IFM, Department of Physics, Chemistry and Biology
Master Thesis
Expression pattern of GPI-anchored non-specific lipid
transfer proteins in Physcomitrella patens
Andrey Höglund
LiTH-IFM- Ex-- 11/2427--SE
Supervisor: Johan Edqvist, Linköpings universitet
Examiner: Jordi Altimiras, Linköpings universitet
Department of Physics, Chemistry and Biology Linköpings universitet
Rapporttyp Report category Licentiatavhandling x Examensarbete C-uppsats x D-uppsats Övrig rapport _______________ Språk Language Svenska/Swedish x Engelska/English ________________ Titel Title:
Expression pattern of GPI-anchored non-specific lipid transfer proteins in Physcomitrella patens
Författare
Author: Andrey Höglund
Sammanfattning
Abstract:
During the water-to-land transition, that occurred approximately 450 MYA, novel habitats were revealed to the emerging plants. This terrestrial habitat was a harsh environment compared to the aquatic, with shifting substrate content, irregular supply of water, damaging UV-radiation and rapid fluctuating temperatures. Non-specific lipid transfer proteins (nsLTP) are today only found in the land living plants and not in the green algae. This suggests that these genes might have evolved to help the plants cope with the stressful conditions. In this study the expression pattern has been analysed of the nsLTPs in the moss Physcomitrella patens during the possible conditions that raised during the water-to-land transition. The moss was exposed to salt, UV-B, drought, copper, cold and osmotic stress. Quantitative real-time PCR was used to analyse the transcription levels. I found that six genes were upregulated during either cold, dehydration or UV-B stress. This suggest that these genes are involved in the plant defense against these abiotic stresses
ISBN
LiTH-IFM- Ex-- 11/2427--SE
__________________________________________________ ISRN
__________________________________________________
Serietitel och serienummer ISSN
Title of series, numbering
Handledare
Supervisor: Johan Edqvist Ort
Location: Linköping
Nyckelord
Keyword:
Abiotic stress, lipid transfer proteins, moss, nsLTP, Physcomitrella patens, qRT-PCR Datum Date 2011-06-03
URL för elektronisk version
Avdelning, Institution Division, Department
Avdelningen för biologi
Content
1 Abstract ... 1
2. List of abbreviation ... 1
3. Introduction ... 1
4. Materials and methods... 2
4.1 Plant material and growth conditions ... 2
4.2 Abiotic stresses ... 3 4.3 mRNA extractions ... 3 4.4 cDNA synthesis ... 3 4.5 Quantitative real-time PCR ... 4 4.6 Bioinformatics ... 4 5. Results ... 5 5.1 Quantitative real-time PCR ... 5 5.2 Phylogenetic tree ... 9 6. Discussion ... 11 6.1 Abiotic stresses ... 11 6.2 Phylogenetic tree ... 12 7. Acknowledgement ... 13 8. References ... 14
1 Abstract
During the water-to-land transition, that occurred approximately 450 MYA, novel habitats were revealed to the emerging plants. This terrestrial habitat was a harsh environment compared to the aquatic, with shifting substrate content, irregular supply of water, damaging UV-radiation and rapid fluctuating temperatures. Non-specific lipid transfer proteins (nsLTP) are only found in the land living plants and not in the green algae. This suggests that these genes might have evolved to help the plants cope with the stressful conditions. In this study the expression pattern has been analysed of the nsLTPs in the moss Physcomitrella patens during the possible conditions that raised during the water-to-land transition. The moss was exposed to salt, UV-B, drought, copper, cold and osmotic stress. Quantitative real-time PCR was used to analyse the transcription levels. I found that six genes were upregulated during either cold, dehydration or UV-B stress. This suggest that these genes are involved in the plant defense against these abiotic stresses
Keywords: abiotic stress, lipid transfer proteins, moss, nsLTP, Physcomitrella patens, qRT-PCR
2. List of abbreviation LTP – lipid transfer protein
nsLTP – non-specific lipid transfer protein GPI-anchor - glycosylphosphatidylinositol PCR – polymerase chain reaction
qRT-PCR – quantitative real-time polymerase chain reaction 3. Introduction
Around 450 million years ago, during the Ordovician period, the first land plants started to colonize the terrestrial habitats (Zimmer et al., 2007). This water-to-land transition opened up new environments but also revealed novel stresses such as shifting substrate content, irregular supply of water, damaging UV-radiation and rapid fluctuating temperatures to the emerging plants (Rensing et al., 2008). The first layer of defense between the plants and these environmental stresses is the cuticle. This non-living hydrophobic structure covers the aerial part of the plant and prevents non-stromatal water loss, provides mechanical strength, protects the plants from environmental stresses and serves as a protective barrier against pathogens (Schweizer et al., 1996; Baker et al., 1982; Riederer, 2006). The main structural component of plant cuticle is a polyester matrix called cutin (Jeffree, 2006). DeBono et al. (2009), showed that in Arabidopsis thaliana the gene At1g27950, which is a member of the lipid transfer protein (LTP) family, is required for cutin transport. The actual mechanism that exports the synthesized waxes from the plasma membrane through the aqueous cell wall to the aerial part of the plant is unknown (Samuels et al., 2008).
