Linköping University | Department of Physics, Chemistry and Biology Bachelor thesis, 16 hp | Biology programme: Physics, Chemistry and Biology Spring term 2019 | LITH-IFM-G-EX--19/3694--SE
DNA extraction comparisons between
fresh and boiled
Atlantic Salmon (S. salar) tissues.
Victoria Bernal
Examinator, Per Jensen, IFM Biologi, Linköpings universitet Jenny Hagenblad, IFM Biologi, Linköpings universitet
13-06-2019 Department of Physics, Chemistry and Biology
Linköping University
URL för elektronisk version
ISBN
ISRN: LITH-IFM-G-EX--19/3694--SE
_________________________________________________________________ Serietitel och serienummer ISSN
Title of series, numbering ______________________________
Språk Language Svenska/Swedish Engelska/English ________________ Rapporttyp1 Report category Licentiatavhandling Examensarbete C-uppsats D-uppsats Övrig rapport _____________ Titel Title
DNA extraction comparison between fresh and boiled Atlantic Salmon (S. salar) tissues.
Författare
Victoria Bernal
Nyckelord
Keywords
cee, CO1, DNA barcoding, DNA extraction, Salmo salar
Sammanfattning
Abstract
Barcode identification is a method that uses genetic information to differentiate species. Because of its general versatility it can be applied to contexts from archaeology to the food industry. Atlantic salmon (Salmo salar) is a fish species commonly hunted in the modern times and has been found in archaeological settings. However, barcoding requires enough quality DNA for amplification and abiotic exposure tends to degrade it. High temperatures, such as when boiling, can diminish DNA quality. The extent of DNA degradation between fresh and boiled tissues and whether all tissues retain the same amount of DNA is unclear. In this study DNA was extracted from S. salar tissues fins, muscle, bones and scales without treatment and with boiling treatment. DNA concentrations between fresh and boiled bones were not significantly different, as were comparisons between samples with the same treatments. Muscles had higher DNA concentrations when boiled and fins had higher when fresh. These findings show that regarding certain tissue types can be expected to better retain DNA concentrations after boiling.
Table of content
1
Abstract ... 4
2
Introduction ... 4
3
Material and methods ... 7
3.1
Choice of fish and genes ... 7
3.2
Sampling, treatment and DNA extraction ... 8
3.3
PCR and gel electrophoresis ... 8
3.5 Statistical analysis ... 9
4
Results ... 10
5
Discussion ... 12
5.1
General ... 12
5.2
PCR Troubleshooting ... 14
5.3
Limitations ... 15
5.4
Conclusion... 16
5.5
Societal and ethical aspects ... 16
6
Acknowledgements ... 16
7
References ... 16
1 Abstract
Barcode identification is a method that uses genetic information to differentiate species. Because of its general versatility it can be applied to contexts from archaeology to the food industry. Atlantic salmon (Salmo salar) is a fish species commonly hunted in modern times and has been found in archaeological settings. However, barcoding requires enough quality DNA for amplification and abiotic exposure tends to degrade it. High temperatures, such as when boiling, can diminish DNA quality. The extent of DNA degradation between fresh and boiled tissues and whether all tissues retain the same amount of DNA is unclear. In this study DNA was extracted from S. salar tissues fins, muscle, bones and scales without treatment and with boiling treatment. DNA concentrations between fresh and boiled bones were not significantly different, nor were comparisons between samples with the same treatments. Muscles had higher DNA concentrations when boiled and fins had higher when fresh. These findings show that regarding certain tissue types can be expected to better retain DNA concentrations after boiling. Keywords: cee, CO1, DNA barcoding, DNA extraction, Salmo salar
2 Introduction
Barcode identification has heavy relevancy in ancient and contemporary timelines; animal exploitation has been commonplace in all cultures since pre-historical times, intertwining human history with animal products usage. Documentation of environmental effects on populations, the food industry and archaeological efforts all benefit from species identification (Weigt et al, 2012). Identification through osteological and morphological means can prove arduous when archaeological remains are insufficient (Lambrides and Weisler, 2015). With molecular technology intact tissue is not a requirement because identification occurs on a genetical level rather than on tissue level. However, exposure to abiotic elements like pH and high temperatures degrade DNA, rendering DNA retrieval a tedious task, in particular when it comes to aged remains (Allentoft, 2012). DNA degradation lowers the amount of viable DNA available for amplification, which makes barcoding sequences from degraded DNA harder.
