Primers used are shown in Table 4. Results were normalized to housekeeping genes ACTB and GAPDH.

2.12 POLR2A activity assay.

In order to identify a possible functional difference in iPSCs POLR2A K.D. line, an activity assay based on qPCR was performed. The methodology was adopted from Singh and Padgett study (25). In this assay, cells are treated with DRB (5,6-Dichloro- 1-beta-Ribo-furanosyl Benzimidazole), a transcription elongation inhibitor which allow the assembly of the transcription complex and the start of transcription but stops the elongation. Upon removal of the inhibitor, the cells will be cultured again to allow restart of transcription. The rate of transcription is measured by investigating the amplification of pre-mRNA, harvesting the cells in a time course manner. More specifically, cells were cultured as described previously (paragraph 2.1), in 4 wells of a 12wp, when they were 70-80% confluent, cells were treated for 3 hours with DRB 100uM (Sigma) in culture media. After the 3 hours incubation, the media was removed, and the cells were washed twice with 1X DPBS. Following incubations with fresh media, cells were collected for RNA extraction at different time points (after 0, 10, 20, 30 minutes incubation). Therefore, cells were lysed directly in the well using QIazol and RNA was isolated and quantified (described in paragraph 2.10). Synthesis of cDNA and qPCR was carried out (paragraph 2.11). The primers used target pre-mRNA exons- intron junction for a native gene and were selected from Singh and Padgett’s study (Table 4). StepOne Plus Real-Time PCR system (Applied Biosciences) was employed to run the reactions.

2.13 Neural crest differentiation of iPSC ZEB2 knock-out line and its isogenic control.

A 7 days protocol of neural crest differentiation using Top-down BMP4 inhibition, was conducted for iPSCs ZEB2 K.O. line and isogenic control Ctl10-I (26). Cells were cultured in 1 well of a 6 well plate as previously described. Once the cells reached 80%

confluency, culture media was removed and cells were incubated for 4 minutes in 1 ml

of TrypLE at 37°C, triturated after adding 1 ml of DTI and centrifuged at 300g for 3

minutes. The supernatant was discarded, and the pellet resuspended in 1 ml E8 essential

medium, the cells were counted and 10000 cells/cm² were seeded in E8 essential

medium and Rho kinase inhibitor in 4 wells of 12 wp and on coverslips in 24 wells of

24 wp coated previously with LN521. The day after passage E8 essential medium was

removed and cells were fed every day for 7 days with TDi medium (DMEM/F12

supplemented with 1X N2, 1X PenStrep, 1 μM small molecule activator of WNT

CHIR99021, 2 μM inhibitor of Activin/BMP/TGF-β SB431542, 2 μM BMP1R

inhibitor DMH1, and 15 ng/ml BMP4). Cells in 12 wp were harvested for RNA

extraction (paragraph 2.10) and cells were fixed on coverslips (paragraph 2.7) on day 0, 3, 5 and 7. The expression of NCC markers was analyzed qualitatively with IF (paragraph 2.8) and quantitatively by amplification by qPCR (paragraph 2.11).

Antibodies used for IF and primers used in qPCR reactions are shown in Table 5 and Table 4, respectively.