LTPs have been discovered in a wide range of organisms, from bacteria and yeast to animals and higher plants (Rueckert and Schmidt, 1990). Some LTPs are specific for certain lipids while other lacks specificity and affinities various lipids. No matter specificity, plant non-specific LTPs (nsLTP) shares no amino acid sequence similarity to animal LTP (Han et al., 2001). Plant nsLTPs have a hydrophobic cavity built up by four or five α-helices which are stabilized by four disulfide bridges formed by an eight cysteine residues with the characteristic form C-Xn-C-Xn-CC-Xn-CXC-Xn-C-Xn-C. The in vitro functions of nsLTPs
are the capable of binding fatty acids (Kader, 1996). Additionally, nsLTPs are extracellular proteins with a size of ~10 kD which makes them small enough to pass through the pores of the plant cell wall (Zachowski et al., 1998; Yeats and Rose, 2008). Other reports have shown that in A. thaliana the gene DIR1, a nsLTP, is involved in long-distance signaling and even plant defense against pathogens (Maldonado et al., 2002).
As a post-translational modification, glycosylphosphatidylinositol (GPI) anchors are added to some nsLTPs (DeBono et al., 2009). The GPI-anchors attach to the plasma membranes and allow the connected protein to face the extracellular side of the membrane, which make them important for cell wall organization and function (Gillmor et al., 2005). In P. patens ten nsLTP genes with GPI-anchor (type G) are found, while in seed plants the number is greater (Edstam et al., 2011). Additionally, Edstam et al., (2011) showed that plant LTPs are only present in land plants, and not found in chlorophyte and charophyte green algae. It is a fair assumption that the LTPs have evolved early during the water-to-land transition and might be involved in protection of the plants to these novel stresses. Thus, by understanding their function, an insight into how plants cope with abiotic stresses can be established.
The moss P. patens is a great candidate organism for studying plant evolution. The mosses are believed to be the earliest land plants in evolutionary terms (Wang et al., 2010). Additionally, they share many features with seed plants, e.g. signaling pathways. Fossil evidence has shown that the early land plants have changed very little morphological compared to present moss (Kenrick and Crane, 1997). Moreover, the P. patens has been sequenced and is a model organism (Lang et al., 2008).
The purpose of this study was to investigate whether nsLTP type G genes in P. patens are involved in plant defense during abiotic stresses. The experiments were conducted on genes
PpLTPg1, PpLTPg2, PpLTPg3, PpLTPg4, PpLTPg5 PpLTPg6, PpLTPg7, PpLTPg8, PpLTPg9 and PpLTPg10, annotated by (Edstam et al., 2011). During the experiments the
moss was exposed to freezing, salt, osmosis, drought, plant hormones, toxic ions or UV-B radiation stresses. Quantitative real-time PCR (qRT-PCR) was used to analyze the transcript levels of the genes of interest. The relationship between the genes was established by generating a phylogenetic tree.
4. Materials and methods
4.1 Plant material and growth conditions
Physcomitrella patens strain Gransden 2004 was obtained from Mattias Thelander at Swedish
University of Agricultural Sciences (SLU) in Uppsala and was grown in solidified 1% (w/v) BCDAT medium (250 mg/l MgSO4 7H2O, 250 mg/l KH2PO4 adjusted pH to 6.5 with KOH,
1010 mg/l KNO3, 12.5 mg/l FeSO4 7H2O, 921 mg/l ammonium tartrate (Fluka, St. Louis,
Missouri), 147 mg/l CaCl2 2H2O and 10 g agar) on 9 cm petri dishes enclosed with micro
pore film. They were cultivated in a growth chamber (Percival Intellius, CLF, Plant Climatics) at 25 oC with 24 h light period in 6000 Lux.
