Expression of Ebola and Marburg
Virus Nucleoproteins
For Use in Antibody-Based Diagnostics
Jonnie Svedberg
Spring 2015
Department of Clinical Microbiology Biomedical Laboratory Science Biomedical Analysis Programme
Swedish titel: Uttryck av Ebola och Marburg virus nukleoprotein för
antikroppsbaserad diagnostik
Supervisor: Göran Bucht, Totalförsvarets Forskningsinstitut (FOI)
Abstract
The Ebola virus disease that has swept through Western Africa gave a strong international response once it was realized how quickly the outbreak was progressing, and the fear of an epidemic becoming a pandemic is palpable. The current total death toll is estimated at 11 000, including health personnel that volunteered to help. Further international effort is still deemed necessary to combat any further damage. The need for a more utilitarian diagnostic of Ebola hemorrhagic disease, other than the fairly logistically cumbersome RT-PCR, might be found by an ELISA towards nucleoproteins in associated pathogens. The purpose of this study was to use the nucleoprotein of both Ebola and Marburg filoviruses and clone the corresponding genes or gene fragments into pET101 and pET151 vectors, respectively. Protein was then expressed in BL21 Star competent cells, as well as purified by using the His-tag present in aforementioned vectors. In conclusion, amplification of full length and fragments of the nucleoprotein sequence, cloning of amplified sequences into both vectors, as well as
transformation into competent cells was successful. However, expression and purification of the full Ebola nucleoprotein was not fully completed, yet provides some valuable input on how optimization could improve the results.
Keywords
Introduction
The recent outbreak of Ebola virus disease (EVD) in regions of Western Africa has had a major international impact of the view of epidemics in modern time. Nine months after the first case occurred in the rural parts of Guinea in around December 2014, the number of reported cases and deaths were still rising despite multinational efforts to contain and control the spread of the infection (1). As of 20th May 2015, there have been over 26 000 cases of EVD with 11 000 reported deaths (2).
Due to the current lack of any effective vaccines, prophylactics, and antiviral substances, mortality rates of up to 80% were observed (1). EVD have a strong psychological effect; it is easy to fear a disease that seemingly cannot be stopped once it has taken hold. Today the only treatment available for EVD patients is supportive therapy. Even though the spread has halted today, it has been reported that sustained actions are required to keep the infection at bay and to eventually eliminate it (3, 4).
In terms of classification and nomenclature, Ebola belongs in the Mononegavirales order as one of the three genus present in the Filoviridae family, which includes Ebolavirus, Marburgvirus and
Cueavirus. Within the Ebola genus there are five species present, usually named after where the first
outbreak occurred; Ebola, for example is named after the Ebola river close to its first outbreak in 1976 (5). The Marburg virus is alone within its genus, and is particularly interesting as it has a very high lethality in previous outbreaks. (6). Due to their similarities, cross-reactivity between Marburg and Ebola proteins may also be a factor, which may complicate diagnostics and epidemiologic tracking, and in some cases adequate treatment (7).
Material and Methods
Virus and plasmids
Complete RNA from Ebola and Marburg filovirus was obtained from the Public Health Agency of Sweden (Folkhälsomyndigheten), and plasmid containing Ebola DNA from Swedish Defense Research Agency (Totalförsvarets forskningsinstitut, FOI).
PCR
Three pairs of forward and reverse primers were designed and used for each filovirus (Tab. 1) to produce dsDNA fragments of the nucleoproteins in varying sizes, using the KAPA Biosystems HiFi PCR kit (KAPA Biosystems, Wilmington, MA, USA) according to manufacturer recommendations.
Gel electrophoresis
Agarose gels (1%) containing GelRed (Biotium, Hayward, CA, USA) was used to confirm and estimate the size of the PCR products, and to confirm plasmid cloning and transformed bacterial colonies. The molecular weight standard used was 1 kb Plus DNA Ladder (Invitrogen, Carlsbad, CA, USA)
Gene cloning and transformation
Gene fragments of the correct size was ligated and transformed into Champion™ pET Directional pET101 and pET151 vectors, respectively, by using the TOPO® Expression Kits (Life Technologies, Carlsbad, CA, USA) and the included TOP10 cells according to manufacturer specifications. Cloning results were confirmed by using Dynazyme II PCR kit directly on transformed cell colonies according to manufacturer recommendations. Plasmids from two confirmed colonies of each construct were prepared using Spin Miniprep Kit (Qiagen, Hilden, Germany) according to manufacturer
specifications.