A barcode gene is a well-conserved gene whose fast mutation rate can be exploited as an identifying biomarker (Weigt, 2012). The gene should be present in many, if not a majority, of taxa and differ slightly between species. Barcoding requires DNA amplification. Should the amplification prove successful the gene can be sequenced and compared in a sequence database, which presents the species this sequence shares the most similarity to. Whether the gene sequence is in the database depends on the barcode genes available for the studied species.
Atlantic salmon (S. salar) is a commonly hunted fish species and has various suitable barcode genes, both with mitochondrial and nuclear origin (Nicola et al, 2018). Mitochondrial genes generally tend to be multiple-copy while nuclear genes tend to be single-copy. The mitochondrial multiple-copy nature makes more copies present for amplification during PCR compared to single-copy genes. Thus, methods amplifying nuclear genes could be considered more sensitive than those using mitochondrial genes. When amplifying degraded DNA, multiple-copy genes are preferred as at least one copy may remain relatively intact. In this context, single-copy genes are more suited for population genetics. For identification purposes nuclear and mitochondrial genes are both useful.
Barcoding has been used to identify S. salar using mitochondrial genes. Fish remnants from the Andamoty-be archaeological site in Madagascar were identified down to species level with the mitochondrial 12S rRNA gene, producing 56 bp long fragments (Grealy et al, 2016). The mitochondrial gene 16S rRNA has been used to identify processed S. salar (Hossain et al, 2019). Archaeological salmon bones have been identified with mitochondrial DNA from the cytochrome b and D-loop regions using fragments shorter than 200 bp (Yang et al, 2004). In comparison, 608 to 645 bp long fragments located in different regions of the cytochrome c oxidase 1 (CO1) gene were amplified using muscle extract from 94 fish families (Ivanova et al, 2007). While longer nucleotide comparisons increase database accuracy, this is not necessarily viable for aged samples. The longer fragments standard barcoding genes produce can be hard to amplify using ancient, degraded DNA (Yang, 2004). However, M13-tailed CO1 primers cause longer fragments than untailed ones (Ivanova, 2007). Together with longer reads, sequence quality is enhanced by 40 to 60 bp long tails in the 5’ direction (Binladen et al, 2018). If tailed primers could produce longer fragments from ancient DNA there would possibly be higher sequence accuracy and quality for mitochondrial genes.
Universal nuclear protein-coding locus markers have previously been evaluated with the primers KIAA1239, SACS and TTN getting fragments of over 1000 bp (Xing-Xing et al, 2012). The primers produced fragments corresponding to 1737 bp, 2211 bp and 1698 bp. An advantage to universal primers is broad targeting of regions common to many species rather than specific sequences common to few, enabling identification of a wider species selection. They may produce longer fragments, such as in Xing-Xing,
2012 and this may hinder barcoding in degraded DNA. Thus, shorter fragments would be preferred. The internal transcript spacer 1 (ITS1) was used in real-time PCR to retain cDNA from smoked, canned, frozen and pate salmon, retrieving 198 bp fragments (Herrero et al, 2011). Similarly, growth hormone gene 1 (GH1) was used in qRT-PCR to detect salmon in food products with 176 bp long fragments (Hafsa et al, 2016). The conserved edge expressed protein (cee) is a single-copy, nuclear gene highly conserved between eukaryotes and lacks orthologues in eubacteria and archaea (Fernandes et al, 2008). It has produced fragments of 969 bp long from raw S. salar tissue. While it is not ideally short, it spans over many taxa and could potentially prove useful to barcoding boiled tissue.