Table 4 List of primers used in qPCRs

Primer´s name

Target Forward and reverse primers (5´-3´) ZEB2 Zinc finger E-box-

binding homeobox 2 for mutation analysis qPCR and NCC differentiation qPCR

CGCTTGACATCACTGAAGGA/

TGTGCGAACTGTAGGAACCA

ACTB Beta-Actin for normalization in mutation analysis qPCR and POLR2A assay

TGACGGGGTCACCCACACTGTGCCCATCTA/

CTAGAAGCATTTGCGGTGGACGATGGAGGG

GAPDH Glyceraldehyde-3- phosphate

dehydrogenase for normalization in mutation analysis qPCR

GAAGGTGAAGGTCGGAGTC/

GAAGATGGTGATGGGATTTC

Utr-Ex-1 Utr-In-1

Utrophin Exon 1 and Intron 1 junction for POLR2A activity assay

GGCAAGATGGCCAAGTATGGAG/

GCTTTCTTGAGCTTCCTTTACCTACCAG Utr-In-1 Utr-

Ex-2

Utrophin Intron 1 and Exon 2 junction for POLR2A activity assay

CCATTCCACAGATGAACACAATGACG/

GCGGCATCTGAACCATCGAAGT Utr-Ex-3

Utr-In-3

Utrophin Exon 3 and Intron 3 junction for POLR2A activity assay

CAGAGTGGGAAACCACCCATCA/

GGTACCCACACTGGGTCATCAA GAPDH(1) Glyceraldehyde-3-

phosphate

dehydrogenase for normalization in NCC differentiation qPCR

GGGACTGGCTTTCCCATAATTTCCT TAGAGGCAGGGATGATGTTCTGGA

SOX10 SRY-Box Transcription Factor 10 for NCC differentiation qPCR

CTCAGCGGCTACGACTGGA GGCGCTTGTCACTTTCGTTC SOX2 SRY-Box Transcription

Factor 2 for NCC differentiation qPCR

CATGAAGGAGCACCCGGATTA ATGTGCGCGTAACTGTCCAT CDH1 Cadherin 1 for NCC

differentiation qPCR

CACCACGTACAAGGGTCAGG GGGGGCTTCATTCACATCCA NANOG Nanog Homeobox for

NCC differentiation qPCR

GCCTCCAGCAGATGCAAGAA GCATCCCTGGTGGTAGGAAG PAX3 Paired Box 3 for NCC

differentiation qPCR

GCCTGACGTGGAGAAGAAAA CTTTCCTCTGCCTCCTTCCT NGFR Nerve Growth Factor

Receptor for NCC differentiation qPCR

CACCTCCAGAACAAGACCTCA CTGTTCCACCTCTTGAAGGCTA

Table 5 Antibodies used for IF

Primary antibody Secondary antibody

SOX10 rabbit (1:100, Cell Signaling, Cat# D5V9L)

Alexa 633 Goat anti-rabbit IgG (1:1000, Invitrogen)

NANOG mouse (1:500, Millipore Cat#MABD24)

Alexa 488 Goat anti-mouse IgG (1:1000, Invitrogen)

3 Results

3.1 Generation of iPSCs lines deficient for ZEB2, POLR2A, SCN1A and NCDN.

A human induced pluripotent stem cell (iPSC) line Ctl10-I (26) derived from a healthy male individual was employed to generate iPSC lines deficient for SCN1A, NCDN,

targeting approach (Figure 1), two gRNAs each targeted exon 11 and 12 of chr 2 for

and 5 of chr 17 for POLR2A (see paragraph 2.2). The gRNAs were introduced into the GFP/Cas9 expression vector and verified by Sanger sequencing. Obtained vectors containing specific gRNAs were introduced individually into the control line by transfection. For each gene, a bulk population of GFP expressing cells was submitted to FACS sorting. After expansion, the bulk populations were analyzed by PCR and Sanger sequencing for editing at the targeted loci. Resulting sequences were matched to the human genome using BLAT and the UCSC genome browser (27,28). The sequencing results showed that CRISPR/Cas9 editing was successful for all four genes.

More specifically, first, for SCN1A targeting, I identified a heterozygous variant in the iPSCs bulk population. Sequencing confirmed two different alleles, consistent with editing of one allele, while the other allele remained WT. The edited allele presented a 1550 bp deletion (Figure 1a). From the SCN1A editing bulk iPSC population, I performed single cells dilution (see paragraph 2.3), to obtain iPSC lines derived from one single cell, so-called clonal population. I obtained 21 clones, and PCR screening revealed that all clones contained only WT allele.

Second, NCDN edited iPSCs bulk iPSC population showed heterozygous editing, where one allele was WT and the other had a 740 bp deletion (Figure 1b). I subsequently proceeded with single cells dilution and obtained 23 clones. Of these clonal lines, 6 clones were analyzed with PCR and Sanger sequencing which confirmed heterozygous editing. To rule out the possibility that these clones contained a mixture of clonally derived cells, i.e. both WT cells and edited cells, I carried out a second round of single cells dilution starting from these 6 heterozygous clones. I obtained from 2 to 4 sub- clones for each clone. Again, the obtained sub-clones were screened for editing by PCR and Sanger sequencing as described before. Specifically, I identified three clones, derived from the same first round of single cells clone, to be compound heterozygous.