Protein expression
The BL21 Star competent cells from the above mentioned expression kit were transformed according to manufacturer specifications. The plasmid carrying the entire Ebola nucleoprotein fragment was transformed and confirmed in the same manner as above. Overnight cultures were diluted and monitored for bacterial growth at 37˚C through spectrophotometric OD600 readings every h. At optimal induction concentration (OD 600 ~0.5-0.7), IPTG (Sigma-Aldrich, St. Louis, MO, USA) were added to a concentration of 0.1 mg/mL to induce protein expression. Cultures were induced for approximately four h before harvested by centrifugation at 3500 RPM for 15 min, and then frozen at -20 °C overnight.
Protein purification
The frozen bacterial pellets were thawed and treated with a lysis buffer (50 mM NaH2PO4, 300 mM
above suspension was then sonicated before centrifugation. After sonication, samples of unpurified proteins from the supernatant were obtained and put on ice. Ni-NTA agarose (Qiagen, Halden, Germany) was then added to the supernatant, which were allowed to mix overnight. Ni-NTA agarose were then washed twice in lysis buffer before eluded four times using an elusion buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole, pH 8.0 using NaOH). When elusion by a higher
imidazole concentration was proven ineffective, 100 mM EDTA was used instead in an additional elusion attempt.
SDS-PAGE
Standard polyacrylamide gel (12%) was used for protein separation of the eluded product in the above step, and was visualized using Coomassie Blue (BioRad, Hercules, California, USA). Standard used was Prestained SDS-PAGE Standard Low Range (BioRad,).
Ethical consideration
Results
PCR Product
Initial amplification of Ebola and Marburg nucleoproteins showed that the kit and primers was able to produce the desired fragments of both whole nucleoprotein sequence as well as individual thirds of the entire nucleoprotein sequence (Fig 1.).
Gene cloning
Examination of transformed TOP10 cells indicated that the plasmids contained the desired fragments; the full length Ebola and nucleoprotein as well as the individual thirds of the nucleoprotein sequence (Fig 2.).
Protein expression
Cloning the full-length Ebola nucleoprotein gene into plasmids and subsequently transformed to BL21 Star cells was deemed successful (Fig 3.). Growth curve shows adequate growth to produce a
Discussion
We have determined that PCR of the Ebola nucleoprotein in both the complete sequence encoding the full-length protein as well as individual overlapping thirds of the same gene is possible using our designed primers. Initial analysis by gel electrophoresis was slightly difficult, due to the high
concentrations of PCR product, but after sufficient dilution of amplified product it was confirmed to be of accurate molecular weight, and thus suitable for cloning into our expression vectors.
Fragments of both Ebola and Marburg nucleoproteins containing the full nucleoprotein sequence, as well as individual thirds of it were acquired though PCR amplification before cloning into both pET101 and pET151 vector, respectively. The identity of the pET constructs were verified before long term storage of the Marburg constructs, in order to focus on expressing the Ebola full length nucleoprotein due to time constraints.
Transformation of both plasmids containing full length Ebola nucleoprotein into BL21 Star cells was deemed successful, but expression and purification proved harder to achieve. It was initially suspected to be problematic since the gene is rather large and also might pose problems in a prokaryotic
organism due to presence 0f rare codons. This might lead to translation errors, or toxicity in the bacterial host cell. (6). It can be suspected that the elusion process was not sufficient to elude the proteins from the Ni-NTA, since no protein bands were visible in the purified samples. The size of Ebola nucleoprotein is estimated at 104 kDa (7), yet no protein of that size range was detectable in either the purified or unpurified samples. Several other protein band of varying size were visible in the unpurified samples, which presumably were remnants of the bacterial vector.
However, the expression might have been successful, since there were reasonably strong bands close to the expected size 104 kDa size. The large bands might also have been expressed as smaller peptides or degrades into a number of smaller proteins, either due to faulty translation or faults in the purification process.
Due to time constraints, it was not possible to test this within this project. However, Western blot analysis with either polyhistidine- or v5-antibodies against epitopes present in our vectors could show if any parts of the protein have been expressed in the unpurified samples (10). If binding of these particular antibodies occurs, then optimization of the Ni-NTA purification should be performed to ensure the protein can be eluded successfully and used in diagnostics.If no binding of antibodies occurs, focus should be on optimizing the expression, for instance in BL21 Rosetta cells, which contain tRNA for codons otherwise uncommon in E. coli, which could lead to a better transcription and more successful expression. (11, 12)
References
1. WHO Ebola Response Team. Ebola virus disease in West Africa--the first 9 months of the epidemic and forward projections. N Engl J Med. 2014 Oct 16;371(16):1481-95. doi: 10.1056/NEJMoa1411100. Epub 2014 Sep 22. PubMed PMID: 25244186; PubMed Central PMCID: PMC4235004
2. WHO Ebola Situation Report – 20 May 2015
http://apps.who.int/ebola/en/current-situation/ebola-situation-report-20-may-2015 [2015-05-22]
3. Dallatomasina S, Crestani R, Sylvester Squire J, Declerk H, Caleo GM, Wolz A, Stinson K, Patten G, Brechard R, Gbabai OB, Spreicher A, Van Herp M, Zachariah R. “Ebola outbreak in rural West Africa: Epidemiology, clinical features and outcomes.” Tropical Medicine & International Health 20.4 (2015): 448–454.