4.2 Abiotic stresses
The experiments were carried out on three to four-weeks-old gametophytes. Two different substrates were used, liquid- and solid BCDAT medium during the stresses. The stresses in the liquid BCDAT medium were conducted with either plant hormone; 50 µM abscisic acid (ABA) (Sigma Aldrich, St. Louis, Missouri), salt; 350 mM NaCl (Scharlau, Barcelona, Spain), osmosis; 600 mM mannitol (Sigma) and toxic ions; 100 µM CuSO25H2O (Merck,
Darmstadt, Germany), respectively. The gametophytes were shredded with a disperser (IKA T18 basic, Ultra-Turrax) to increase the surface area, mixed with the respective growth medium and incubated in growth chamber (Percival Intellius) at 25 oC with 24 h light period in 6000 Lux on a shake table (Edmund Bühler GmbH, KS-15) at 175 rpm. The stress conducted with ABA, copper and mannitol were treated for 24 h, and the salt stress for 3 h. For the UV-B radiation, cold and dehydration stress solid BCDAT medium was used. The B stress was imposed by placing the petri dish upside-down, without the lid, on a UV-table (Spectroline, Bi-o-vision UV/White light transilluminator) at 315-280 nm for 1 h. The cold stress was imposed by placing the petri dish on ice for 48 h in 5000 Lux. Finally, the dehydration was imposed by removing the lid of the petri dish for 24 h, while keeping the petri dishes inside the growth chamber (Percival Intellius) at 25 oC with 24 h light period in 6000 Lux. For each stress type three replicates were used, all treated independently. Moreover, controls from both solid and liquid moss cultures were made. The RNA concentrations were measured in a spectrophotometer (NanoDrop ND-1000, Spectro-photometer, Thermo Scientific).
4.3 mRNA extractions
Total RNA was extracted from gametophytes using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany), according to the protocol of the manufacturer. 100 mg plant tissue was used for each sample. The plant tissues were grinded in liquid nitrogen before isolation of RNA. Prior to RNA isolation for the mosses in the liquid BCDAT medium the mosses were pressed between two filter papers to remove excess liquid before weighted. The purified RNA was treated with DNaseI, for each 1 µg RNA 1 µl reaction buffer containing MgCl2 and DNaseI
1 u (Invitrogen, Carlsbad, CA, USA) was used. The samples were incubated at 37 oC for 30 min, followed by addition of 1 µl 25 mM EDTA (Invitrogen) and incubation at 65 oC for 10 min. The RNA integrity was checked on a 1.2% (w/v) agarose gel containing ethidium bromide.
4.4 cDNA synthesis
The first strand cDNA was synthesised with RevertAid Reverse Transcriptase (Fermentas, Burlington, Canada), which was performed in a 20 µl reaction mixture containing 1 µg RNA, 0.2 µg random hexamer (Invitrogen), 5X reaction buffer, 1 mM dNTP mix and 200 u RevertAid M-MuLV Reverse Transcriptase (Fermentas). The sample was mixed briefly and incubated at 25 oC for 10 min, followed by incubation at 42 oC for 60 min. The cDNA synthesis was terminated by heating the mixture to 70 oC for 10 min. The cDNA concentrations were measured in a spectrophotometer (NanoDrop ND-1000, Spectrophotometer, Thermo Scientific).
4.5 Quantitative real-time PCR
The genes expression levels was analyzed with quantitative real-time PCR (qRT-PCR). For each qRT-PCR reaction 400 ng cDNA was used, and was performed in a 25 µl reaction mixture containing 10 µM forward primer, 10 µM reverse primer (Invitrogen) and 12,5 µl Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA). The primers used for PCR are given in Table 1. The PCR program (performed in Rotor-Gene 6000, Corbett Research) consisted of a initial polymerase activation step of 10 min at 95 oC, followed by 40 cycles of 95 oC for 15 s (denaturation and extension) and 55 oC for 60 s (annealing), and finished by a gradual melting step from 50 oC to 99 oC, 1 oC each second. For each primer pair a standard curve was made with the following amounts of cDNA [ng/reaction]: 400, 200, 100, 50, 25, 12.5, 6.25 and 0 (no template control). The standard curves were used to calculate the amplification efficiency of the primer pairs. Reactions were performed in triplicates from three RNA samples extracted independently from separate biological replicates. The genes expression levels were normalized to the housekeeping gene PpTUB1, encoding beta-tubulin 1. PpTUB1 was previously assessed to display a consistent amplification during circadian rhythmicity in P. patens (Holm et al, 2010). The software Relative Expression Software Tool (REST, http://www.gene-quantification.de/rest.html) was used to analyze the expression levels. The statistical test applied was a randomization test (permutation test). All settings were left as default, except for the number of randomizations, which was set to 6000.
4.6 Bioinformatics
The genomic sequences used to build a phylogenetic tree were taken from the US Department of Energy Join Genome Institute’s homepage (http://genome.jgi-psf.org/). Complete genome and ESTs sequences are available for P. patens. The genes used were PpLTPg1, PpLTPg2, PpLTPg3, PpLTPg4, PpLTPg5, PpLTPg6, PpLTPg6, PpLTPg7, PpLTPg8, PpLTPg9, PpLTPg10, PpLTPd11, PpLTPd12, PpLTPd13 and PpLTPd14. The PpLTPd-genes served as an outgroup. Multiple alignments were performed with the ClustalW method (Thompson et al., 1994), using ClustalW2 (http://www.ebi.ac.uk/Tools/msa/clustalw2/). All settings were left as default, except ‘Gap extension penalty’, which was set to 0.05. The eight-Cystine motif with additionally 3 amino acids on opposite ends (X3-C-Xn-C-Xn-CC-Xn-CXC-Xn-C-Xn
-C-X3), was used for alignments for each gene. The Maximum Likelihood phylogenetic tree was constructed using PhyML 3.0 (http://www.atgc-montpellier.fr/phyml/) (Guindon et al., 2010). All settings were left as default, except bootstraping, which was set to 100 replicates. The tree was visualized in the program FigTree v1.3.1 (http://tree.bio.ed.ac.uk/software/figtree/).