They presented two different mutations in the two separate alleles. Moreover, the rest of the clones were found to have the same heterozygous editing, consisting of an indel on one allele and the deletion on the other allele.

Third, screening of the iPSC bulk population edited for ZEB2 revealed editing

consisting of a homozygous 790 bp deletion. We made single cells dilution and

obtained 27 clones of these 3 clones were found to be homozygous for the 790 bp deletion (Figure 1c).

Finally, in the POLR2A targeted iPSC bulk population we identified editing at one gRNA site. From a round of single cells dilution, 27 clones were obtained, 7 of which were found to be heterozygous after screening with PCR and Sanger sequencing. More specifically, of these 7 heterozygous clones, 3 clones showed the 4 bp insertion (Figure 1), 1 clone presented a 7 bp deletion, 1 clone had a 7 bp insertion, 1 clone showed a 3 bp insertion and 1 bp deletion in one allele, and the last single clone had a 7 bp and 1bp insertion on one allele.

After completing the screening of these clones, we decided to proceed with

characterization of one of the ZEB2 K.O. iPSC line (ZEB2 K.O.23) and one of POLR2A

K.D. line (POLR2A K.D.2) with a 4 bp insertion.

Figure 1 Editing of iPSCs lines with CRISPR /Cas9 A) IPSC bulk population of SCN1A targeted line showed editing in exons 11 and 12, consisting of a 1550bp deletion. B) IPSCs clones of NCDN targeted line showed editing in exons 5 and 6, consisting of a 740 bp deletion. C) IPSCs clones ZEB2 targeted line showed editing in exons 5 and 6, consisting of 790 bp deletion. D) Three iPSCs clones of POLR2A targeted line showed editing in exon 2, consisting of a 4bp insertion.

3.2 Characterization of iPSC lines POLR2A K.D.2 and ZEB2 K.O.23.

Genome editing using CRISPR/Cas9 can potentially introduce genomic aberrations or alter gene expression pattern and cell behavior. Therefore, we assessed the quality of the iPS cell lines obtained following successful CRISPR/Cas9 editing. Cell lines were screened for potential editing at CRISPR/Cas9-OFF targets sites, analyzed for expression of pluripotency genes, differentiation potential, and genome integrity.

In order to assess CRISPR/Cas9 specificity, the above mentioned ZEB2 K.O.23 and

gRNA for editing as predicted by the CRISPR/Cas9 design tools. Off targets in the two iPSC lines were screened using PCR and Sanger sequencing and obtained sequences showed that CRISPR/Cas9 was highly specific as WT sequences were observed at off target sites (Figure 2a-c).

Secondly, to exclude the possibility of genome abnormalities, genome integrity of the

cell lines was assessed by G-banding. The karyotypes of the two edited cell lines were

found to be stable with 46, XY chromosomes (Figure 2d and 2e).

We proceeded with ZEB2 K.O.23 and POLR2A K.D.2 lines authentication by single tandem repeats (STR) analysis. Altogether 16 polymorphic sites were analyzed and compared between the CRISPR/Cas9 lines and the parental iPSCs Ctl10-I line. For both cell lines, the analyzed markers matched with the parental line Ctl10-1 (26).

Thus, these two lines were further characterized to assess their mRNA expression profiles and differentiation capacity, to subsequently be used in functional experiments.

Figure 2 Characterization of ZEB2 K.O. and POLR2A K.D. iPSCs lines A and B show sequencing of ZEB2 off target 1 and off target 2 sites respectively for gRNAs employed in editing ZEB2 using CRISPR/Cas9 technology. C shows sequencing of POLR2A off target site for gRNA employed in editing POLR2A using CRISPR/Cas9. All three off target sites (in red) were found unedited, i.e. showed WT sequence. D and E show pictures of G-banding karyotyping of ZEB2 K.O. and POLR2A K.D. iPSCs lines respectively, revealing normal karyotype (46,XY) for both cells lines.

3.2.1 Quality assessment using Flow cytometry and IF

Pluripotent properties of iPSC lines ZEB2 K.O.23 and POLR2A K.D. 2 were assessed

by analyzing the expression of pluripotency markers in the cell population with Flow

cytometry and IF. The majority of the cells were found to express surface markers

TRA-1-60 and SSEA-4 (Figure 3a and 3b), as well as transcription factors NANOG

and SOX2 (Figure 3c and 3d), which were analyzed using Flow cytometry and IF

respectively (paragraph 2.6 and 2.7).