Tissues from archaeological settlements have likely undergone some type of heat treatment from cooking, boiling being one of the choices. Evaluating how boiling affects extractable DNA in fish tissues is advantageous because if fresh and boiled tissues do not differ in extractable DNA concentrations one can assume that boiled buried tissues have lower concentrations due to degradation from abiotic factors. Because tissues withstand chemical and mechanical stress to different degrees the tissues available from archaeological sites will be limited to more resilient tissues, such as bone. While not traditionally archaeological sites, fisheries have fins and scales conserved in their archives (Smith et al, 2011). Muscle is more suited for the food industry, unless the remains found have been frozen. The inherent differences between the tissues can make certain extraction kits give better results depending on the tissue. DNA extraction kits have had their extractable DNA levels from fresh and boiled tuna muscle compared and the DNA concentrations depended heavily on the extraction kit; the DNEasy® Blood and Tissue kit (QIAGEN) extracted more DNA from tuna muscle boiled at 70 and 90 °C than raw muscle while the DNeasy® mericon Food Kit (QIAGEN) extracted more DNA from the raw muscle than the boiled counterparts (Piskata et al, 2017). For scales and fins salt lysis has yielded higher DNA concentrations compared to extraction with a DNeasy® kit (Meissner, 2013). Modified salt extraction of fins elicited a higher DNA yield compared to urea treatment (Muhammad et al, 2016). Because tissues are different in density and resilience, they benefit from different extraction methods. To date, there are no studies comparing DNA extraction differences between fresh and boiled tissues for S. salar.
This study will evaluate the possibility of different tissue types in S. salar reaching different DNA levels when comparing fresh and boiled treatments. Should extraction be successful, sequencing will be attempted using the nuclear cee gene and mitochondrial CO1 gene.
3 Material and methods
3.1 Choice of fish and genes
Fish species for this study was decided using local availability in food stores and existence of primers suited for nuclear, single-copy genes as factors. The fish individual being gutted without removal of appendages, scales and skeleton was imperative since several different tissue types were studied. S. salar fulfilled all conditions. Two genes with different transcriptional origins were sought. One was required to be nuclear and single-copy while the other had to originate from mitochondrial DNA and be a multiple-copy gene. The reason for this was to evaluate whether DNA could be amplified using a less and a more sensitive primer. CO1 is a standard barcoding gene used for S. salar and a plethora of aquatic species (Ivanova, 2007; Asis et al, 2016; Turanov et al, 2016; Kolmann et al, 2017). It is a multiple-copy and mitochondrial gene. cee has been used for identification of S. salar once before (Fernandes, 2008). It is a single-copy and nuclear gene. For primers, see table 1.
Table 1. Primer pairs, their respective sequences and the product fragment size.
1 Primer pair from Fernandes et al, 2008. 2 Primer pair from Ivanova et al, 2007.
Primer pair Fragment size (bp) Sequence Cee-CDS-Ss-F1 Cee-CDS-SS-R1 969 5’-ATGTCGGAGCAGGAGGCTCTG 5’-TCAGTCCAGCTCAATGGGGC M13FF2d2 M13FR1d2 654 5’- TGTAAAACGACGGCCAGTTCTCCACCAA CCACAARGAYATYGG 5’-CAGGAAACAGCTATGACCACCTCAGGGT GTCCGAARAAYCARAA
3.2 Sampling, treatment and DNA extraction
The tissues harvested were muscle, fins, bones and scales. There were 6 replicates per tissue-treatment combination with a total of 42 samples. Each fin sample consisted of one soft ray from the caudal fin. Muscle samples were extracted from the lateral muscles above the pectoral fin, about 1 cm3 in total to avoid degradation when
boiled. One vertebra was assigned for every tube. Scale samples were taken along with skin. Muscle and scale samples all exceeded the minimum 10 mg required by the DNA extraction protocol. The samples were placed in 1.5 ml microtubes and stored at –21 °C. Sample boiling was done at 100 °C for 5 minutes. DNEasy® Blood and Tissue kit (QIAGEN) was used for DNA extraction, following the manufacturer’s instructions. Diversions of protocol will be commented below.
Tissue fragmentation was done using a sterile plastic mortar for all muscle samples. The denser, more resilient bone and fin samples were crushed using a TissueLyser and wolfram beads. Nonetheless, these samples withstood crushing for a substantial amount. Most bone samples were crushed approximately half-way or three quarters, leaving behind fragments. Because bone and fins samples could not be completely disintegrated these samples retained DNA from less than an entire vertebra or ray.