Table 1. The primers used for the qRT-PCR. Both amplicon size and primer efficiency are shown. Primers for PpLTPg1 and PpLTPg10 did not work, thus no efficiency was calculated.
Name Gene Sequence (5’ 3’) Primer eff. (%) Amplicon size (bp)
PpLTPg1 forward Pp65746 TACTGGGAGAACCCATCTCG PpLTPg1 reverse Pp65746 ACCAGATGAAGCTGGGAGAA - 172 PpLTPg2 forward Pp111116 CGCCATGTTTAGCGTATGTG PpLTPg2 reverse Pp111116 ATCTCGTGGCAATGAGAAGG 83 170 PpLTPg3 forward Pp163050 CCAAAGTGTTAGCCCTTCCA PpLTPg3 reverse Pp163050 AAGTCGGGAAACATCATTCG 79 155 PpLTPg4 forward Pp163905 GATGCTTCCAAGTGCACAGA PpLTPg4 reverse Pp163905 ACCACAGGTGGAGAAACTGG 100 158 PpLTPg5 forward Pp168261 GCAACTCCGACAGCTACTCC PpLTPg5 reverse Pp168261 GCAGCAGTCGGTACTTGGTT 95 186 PpLTPg6 forward Pp170287 GTTCCTCCCACCATGTTCAC PpLTPg6 reverse Pp170287 AAGAAGGAGGAGAGGGACCA 92 163 PpLTPg7 forward Pp171728 AGAGAACCGGTTTGCATCTG PpLTPg7 reverse Pp171728 AGGACTGAAGGGTGATGGTG 93 183 PpLTPg8 forward Pp217301 ACTCCTCCTGCAATGTCACC PpLTPg8 reverse Pp217301 GCCATTGGAGAACTCTCTGG 88 179 PpLTPg9 forward Pp234183 TGCTTCGAGTACGTGACAGG PpLTPg9 reverse Pp234183 GGAAGGCTCAAACCTTTGGT 83 170 PpLTPg10 forward Pp172621 CGAAGTACATGGCGGTGAAT PpLTPg10 reverse Pp172621 TACACATGAAGCCGGTGGAG - 257 PpTub1 forward PpTUB1 GACTGCTTGCAAGGTTTCCAAG
PpTub1 reverse PpTUB1 GTTCAAGTCGCCAAACGAAGGA 93 297
5. Results
5.1 Quantitative real-time PCR
In order to investigate the expression patterns of nsLTP type G genes, wild-type P. patens was exposed to several abiotic stresses (salt, ABA, drought, cold, copper, UV-B or osmotic stress) The expression of PpLTPg1, PpLTPg2, PpLTPg3, PpLTPg4, PpLTPg5, PpLTPg6, PpLTPg7, PpLTPg8, PpLTPg9 and PpLTPg10 were analyzed with qRT-PCR. All plants appeared to grow normally during the experiments, except the moss that was exposed to the UV-B radiation, which appeared brownish after treatment. During RNA extractions one replicate of salt, ABA and control (solid) were probably contaminated with RNases. These contained too low RNA levels to synthesis cDNA from. Additionally, the cDNA level from one of the cold stress replicates was too low to serve as template for qRT-PCR. Hence, only two replicates instead of three were used for qRT-PCR of salt stress, ABA stress, control (solid) and cold stress. The primers for the genes PpLTPg1 and PpLTPg10 showed no amplification, and were not used for the qRT-PCR. For the other primers the amplification efficiency was calculated (table 1). After the qRT-PCR was performed the Ct values for one dehydration sample and one control (liquid) sample deviated by more than 23% from the other two samples in the triplicate, and were not taken into account for the analysis.
For the UV-B radiation stress PpLTPg6 was significantly upregulated (p<0.05) by a ratio of 4, while PpLTPg4, PpLTPg5 and PpLTPg9 was significantly downregulated (p<0.05) 1/8, 1/5 and 1/2 of the control, respectively (fig. 1). The other genes displayed no significant variation in their transcription level.
Figure 1. qRT-PCR analysis of the B radiation treatment. The moss was exposed to UV-light for 1 h. The y axis indicate the ratio compared to the control samples, where 1 is the control. The error bars represent standard errors. The asterix (*) represent significance of p<0.05, calculated with randomization test.
During the cold stress the genes PpLTPg3, PpLTPg8 and PpLTPg9 was significantly upregulated (p<0.05) by a ratio of 2, 2 and 5, respectively, while PpLTPg7 was significantly downregulated (p<0.05) 1/2 of the control (fig. 2). The other genes displayed no significant variation in their transcription level.