Figure 3 Quality assessment of pluripotency A and B show graphs of expression of surface pluripotency markers, TRA-1-60 and SSEA4, in iPSCs POLR2A K.D.2 and ZEB2 K.O.23 cell populations respectivly, assesed with Flow cytometry. C and D show microscope pictures for IF staining of pluripotency markers SOX2 (green) and NANOG (red) for iPSCs POLR2A K.D. and ZEB2 K.O lines respectevly. Genomic DNA is stained with DAPI.

3.2.2 Pluripotency and differentiation potential analysis

To further evaluate the pluripotency of ZEB2 K.O. and POLR2A K.D. lines, we

analyzed their mRNA expression profiles using hPSCs Scorecard analysis (paragraph

2.9). The assay targets expression of stemness and self-renewal markers, as well as

differentiation marker directed towards ectoderm, mesoderm, and endoderm cell types

(29). Results revealed the iPSCs lines to be pluripotent and undifferentiated compared

to the reference set of 23 pluripotent stem cell lines (Figure 4a and b). Moreover, to

assess their ability to spontaneously differentiate into cell types representing the three

germ layers ectoderm, mesoderm, and endoderm, we performed an embryonic body

(EB) differentiation assay (paragraph 2.8). The expression profiles of differentiated

EBs were also analyzed with hPSCs Scorecard analysis. Results showed an

upregulation of markers specific of the three germ layers in comparison to the iPSC

lines (Figure 4c and d).

Figure 4 Scorecard analysis of iPSC line ZEB2 K.O.23 and POLR2A K.D.2 mRNA expression profiles. A and B Scorecard assay expression scores for ZEB2 K.O.23 and POLR2A K.D. 2 iPSC lines, respectively. C and D graphs represents expression profiles of EBs derived from ZEB2 KO and POLR2A KD iPSCs lines, respectively.

3.2.3 Mutation analysis using qPCR

Mutations in ZEB2 and POLR2A were further investigated with qPCR, targeting the

gene at the editing sites. Results show a significant reduction of ZEB2 mRNA

expression in ZEB2 K.O.23 line and a 20% reduction of POLR2A mRNA in POLR2A

K.D.2 compared to its isogenic control (Figure 5).

Figure 5 Expression of ZEB2 assessed with qPCR. A ZEB2 K.O.23 showed significant reduction of ZEB2 compared to the unedited parental line (Ctl10-1). B POLR2A K.D.2 showed a 20% reduction of POLR2A compared to parental line (Ctl10-1).

In summary, I conclude that the two generated iPSC lines ZEB2 K.O.23 and POLR2A K.D.2 have been successfully edited to yield a homozygous K.O. and a heterozygous K.D., respectively. Both lines proved to be pluripotent without any genomic aberrations.

3.3 POLR2A activity assay

With the aim to investigate an effect of POLR2A deficiency in the characterized knock down line, I used a qPCR based assay tracking the rate of mRNA transcription in the POLR2A K.D.2 line compared to its isogenic control (25). After inhibition of transcription with DRB, the cells were supplied with fresh culture media to allow transcription to restart. Cells were harvested at four time points (0, 10, 20 and 30 min).

Using real-time quantitative RT-PCR (qPCR), I measured expression of pre-mRNA of utrophin, a ubiquitously expressed cytoskeleton protein, at each time point. The deficient and isogenic control line behave similarly. More specifically, expression of Exon1-Intron1 junction started early and increased over the course of the experiment.

While Intron1-Exon2 and Exon3-Intron3 junction expressions remain low for the first 20 minutes, with an upregulation in the last ten minutes (Figure 6).

A B

Figure 6 Expression of Utrophin pre-mRNA in POLR2A deficient iPSCs line and its isogenic control A and B show expression of Utrophin pre-mRNA in control and POLR2A K.D.2 line respectively, over a time course of 30 minutes after treatment with DRB transcription inhibitor.