Incubation was done with 20 µl proteinase K (Thermo Scientific). Incubation times were 45 minutes for muscles and scales regardless of treatment. Bone and fin samples had incubation times of 1 hour. In an attempt to further break down the bone samples some of these samples received nightly incubation and were further crushed using the TissueLyser afterwards.
Bone and fin samples had considerable tissue residues after application on the spin columns, obstructing the membranes and retaining liquid above. The centrifugation steps between AW buffer applications were repeated up to four times depending on necessity. If a complete drain was impossible, at least half the liquid had gone through the membrane. Additionally, only 100 µl buffer AE was used for elution for all samples instead of 200 µl.
3.3 PCR and gel electrophoresis
Samples that had A260/A280 ratios of 1.7 to 1.9 were used for PCR. The standard
DreamTaq buffer (20 mM MgCl2, Thermo Scientific), 0.2 µl DreamTaq-polymerase (Thermo Scientific) and 2 µl of each primer (1 µM) per PCR tube. 1 µl extracted DNA was added to each PCR tube. Each PCR run consisted of four reactions with sample DNA and one negative control without sample DNA. In order to optimize the PCRs, different dNTP concentrations were tested along with varying primer concentrations.
The PCR protocol was as follows: 94 °C during 2.5 minutes; 94 °C during 15 seconds; varying annealing temperature during 40 seconds; 72 °C for an extended amount of time; repeat 34 times; 72 °C for 10 minutes; 4 °C onto eternity. The recommended annealing temperature (58 °C) for the cee primers was calculated with the Tm calculator on Thermo Fisher’s website. For the M13-tailed CO1 primers 52 °C
was the recommended temperature from Ivanova, 2007. Commencing with these temperatures, annealing temperatures were lowered to find the optimal temperature for each primer pair. The results of the PCR reactions were examined using gel electrophoresis.
3.5 Statistical analysis
SPSS (version 26) was used for all the statistical analyses. Normality in the tissue nuclear acid concentrations was examined and upon confirmation of no normal distribution non-parametric tests were chosen. All 42 samples were eligible for statistical testing. The statistical tests all used a significance level of 0.05.
To evaluate whether nuclear acid concentration differed between fresh and boiled tissues an Independent-Samples Mann-Whitney U test was performed. Comparisons of all tissues exposed to the same treatment were done separately using
4 Results
The DNA extractions were successful for all samples (see appendix, table 2). For the boiled tissues only muscle contained higher extractable DNA concentrations compared to its fresh counterpart (Independent-Samples Mann-Whitney U test: N = 12, U = 36, SE = 6.245, P = 0.002, see figure 1) with boiled muscle having DNA concentrations between 195.6 and 458.9 ng/µl and a mean of 358.8 ng/µl. Boiled fins contained less extractable DNA than fresh fins (Independent-Samples Mann-Whitney U test: N = 12, U = 4, SE = 6.245, P = 0.026, see figure 1. The boiled fins contained DNA concentrations of 28.6 to 90.4 ng/µl and a mean of 56.4 ng/µl. The boiled scales had a mean of 124.5 ng/µl and the concentrations ranged between 99.6 to 153.4 ng/µl. Fresh scales were not used and therefore no comparison was made between the two treatments. There were no significant differences between the two treatments in bone (Independent-Samples Mann-Whitney U test: P = 0.132, see figure 1). Boiled bones had concentrations between 75.9 and 273.3 ng/µl, mean 179.6 ng/µl and its fresh counterpart concentrations from 94.2 to 136.9 ng/µl with a mean of 113.6 ng/µl. Fresh muscle had concentrations ranging between 49.3 to 178.3 ng/µl, mean 100.5 ng/µl. Fresh fin had a range of 77.5 to 171.6 ng/µl, mean 139.4 ng/µl.
Figure 1. Concentration distribution for a) muscle, b) bone and c) fin samples. Group 1 denotes the fresh samples, group 2 the boiled.