Figure 2. qRT-PCR analysis of the cold treatment. The moss was exposed to cold (put on ice) for 48 h. The y axis indicate the ratio compared to the control samples, where 1 is the control. The error bars represent standard errors. The asterix (*) represent significance of p<0.05, calculated with randomization test.
During the dehydration stress the genes PpLTPg2, PpLTPg4 and PpLTPg6 was significantly upregulated (p<0.05) by a ratio of 8, 10 and 8, respectively (fig. 3). The gene PpLTPg8 had only one sample that gave a Ct value, this might have been due to a calculation error or pipet error. The software REST could not calculate any ratio values for that gene. The other genes displayed no significant variation in their transcription level.
Figure 3. qRT-PCR analysis of the dehydraitona treatment. The moss was exposed to dehydration for 24 h by removing the lid on the petridishes. Only one Ct value for the gene PpLTPg8 could be calculated, the software REST requires atleast two. No expression ratio was calculated for that gene. The y axis indicate the ratio compared to the control samples, where 1 is the control. The error bars represent standard errors. The asterix (*) represent significance of p<0.05, calculated with randomization test.
For the salt stress all the genes were significantly downregulated (p<0.05), PpLTPg2 1/4 of the control, PpLTPg3 1/11 of the control, PpLTPg4 1/12 of the control, PpLTPg5 1/5 of the control, PpLTPg6 1/2 of the control, PpLTPg7 1/27 of the control, PpLTPg8 1/3 of the control and PpLTPg9 1/2 of the control (fig. 4).
Figure 4. qRT-PCR analysis of the salt treatment. The moss was exposed to salt concentration of 350 mM in liquid medium for 3 h. All the genes were downregulated. The y axis indicate the ratio compared to the control samples, where 1 is the control. The error bars represent standard errors. The asterix (*) represent significance of p<0.05, calculated with randomization test.
The stress with copper showed a significant downregulation of the genes PpLTPg2, PpLTPg3, PpLTPg4, PpLTPg5, PpLTPg6, PpLTPg7 and PpLTPg9 (p<0.05) 1/2, 1/9, 1/3, 1/18, 1/3, 1/12 and 1/6 of the control, respectively (fig. 5). The gene PpLTPg8 displayed no significant variation in its transcription level.
Figure 5. qRT-PCR analysis of the copper treatment. The moss was exposed to copper concentration of 100 µM in liquid medium for 24 h. The y axis indicate the ratio compared to the control samples, where 1 is the control. The error bars represent standard errors. The asterix (*) represent significance of p<0.05, calculated with randomization test.
During the ABA stress the genes PpLTPg3 and PpLTPg8 was significantly downregulated (p<0.05) 1/21 and 1/6 of the control, respectively (fig. 6). The other genes displayed no significant variation in their transcription level.
Figure 6. qRT-PCR analysis of the ABA treatment. The moss was exposed to ABA concentration of 50 µM in liquid medium for 24 h. The y axis indicate the ratio compared to the control samples, where 1 is the control. The error bars represent standard errors. The asterix (*) represent significance of p<0.05, calculated with permutation test.
Figure 7. qRT-PCR analysis of the osmotic treatment. The moss was exposed to mannitol concentration of 600 mM in liquid medium for 24 h. The y axis indicate the ratio compared to the control samples, where 1 is the control. The error bars represent standard errors. The asterix (*) represent significance of p<0.05, calculated with randomization test.
5.2 Phylogenetic tree
A phylogenetic tree was constructed with the maximum likelihood method from type G nsLTPs in P. patens. Four type D nsLTP genes served as an outgroup (fig. 8). The green lines indicate the type G genes, while the red lines indicate the type D genes. PpLTPg2, PpLTPg3, PpLTPg4, PpLTPg6, PpLTPg8 and PpLTPg9 all seem to share a common origin, while PpLTPg1, PpLTPg5, PpLTPg7 and PpLTPg10 seem to share a different common origin. Interestingly, the genes PpLTPg2, PpLTPg3, PpLTPg4, PpLTPg6, PpLTPg8 and PpLTPg9, who all were upregulated in some of the abiotic stresses, are all found in the same branch (area A in fig. 8). The sub-branch with PpLTPg4 and PpLTPg8 was upregulated during dehydration and cold stress, respectively (area B in fig. 8). The sub-branch with PpLTPg2 and PpLTPg6 were both upregulated during dehydration, and PpLTP6 was additionally upregulated during UV-B radiation stress (area C in fig. 8). The sub-branch with PpLTPg3 and PpLTPg9 were both upregulated during cold stress (area D in fig. 8).