A B

3.4 Neural crest cell (NCC) differentiation of ZEB2 K.O.23 iPSC line

In order to study the possible impact of ZEB2 deficiency on neural crest differentiation, I chose to apply a 7 days directed differentiation protocol to generate NCC from iPSCs ZEB2 K.O.23 line and its isogenic control (26).

NCC were generated by Top-Down inhibition (TDi) of BMP4 signaling pathway for 7 days. Differentiation was assessed by following morphological changes of the cells in a bright field microscope. During the 7 days of treatment (paragraph 2.11) both cell lines changed morphologically. From compact colonies well defined by a border, typical of iPSCs, they assumed a cobble-stone form (Figure 7a and b). Differentiation appeared to happen similarly in both lines.

In order to further characterize differentiation events, the two lines were analyzed by IF targeting a pluripotency marker, NANOG, and a NCC marker SOX10. From IF staining, both cell lines seemed to express NANOG but failed to express SOX10 (data not shown).

Moreover, mRNA expression in the control and ZEB2 K.O.23 lines was analyzed at different time points, d0, d3, d5, d7, tracking the expression changes of iPSCs markers

The qPCR results showed a downregulation of markers characterizing pluripotency,

while and upregulation of PAX3 gene which is part of neural crest specification and

migration module (Figure 7c and d).

Figure 7 NCC differentiation from iPSCs A and B show microscope pictures of isogenic control and iPSCs ZEB2 K.O. line respectively, at different time points during the 7 days NCC generation protocol. C and D illustrate qPCR expression graphs for control and ZEB2 K.O. line, respectively.

4. Discussion

This study aimed to generate iPSC lines deficient for a set of genes involved in NDDs, using CRISPR/Cas9 technology. Four independent lines were successfully edited from a parental iPSCs line (26) for SCN1A, NCDN, POLR2A and ZEB2 genes. Previous studies revealed association of SCN1A variants to Dravet syndrome (DS), a disease characterized by epilepsy with infantile onset (13-16). SCN1A is a gene coding for the alpha 1 subunit of the sodium-voltage gated channel 1.1, and cell lines derived from a DS patients presenting heterozygous variants showed correlation with dysregulation of GABAergic neurons function (21). In order to further characterize phenotypic abnormalities related to SCN1A heterozygous variants, we generated an iPSCs line K.D.

for SCN1A from a healthy donor iPSCs line (26). In this way, we aim to avoid line-to-

line variations problems that can be encountered when using patients derived iPSCs

lines. After generating a SCN1A deficient line using CRISPR/Cas9 editing, results in

functional experiments from this line can be compared to a defined isogenic control

line. The advantage is that genetic background effects are eliminated. We successfully

obtained a bulk population of cells edited with CRISPR/Cas9 in only one allele, thus

considered a heterozygous variant. Such variant consists of a 1550 bp deletion, with

gRNAs cutting on Exon 11 and Exon 12. We attempted to clonally expand the

population through a single cell dilution, obtaining 21 clones. Screening of the clones

failed to give heterozygous variants and all derived clones showed the WT sequence.

This could be due to a mixed population in the bulk culture, with single cells WT clones more likely to survive compared to SCN1A K.O. clones. Moreover, screening methods, such as PCR profile and conditions, might bias bands amplification towards the WT sequence.

Second, mutations in NCDN gene, encoding Neurochondrin, have been linked with epilepsy display before, both in animal and human cells models (22–24). Although this cytoplasmatic protein seems to be involved in the regulation of CaMKII phosphorylation and mGluR5 signaling, how it participates in molecular networks needs further investigation. As pointed out, in order to study the effect of a single gene variant on phenotypic abnormalities, we need a defined isogenic control. Therefore, we edited the CTL10-1 iPSCs line, targeting Exon 5 and Exon 6 of NCDN. We obtained heterozygous variants having a 749 bp deletion on one allele and expanded the cells clonally with two rounds of single cells dilutions. After screening of the clones, I identified 3 clones as compound heterozygous and 11 clones presenting heterozygous variants. The first resulted to be edited in both alleles, presenting two different mutations, while the other clones showed an indel only in one allele. These NCDN K.D.

lines could be employed for further experiments to better understand the role of Neurochondrin on NDDs like phenotypes. Moreover, NCDN K.D. lines could be compared to an already established NCDN K.O. line (30) to highlight aspects of importance of Neurochondrin in regulation of specific molecular pathways. To be eligible for functional experiments, we need to assess the quality of the generated K.D.

lines in this study first. The mentioned iPSCs were not characterized because of time limits of the project.

