• No results found

Lär känna din släkt DNA nylänk

N/A
N/A
Protected

Academic year: 2021

Share "Lär känna din släkt DNA nylänk"

Copied!
3
0
0

Loading.... (view fulltext now)

Full text

(1)

Rita fylogenetiska trädet med ny sida! http://www.ebi.ac.uk/Tools/msa/clustalo/ >Homo_sapiens_atp6 ATGAACGAAAATCTGTTCGCTTCATTCATTGCCCCCACAATCCTAGGCCTACCC GCCGCAGTACTGATCATTCTATTTCCCCCTCTATTGATCCCCACCTCCAAATATC TCATCAACAACCGACTAATCACCACCCAACAATGACTAATCAAACTAACCTCAAA ACAAATGATAACCATACACAACACTAAAGGACGAACCTGATCTCTTATACTAGTA TCCTTAATCATTTTTATTGCCACAACTAACCTCCTCGGACTCCTGCCTCACTCATT TACACCAACCACCCAACTATCTATAAACCTAGCCATGGCCATCCCCTTATGAGC GGGCACAGTGATTATAGGCTTTCGCTCTAAGATTAAAAATGCCCTAGCCCACTT CTTACCACAAGGCACACCTACACCCCTTATCCCCATACTAGTTATTATCGAAACC ATCAGCCTACTCATTCAACCAATAGCCCTGGCCGTACGCCTAACCGCTAACATT ACTGCAGGCCACCTACTCATGCACCTAATTGGAAGCGCCACCCTAGCAATATCA ACCATTAACCTTCCCTCTACACTTATCATCTTCACAATTCTAATTCTACTGACTAT CCTAGAAATCGCTGTCGCCTTAATCCAAGCCTACGTTTTCACACTTCTAGTAAGC CTCTACCTGCACGACAACACATAA >Homo_neanderthalensis_atp6 ATGAACGAAAATCTGTTCGCTTCATTCATTGCCCCCACAATCCTAGGCCTACCC GCCGCAGTACTGATCATTCTATTTCCCCCTCTATTGATCCCCACCTCCAAATATC TCATCAACAACCGACTAATTACCACCCAACAATGACTAATCAAACTAACCTCAAA ACAAATGATAGCCATACACAACACTAAGGGACGAACCTGATCTCTTATACTAGTA TCCTTAATCATTTTTATTACCACAACTAACCTCCTCGGACTCCTGCCTCACTCATT TACACCAACCACCCAACTATCTATAAACCTAGCCATGGCCATCCCCTTATGAGC GGGCGCAGTGATTATAGGCTTTCGCTCTAAGATTAAAAATGCCCTAGCCCACTT CTTACCACAAGGCACACCTACACCCCTTATCCCTATACTAGTTATTATCGAAACC ATCAGCCTACTCATTCAACCAGTAGCCCTGGCCGTACGCCTAACCGCTAACATT ACTGCAGGTCACCTACTCATGCACCTAATTGGAAACGCCACCCTAGCAATATCA ACCATTAACCTTCCCTCTACACTTATCATCTTCACAATTCTAATTCTACTGACTAT CCTAGAAATCGCTGTCGCCTTAATCCAAGCCTACGTTTTCACACTTCTAGTAAGC CTCTACCTGCACGACAACACATAA

(2)