Figure 8. Phylogenetic tree constructed with the maximum likelihood method. PpLTPd genes constitute the outgroup, marked with red lines. The green lines indicate the PpLTPg genes. Rectangle A indicates the genes that were upregulated during any of the abiotic stresses. The sub-branch in rectangle B contains PpLTPg4 and PpLTPg8 that were upregulated during dehydration and cold stress, respectively. The sub-branch in rectangle C contains PpLTPg2 and PpLTPg6 that were upregulated during dehydration stress, PpLTPg6 was additionally upregulated during UV-B radiation stress. The sub-branch in rectangle D contains PpLTPg3 and PpLTPg9 that were both upregulated during cold stress. The numbers on the axis represents the bootstrap values.
B
C D
6. Discussion
In this study wild-type P. patens was exposed to various abiotic stresses, such as dehydration, UV-B radiation, copper, ABA, cold, salt and osmotic stress. The prediction was that nsLTP type G genes would be upregulated during some of the abiotic stresses, thus playing a role in the protective mechanisms against the stressful conditions.
6.1 Abiotic stresses
The UV-B radiation is believed to have been significantly higher during the water-to-land transition period than today. Hence, the plants emerging must have evolved protective mechanisms that should be present in all land plants today (Wolf et al., 2010). The transcription levels of phenolic compounds like flavonoids are induced by UV-B radiation, and have been seen accumulating in the epidermal cells (Rozema et al., 1997). These flavonoids are able to absorb UV-radiation. For the UV-B radiation stress the qRT-PCR results showed a significant upregulation for PpLTPg6 (fig. 1), which perhaps aids in the transport of the phenolic compounds to the epidermal cells.
Cold stress affects the plants development and growth due to metabolic reactions being inhibited. One specific process is the photosynthesis that is retarded by downregulation of important proteins during cold stress (Wang et al., 2009). Additionally, the cold-signaling pathway in P. patens has been shown to be ABA-independent, compared to higher plants that are ABA-dependent. That is, cold treatments do not increase ABA concentrations in
P. patens. (Minami et al., 2005). For the cold stress the qRT-PCR results showed a significant
upregulation for PpLTPg3, PpLTPg8 and PpLTPg9, and downregulation for PpLTPg7 (fig. 2). The upregulation suggest an involvement in the cold signaling pathway. Nagao et al., (2005) have shown that ABA induces increased sucrose concentrations that functions as a protectant during freezing. However, ABA is not increased during cold stress, thus the upregulated genes might play a role in the increased sugar concentrations. The downregulation points to an involvement in metabolic reactions, perhaps photosynthesis. Moreover, P. patens is a very salt tolerant plant, while A. thaliana is severely impaired by 100 mM NaCl (Sunkar et al., 2003), P. patens is able to withstand concentrations of over 300 mM (Wang et al., 2008; Frank et al., 2005). The salt concentration in this study was set to 350 mM, which is the recovery threshold (Frank et al., 2005). For the salt stress the qRT-PCR results showed that all the nsLTP type G genes were seen significantly downregulated (fig. 4), suggesting that these genes are not involved in Na+ regulation in P. patens. The moss is also tolerant to copper, compared to other mosses like Mielichhoferia elongate (Sassmann et al., 2010), which belongs to a group of specialists found on habitats with high copper concentrations (Hartman, 1969). For the copper stress the qRT-PCR results showed that all genes except PpLTPg8 were significantly downregulated (fig. 5), suggesting that the nsLTP type G genes are not involved in Cu+ regulation.
During the dehydration stress all genes, except PpLTPg8, were seen upregulated, but only PpLTPg2, PpLTPg4 and PpLTPg6 were significant (fig. 3). This finding suggests that some nsLTP type G genes might play a role in the desiccation protection in P. patens. Bryophytes in general are very tolerant to dehydration. By being haploid most of their life cycle and lacking a long-distance conducting system, bryophytes have a different strategy for drought adaptation compared to vascular plants (Mauseth, 2003). Their survival strategy is called poikilohydry, where bryophytes lose most water in their tissue during scarce water conditions,
and are able to rapidly take up water when present, without any significant damage (Takezawa et al., 2011). This type of strategy tolerance is likely an evolutionary adaptation that land plants acquired during the water-to-land transition (Oliver et al., 2005).
For the ABA stress PpLTPg3 and PpLTPg8 were significantly downregulated (fig. 6), while for the osmotic stress all genes were significantly downregulated except PpLTPg2 (fig. 7). Other studies have shown that ABA biosynthesis is upregulated by high salinity, desiccation (Richardt et al., 2010) and osmotic stress (Minami et al., 2005). Obviously, both desiccation and high salinity can cause osmotic stress, indirectly. Additionally, previous data have showed that ABA inhibits photosynthesis in rice (Rakwal and Komatsu, 2004) and in
P. patens (Wang et al., 2010) by downregulation of proteins involved in the photosynthesis.
The only observed correlating results between the ABA stress, salt stress and the osmotic stress was the downregulation of PpLTPg3 and PpLTPg8. These results suggest that PpLTPg3 and PpLTPg8 might be connected to the process of photosynthesis, and are downregulated to protect the plant. Why dehydration did not show any downregulation might be explained by the fact that in bryophytes are poikilohydric, and their leaves only have cuticle on the upper side. This makes it possible for the moss to absorb water through the lower part of the leaves, without any roots or stomata (Mauseth, 2003). However, this construction makes the moss lose a lot of water when the habitat dries. But since the moss is able to survive desiccation, there is no need to shut down the photosynthesis, and thus rather beneficial using all the water for the reactions than just losing it to the surrounding habitat.