4. Tambo E, Ugwu EC, Ngogang JY. Need of surveillance response systems to combat Ebola outbreaks and other emerging infectious diseases in African countries. Infect Dis Poverty.
(2014);3:29. doi: 10.1186/2049-9957-3-29. eCollection 2014. PubMed PMID: 25120913; PubMed Central PMCID: PMC4130433.
5. Kuhn JH, Becker S, Ebihara H, Geisbert TW, Johnson KM, Kawaoka Y, Lipkin WI, Negredo AI, Netesov SV, Nichol ST, Palacios G, Peters CJ, Tenorio A, Volchkov VE, Jahrling PB. “Proposal for a Revised Taxonomy of the Family Filoviridae: Classification, Names of Taxa and Viruses, and Virus Abbreviations.” Archives of Virology 55.12 (2010): 2083–2103. PMC..
6. International Committee on Taxonomy of Viruses 2014
http://www.ictvonline.org/virusTaxonomy.asp [2015-05-22]
7. Huang Y, Zhu Y, Yang M, Zhang Z, Song D, Yuan Z. Nucleoprotein-based indirect enzyme-linked immunosorbent assay (indirect ELISA) for detecting antibodies specific to Ebola virus and Marbug virus. Virol Sin. 2014 Dec;29(6):372-80. doi: 10.1007/s12250-014-3512-0. Epub 2014 Dec 15. PubMed PMID: 25547682.
8. Khow, Orawan, and Sunutcha Suntrarachun. “Strategies for production of active eukaryotic proteins in bacterial expression system.” Asian Pac Journal of Tropical Biomedicine 2.2 (2012): 159–162.
9. Bornhorst JA, Falke JJ. Purification of proteins using polyhistidine affinity tags. Methods Enzymol. 2000;326:245-254. PubMed PMID: 11036646
10. Champion™ pET Directional TOPO® Expression Kits Manual
https://tools.lifetechnologies.com/content/sfs/manuals/pettopo_man.pdf [2015-05-22] 11. Novagen Competent Cells Manual
http://www.med.unc.edu/pharm/sondeklab/Lab%20Resources/manuals/novagen_competent_c ells2.pdf [2015-05-22]
12. Tegel H, Tourle S, Ottosson J, Persson A. Increased levels of recombinanthuman proteins with the
Escherichia coli strain Rosetta(DE3). Protein Expr Purif.2010 Feb;69(2):159-167. doi:
Table 1. Primer details regarding sequences, molecular weights (MW), and melting temperatures. Sequence (5'->3')a MW [g/mol] Tm (°C) Oligo name MarvF1 caccATGGATTTACACAGTTTGTTGGAGT 8922 63.9 MarvR1 GATGAACTCGAGAACTGTTTTCACGATAA 8924 62.4 MarvF2 caccATGAAAGTAATTTTCGGGATTTTGA 8930 61.0 MarvR2 CATGACACTGTCATCAAGAGTATCCTC 8252 63.4 MarvF3 caccATGAATCGACCAACTGCTCTG 7570 64.6 MarvR3 CAAGTTCATCGCAACATGTCTCCTTTCAT 8762 63.9 EboF1 caccATGGATTCTCGTCCTCAGAAAAT 8203 63.4 EboR1 ATTTACTCCAGAAAGGTTCAAAAGTCGGG 8949 63.9 EboF2 caccATGGTTGCCGGGCATGA 6447 63.7 EboR2 CTCTATATGCTGGCCCTTTTGACTGTT 8198 63.4 EboF3 caccATGAATGCACCAGATGACTTG 7634 63.0 EboR3 CTGATGATGTTGCAGGATTGCCATGAATT 8962 63.9
aLower case indicates the initial sequences required for directional cloning into pET vectors according to
ST ST ST ST ST ST ST A B C D
ST A B C D E F
ST
Figure 4. Growth diagram of cultured BL21 Star cells containing the full-length Ebola NP gene. Samples 7 to 9 contain pET 101 vector, and 10 to 12 contain pET 151 vector. At the three h time point IPTG was added to induce protein expression.
0 0,5 1 1,5 2 2,5 3 0h 1h 2h 3h 4h 5h 8h 9h O D 600
ST