>Pan_paniscus_dvargscimpans_atp6 ATGAACGAAAATCTGTTCGCTTCATTCGCTGCCCCCACAATCCTAGGCCTACCC GCCGCAGTACTGATCATTCTATTCCCCCCTCTACTGGTTCCCACCTCTAAACATC TCATCAACAACCGACTAATTACCACCCAACAATGACTAATTCAACTGACCTCAAA ACAAATAATAACTATACACAACACTAAAGGACGAACCTGATCTCTCATACTAGTA TCCTTAATTATTTTTATTGCCACAACTAATCTTCTCGGACTTCTACCTCACTCATT CACACCAACCACCCAACTATCTATAAACCTAGCCATGGCTATCCCCCTATGAGC AGGCACAGTAGTCATAGGCTTTCGCTTTAAGACTAAAAATGCCCTAGCCCACTT CTTACCGCAAGGCACACCTACACCCCTTATCCCCATACTAATTATCATCGAAACT ATCAGCCTATTCATTCAACCAATAGCCTTAGCCGTACGTCTAACCGCTAACATTA CTGCAGGCCACCTACTCATGCACCTAATTGGAAGCGCCACACTAGCATTATCAA CTATTAGTTTACCCTCCACACTCATTATCTTCACAATTCTAATCCTACTGACTGTT CTAGAAATCGCCGTTGCCTTAATCCAAGCCTACGTTTTTACACTTCTAGTGAGCC TCTACCTGCACGACAACACATAA > Gorilla_gorilla_atp6 ATGAACGAAAATTTATTCGCTTCATTCATTGCCCCCACAATCCTAGGCTTACCCG CCGCAGTATTAATTATCCTACTTCCCCCTCTACTGATCCCCACCTCCAAATATCT CATCAACAACCGACTGATTGCCACCCAACAGTGACTAATCCAACTAACCTCAAAA CAAATAATAACTATACATAACGCCAAGGGACGAACCTGATCCCTTATGTTAATAT GATTAATTATTTTTATTGCCACAACCAACCTCCTCGGACTCTTGCCCCACTCATT CACACCAACTACCCAGCTATCTATAAACCTGGCCATAGCCATCCCCCTGTGAGC AGGCGCAGTAACTACAGGCTTTCGCTCCAAGACTAAAAATGCCCTAGCCCACCT ACTACCACAAGGCACCCCTACACCCCTTATCCCTATACTAGTCATCATTGAAACC ATCAGCCTATTCATCCAACCAATAGCCCTAGCTGTACGCCTAACCGCTAACATCA CTGCAGGTCACCTACTTATGCACCTAATCGGAAGCGCCACACTAGCAATATCAA CTACCAATCTTCCCTCAACACTCATTATCTTTACAGTCCTAATTTTATTAACTATA CTAGAAATCGCTGTCGCCCTCATCCAAGCCTACGTTTTCACACTTTTAGTGAGCC TCTACCTGCACGAGAACACATAA >Mus_musculus_atp6 ATGAACGAAAATCTATTTGCCTCATTCATTACCCCAACAATAATAGGATTCCCAAT CGTTGTAGCCATCATTATATTTCCTTCAATCCTATTCCCATCCTCAAAACGCCTAA

(3)

TCAACAACCGTCTCCATTCTTTCCAACACTGACTAGTTAAACTTATTATCAAACAA ATAATGCTAATCCACACACCAAAAGGACGAACATGAACCCTAATAATTGTTTCCC TAATCATATTTATTGGATCAACAAATCTCCTAGGCCTTTTACCACATACATTTACA CCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAG CCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCC ACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCC TATTTATTCAACCAATGGCATTAGCAGTCCGGCTTACAGCTAACATTACTGCAGG ACACTTATTAATACACCTAATCGGAGGAGCTACTCTAGTATTAATAAATATTAGCCCACC AACAGCTACCATTACATTTATTATTTTACTTCTACTCACAATTCTAGAATTT GCAGTAGCATTAATTCAAGCCTACGTATTCACCCTCCTAGTAAGCCTATATCTAC ATGATAATACATAA

References

Related documents

Observera alltså att ett fragment som betecknas med rätt inte nödvändigtvis behöver vara blått utan endast måste komma från faderns paternella kromosom för att möjligheten ska

För instruktion och inköp av material till den praktiska delen med extraktion av DNA från växtmaterial hänvisas till Bioscience explained vol 3, nr 2, www.bioscience-explai-

[r]

Som ett inledande steg i arbetet med den nya översikts- planen väljer vi att göra en vardagslivskartläggning med kommuninvånarna för att förbättra vår kunskaps- och

Oavsett hur gam- mal du är, eller vad som kan påverka din möjlighet att berätta hur du vill ha det, vill vi hjäl- pa dig att fortsätta vara den du är.. Grunden för omvårdnaden

Teman som behandlas är bland annat: Lagstiftning, brottsprocessen i korthet, förfarande vid misstanke om våld, förebyggande och stödtjänster samt Brottsofferjourens

• Berätta att frågorna är ett sätt att lära känna sig själv och sätta mål för vad de själva vill ändra för att må så bra som möjligt.. De svarar sedan på samma frågor

SO•S Plus innehåller övningsmaterial för samtliga SO-ämnen för årskurs 7 till 9 och följer SO-seriens upplägg?. Under varje årskurs, ämne och kapitel hittar eleven