6.2 Phylogenetic tree
The phylogenetic tree shows that the upregulated genes, PpLTPg2, PpLTPg3, PpLTPg4, PpLTPg6, PpLTPg8 and PpLTPg9, are all clustered together (fig. 8). This suggests a common ancestry gene that evolved as an evolutionary adaptation to cope with the terrestrial conditions. P. patens genome has been duplicated one or even more times (Rensing et al., 2008). This could explain how the upregulated genes can be so closely related and even how PpLTPg6 could be upregulated both during UV-B radiation and dehydration stress.
In conclusion the nsLTP type G family seems highly interesting of studying to better understand the early land plant evolution. Of the ten genes, six were upregulated during either cold, dehydration or UV-B stress. During NaCl, copper and osmotic stress downregulation was seen for most of the genes, suggesting their involvement in metabolic pathway that gets halted during these stressful conditions. Future studies should aim to knockdown the upregulated genes and then compare the phenotype to the wild-type during the mentioned stresses.
7. Acknowledgement
I would like to thank my supervisors Johan Edqvist and Monika Edstam for their guidance and expertise, and my fellow students in the MOSSGROUP and at the office for all the laughs.
8. References
Baker CJ, McCormick SL, Bateman DF (1982) Effects of purified cutin esterase upon the permeability and mechanical strength of cutin membrane. Phytopathology. 72:420-3
Beisson, F., Koo, AJ., Ruuska, S., Schwender, J., Pollard, M., Thelen, JJ., Paddock, T., Salas, JJ., Savage, L., Milcamps, A., Mhaske, VB., Cho, Y. and Ohlrogge, JB. (2003) Arabidopsis genes involved in acyl lipid metabolism. A 2003 census of the candidates, a study of the distribution of expressed sequence tags in organs, and a web-based database.
Plant Physiol. 132:681-97
Debono A, Yeats TH, Rose JK, Bird D, Jetter R, Kunst L and Samuels L. (2009) Arabidopsis LTPG is a glycosylphosphatidylinositol-anchored lipid transfer protein required for export of lipids to the plant surface. Plant Cell. 21:1230-8
Hartman E. (1969) The Ecology of the "Copper Moss" Mielichhoferia mielichhoferi in Colorado. The Bryologist. 72:56-9
Frank W, Ratnadewi D and Reski R (2005) Physcomitrella patens is highly tolerant against drought, salt and osmotic stress. Planta. 220:384-94
Gillmor CS, Lukowitz W, Brininstool G, Sedbrook JC, Hamann T, Poindexter P, Somerville C (2005) Glycosylphosphatidylinositol-Anchored Proteins Are Required for Cell Wall Synthesis and Morphogenesis in Arabidopsis. Plant Cell. 4:1128-40
Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O (2010) New
Algorithms and Methods to Estimate Maximum-Likelihood Phylogenies: Assessing the Performance of PhyML 3.0. Systematic Biology. 3:307-21
Han GW, Lee JY, Song HK, Chang C, Min K, Moon J, Shin DH, Kopka ML, Sawaya MR, Yuan HS, Kim TD, Choe J, Lim D, Moon HJ, Suh SW. (2001) Structural basis of
non-specific lipid binding in maize lipid-transfer protein complexes revealed by high-resolution X-ray crystallography. J Mol Biol. 2:263-78
Holm K, Källman T, Gyllenstrand N, Hedman H, Lagercrantz U. (2010) Does the core
circadian clock in the moss Physcomitrella patens (Bryophyta) comprise a single loop? BMC
Plant Biol. 10:109
Jeffree, CE. (2006). Biology of the Plant Cuticle. In Introduction: Biology of the plant
cuticle. (ed M. Riederer and C. Müller) pp. 1–11. Oxford, UK: Blackwell.
Kader, JD. (1996) Lipid-transfer proteins in plants. Annu. Rev. Plant Physiol. Plant Mol.