Moreover, we successfully characterized one POLR2A K.D iPSCs line and one ZEB2 K.O. iPSCs line. More specifically, we generated POLR2A deficient iPSCs, using CRISPR/Cas9 with two gRNAs targeting Exon 2 and Exon 5. From a round of single cells dilution, we obtained 20 WT clones and 7 heterozygous clones. GRNA2 failed to cut Exon 5 and mutations were introduced only by gRNA1 in Exon 2. We observed that the cell line presented a SNPs in the targeted position in Exon 5; therefore we hypothesized that this SNPs in Exon 5 might cause gRNA2 to not bind. Moreover, no identification of homozygous variants for POLR2A edited iPSCs line finds a possible explanation within POLR2A gene function. POLR2A encodes RPB1 subunit of RNA pol II, and it is directly related to rate of transcription. Decreased transcription rate has been observed in presence of de novo heterozygous variants (14). Lethality of slow transcription rate has been studied in mouse ESCs POLR2A knock out lines (31).

Indeed, pluripotent stem cells requires a high level of transcripts for population expansion. Undifferentiated cells that are dividing fast are found in a hypertranscriptional state. What maintain this state and allow the production of high level of RNA are the right chromatin structure and functional RNA pol (32). We therefore assume that the lack of homozygous variants for POLR2A edited iPSCs lines might be caused by the low chance of survival.

Furthrmore, upon generation of ZEB2 edited iPSCs lines, we only obtained homozygous K.O. clones. From a first round of single cells dilution, we derived 27 clones. We identified a 790 bp deletion on both alleles for 3 clonal lines. The screening of the remaining clones only showed WT variant. We hypothesized that lack of ZEB2 K.D. clones is due to bias in amplification with PCR towards one sequence. To solve this issue, primers binding inside the deleted sequence could be employed on previously identified homozygous clonal lines. These primers will screen for only WT sequence;

therefore, amplification will be detected only in heterozygous clones.

We decided to proceed with characterization of two iPSCs lines deficient for genes associated with transcriptional network. Indeed, the Niklas Dahl group had previously studied gene dysregulation in patients derived iPSCs lines (13). More in specific, they focused on cell lines derived from patients affected by Mowat-Wilson syndrome with

of POLR2A. Therefore, we chose to assess the quality of one POLR2A K.D.2 iPSCs line with a 4bp insertion in Exon 2, likely inactivating function of the polr2a protein derived from this allele, and one ZEB2 K.O.23 iPSCs line with a 790 bp deletion between exon 5 and 6, completely abolishing ZEB2 expression.

Characterization of CRISPR/Cas9 edited iPSCs lines is necessary to ensure the quality of the cell lines on different levels. First, screening of gRNAs off target sites is needed to evaluate CRISPR/Cas9 specificity. Second, it rules out the possibility of additional unwanted mutations that could create a genetic background different from the isogenic control and it might interfere with specific experimental questions. Off-target editing was excluded in both POLR2A and ZEB2 deficient lines, allowing us to further characterize the cell lines.

One drawback of reprogramming as well as CRISPR/Cas9 editing and subsequent cell maintenance culture is the possible accumulation of genome abnormalities. We investigated genome integrity with G-banding karyotyping, revealing the absence of genetic aberrations for both cell lines. We followed up with STR analysis for the authentication of the lines relative to the isogenic unedited parental line. STR profiles were found to be identical to the parental line CTL10-I.

To evaluate the quality of the generated lines as pluripotent stem cells, we need to assess pluripotency and differentiation potential. Flow cytometry and IF revealed expression of surface pluripotency markers (SSEA-4 and TRA-1-60), and self-renewal markers (SOX2 and NANOG) in most of the cell population for both POLR2A K.D.2 and ZEB2 K.O.23 lines. IPSCs and EBs expression profiles were analyzed to further guarantee the undifferentiated state of the line and their ability to differentiate towards the three germ layers. For both derived cell lines, iPSCs were undifferentiated and upregulation of germ layers markers was identified for EBs relative to iPSCs profile. In this way we were able to guarantee the generated cell lines as iPSCs can serve as unlimited source of biological material and can be directly differentiated into any cell type.