Biol. 47:627-54
Kenrick P. and Crane PR. (1997) The origin and early evolution of plants on land. Nature. 389:33-39
Maldonado AM, Doerner P, Dixon RA, Lamb CJ, Cameron RK. (2002) A putative lipid transfer protein involved in systemic resistance signalling in Arabidopsis. Nature. 419:399-403
Mauseth. JD (2003) Nonvascular plants: mosses, liverworts and hornworts. In Botany: An
Introduction to Plant Biology, 3rd ed. pp. 660-1. Jones and Bartlett Publishers
Minami A, Nagao M, Ikegami K, Koshiba T, Arakawa K, Fujikawa S, Takezawa D. (2005) Cold acclimation in bryophytes: low-temperature-induced freezing tolerance in Physcomitrella patens is associated with increases in expression levels of stress-related genes but not with increase in level of endogenous abscisic acid. Planta. 3:414-23
Nagao M, Minami A, Arakawa K, Fujikawa S, Takezawa D. (2005) Rapid degradation of starch in chloroplasts and concomitant accumulation of soluble sugars associated with ABA-induced freezing tolerance in the moss Physcomitrella patens. J Plant Physiol. 162:169-80 Oliver MJ, Velten J, Mishler BD (2005) Desiccation tolerance in bryophytes: a reflection of the primitive strategy for plant survival in dehydrating habitats? Integr Comp Biol. 45:788– 799
Pyee J, Yu H, Kolattukudy PE. (1994) Identification of a lipid transfer protein as the major
protein in the surface wax of broccoli (Brassica oleracea) leaves. Arch Biochem Biophys.
2:460-8
Rakwal R, Komatsu S. (2004) Abscisic acid promoted changes in the protein profiles of rice seedling by proteome analysis. Mol Biol Rep. 31:217-30
Rensing SA, Lang D, Zimmer AD, Terry A, Salamov A, Shapiro H, Nishiyama T, Perroud PF, Lindquist EA, Kamisugi Y, et al. (2008) The Physcomitrella genome reveals evolutionary insights into the conquest of land by plants. Science. 319:64-9
Richardt S, Timmerhaus G, Lang D, Qudeimat E, Corrêa LG, Reski R, Rensing SA, Frank W. (2010) Microarray analysis of the moss Physcomitrella patens reveals evolutionarily conserved transcriptional regulation of salt stress and abscisic acid signalling.
Plant Mol Biol. 72:27-45
Riederer, M. (2006). Biology of the Plant Cuticle. In Introduction: Biology of the plant
cuticle. (ed M. Riederer and C. Müller) pp. 1–11. Oxford, UK: Blackwell.
Rozema J, van de Staaij J, Björn LO, Caldwell M. (1997) UV-B as an environmental factor in plant life: stress and regulation. Trends Ecol Evol. 12:22-8
Rueckert DG, Schmidt K. (1990) Lipid transfer proteins. Chem Phys Lipids. 1:1-20
Samuels, L., Kunst, L. and Jetter, R. (2008) Sealing plant surfaces: cuticular wax formation by epidermal cells. Annu Rev Plant Bio. 59: 683-707.
Sassmann S, Wernitznig S, Lichtscheidl IK, Lang I. (2010) Comparing copper resistance in two bryophytes: Mielichhoferia elongata Hornsch. versus Physcomitrella patens Hedw.
Schweizer P, Felix G, Buchala A, Müller C and Métraux JP (1996) Perception of free cutin monomers by plant cells. Plant J 10:331-41
Sunkar R, Bartels D, Kirch HH. (2003) Overexpression of a stress-inducible aldehyde
dehydrogenase gene from Arabidopsis thaliana in transgenic plants improves stress tolerance.
Plant J. 35:452-64
Takezawa D, Komatsu K, Sakata Y. (2011) ABA in bryophytes: how a universal growth regulator in life became a plant hormone? J Plant Res. DOI 10.1007/s10265-011-0410-5
Thompson JD, Higgins DG, Gibson TJ. (1994) CLUSTAL W: improving the sensitivity of
progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-80
Yeats, TH. and Rose, JK. (2008) The biochemistry and biology of extracellular plant lipid-transfer proteins (LTPs). Protein Sci. 17:191-8
Zachowski A, Guerbette F, Grosbois M, Jolliot-Croquin A and Kader JC. (1998) Characterisation of acyl binding by a plant lipid-transfer protein. Eur J Biochem. 257:443-8 Wang X, Kuang T, He Y. (2010) Conservation between higher plants and the moss Physcomitrella patens in response to the phytohormone abscisic acid: a proteomics analysis.
BMC Plant Biol. 10:192-203
Wang X, Yang P, Gao Q, Liu X, Kuang T, Shen S, He Y. (2008) Proteomic analysis of the
response to high-salinity stress in Physcomitrella patens. Planta. 228:167-77
Wang X, Yang P, Zhang X, Xu Y, Kuang T, Shen S, He Y. (2009) Proteomic analysis of the cold stress response in the moss, Physcomitrella patens. Proteomics. 19:4529-38
Zimmer A, Lang D, Richardt S, Frank W, Reski R, Rensing SA. (2007) Dating the early evolution of plants: detection and molecular clock analyses of orthologs. Mol Genet