Once POLR2A K.D.2 and ZEB2 K.O.23 lines were fully characterized, I investigated possible effects of the respective gene’s deficiency. As mentioned before, POLR2A dysfunctional variants results in a slower transcription rate compared to WT (14,31).

To test possible changes in transcriptional rate caused by POLR2A heterozygous variant, I performed an activity assay (25). By inhibiting phosphorylation of elongation transcription factor Spt5 and CTD domain of RNA pol II using DRB, transcription elongation is blocked. Following the removal of the inhibitor, the expression of exon- intron junctions of Utrophin gene pre-mRNA was measured with qPCR in a time- course manner. The isogenic control line was expected to be faster in transcribing compared to the POLR2A deficient line. As observed in mouse ESCs with a slow RNA pol II mutation (31) expression rates of early exon-intron junctions are similar between WT and K.D. line. I could not therefore conclude a clear effect of POLR2A deficiency on transcription rate. However, the experiment should be repeated in technical replicates with investigation of later exon-intron junctions’ expression and measurements at more time points. This was not carried out in the project because of time limitations, but could make the assay more informative.

Finally, to investigate effects of ZEB2 deficiency in the generated and characterized

line, I proceeded with generation of NCC. ZEB2 codes for a transcription factor of zinc-

finger protein family, and both repress and promote transcription. ZEB2 has been described to induce generation of a set of brain cells, such as cortical interneurons, glia cells and neural crest cells (7,33). To observe differences in NCC directed differentiation between ZEB2 K.O.23 line and its isogenic control, I employed a 7 days protocol for BMP signaling inhibition (34). Both ZEB2 K.O.23 and control line changed their morphology into a cobble stone like form, typical of NCC. To assess how the expression profiles changes upon NCC differentiation, I performed a time course qPCR (day 0, 3,5, and 7) for both lines. Expression profiles of ZEB2 K.O.23 and control line seemed to behave similarly. Pluripotency markers SOX2 and NANOG were downregulated suggesting cells were differentiated successfully. NCC marker PAX3 was upregulated in both lines. Expression of transcription factor PAX3, is usually identified in premigratory neural crest cells (35). Expression of the other two NCC marker NGFR and SOX10 decreased during the time course of differentiation. A possible explanation for the failed expression of SOX10 could be accidental mistakes in the treatment of the cells. Indeed, not supplementing the culture media with optimal amount of DMH1 inhibitor of BMP type 1 receptor, and only adding BMP4- could lead to expression of PAX3 only and failed induction of SOX10 expression (34). CDH1 and

craniofacial development. CDH1 regulated craniofacial development through anaphase-promoting complex APC ubiquitination and activation of transcription factor Goosecoid (Gsc) (36). Since ZEB2 K.O.23 behaved similarly to its isogenic control in the time course of NCC differentiation, treating the cells for a longer time period could reveal differences and therefore an effect in ZEB2 deficiency. Additionally, given time limitations, the experiment was performed only once; thus, repeating the experiment in replicates could be more informative as well. As an alternative way to look into transcriptome differences, a transcriptomics approach, investigating global gene expression could be interesting for future studies in finding gene expression deviations.

In conclusion generated ZEB2 and POLR2A deficient iPSCs lines edited with CRISPR/Cas9, have been successfully characterized. They can find applications in disease models for NDDs, such as Mowat-Wilson Syndrome. As iPSCs, they offer an unlimited source of biological material. Moreover, directing differentiation starting from iPSCs, gives the possibility to study events during the differentiation process, which is not possible if we were to reprogram somatic cells into i.e. neurons.

Specifically, these two edited clones, offer a promising model system to investigate and highlight disrupted transcriptional network, often characterizing genetics behind the onset of neurodevelopmental disorders.

Acknowledgments

I would like to thank Prof Niklas Dahl, who allowed me to be part of his group for my

Degree Project and who was always engaging me in weekly discussions and provided

me suggestions to problems I encounter during experiments. I’m also grateful for my

supervisor Jens Schuster, who guided me throughout the entire project, helping with

any doubts and difficulties I had. Finally, I would like to thank Ambrin Fatima, who,

even for a short time period, helped me when I first start this project.