Boiled tissues had different DNA concentrations for several pair comparisons (Independent-Samples Kruskal-Wallis test: N = 24, df = 3, P = 0.000, figure 2): fins-bones (P = 0.008); fins-muscles (P = 0.000); and scales-muscles (P = 0.013). The pairs without significant differences were fins-scales (P = 0.79), scales-bones (P = 0.369) and muscles-bones (P = 0.111). The fresh tissues retained the same concentrations in
their comparisons (Independent-Samples Kruskal-Wallis test: N = 18, df = 2, P = 0.459, figure 2).
Figure 2. DNA extraction concentrations of a) boiled and b) fresh tissues.
In the PCRs the cee primer pair yielded no bands from temperatures 58 °C to 52 °C, instead lower temperatures gave rise to primer dimers. The M13-tailed primer pairs failed to produce bands or merely established primer dimers between temperatures 56 °C to 48 °C. Prolonged annealing time (80 seconds) produced primer dimers. When M13-tailed primers were used together with a higher dNTP concentration (25 mM) smeared bands appeared (see figure 3). Trying to rectify the smears, lower Taq-polymerase concentrations were used and this produced less intense smears (see figure 3). However, no clear bands were produced for either primer pair.
Figure 3. PCR results of fresh bone samples attempting a) PCR with higher dNTP concentration and b) lower Taq-polymerase concentrations. L = GeneRuler ladder, N = negative control, 1-5 = samples. Image edited to remove unrelated results. The M13-tailed COI primer pair was used with an annealing temperature of 48 °C.
5 Discussion
5.1 General
This study showed that boiling affects DNA extraction concentrations for muscles and fins while bone remains unaffected. DNA was not amplifiable using the tested primer pairs. Boiling causes differences in DNA extraction concentration between certain tissues.
Different tissues have different predispositions for resisting destruction. Bones are traditionally found in archaeological settings due to their great resilience. This study shows that boiling does not cause differences in extractable DNA concentrations in bones, affirming this. The reason for this could be bone density, as it would require more intense boiling to further degrade the DNA. Bone density did not affect mitochondrial DNA preservation in ancient seal ribs but it is not known whether this is true for boiled samples (Barta et al, 2014). More spongeous bones could possibly be easier to disintegrate when boiled, which could affect how abiotic factors degrade DNA. Furthermore, mitochondrial DNA degrades half the speed of nuclear DNA in bone (Allentoft et al, 2012). When handling ancient DNA it could prove advantageous to utilize mitochondrial genes for this reason and because they are generally multiple-copy, at the expense of a lowered detection threshold.
While scales would be hard to acquire from sediments in archaeological sites there are alternatives. Scales archived in research institutions or museums could provide DNA depending on storage conditions. DNA has been extracted from dried Sockeye salmon (Oncorhynchus nerka) scales (Smith, 2011). Considering that these scales were collected in the 1950s and that Smith, 2011 utilized the same kit this study did, the DNA extracted in this study should be amplifiable. Due to time constraints scale DNA amplification attempts were not possible. Because no comparison between fresh and boiled scales was made, it is difficult to judge how boiling would affect ancient samples. Much like muscle, scales would not persevere for long after exposure to abiotic factors. Considering their relative fragility and rarity, effort would be more well-placed in evaluating how dried, aged scales differ in extractable DNA concentration levels compared to fresh scales.
Boiled muscle has more extractable DNA compared to fresh muscle when boiled at 100 °C for 10 minutes. If the temperature is appropriate it can be assumed that structural objects that could impede DNA extraction are destroyed while the DNA is
preserved. There are DNA extraction protocols for certain bacteria that utilize repeated boiling and thawing (da Silva et al, 2012). Perhaps muscle extraction could benefit from boiling because muscle does not contain rigid structures that could affect the spin column membrane, unlike fins and bones. If muscle has more DNA available for extraction when boiled, it could be possible for other soft tissues to experience the same results. Dental pulp in humans has been used to detect Yersinia pestis DNA in 400-year-old human remains (Drancourt et al, 1998). Using dental pulp from S. salar or fish in general would be ideal because the DNA would be isolated from environmental contamination (Drancourt, 1998). This could prove very hard to apply on fish as their elongated teeth are not particularly large and each individual tooth would not necessarily contain enough amplifiable DNA. The dental pulp itself would require the encasing tooth to remain unerupted to avoid contamination and abiotic degradation (Drancourt, 1998). Nuclear DNA from the dental pulp is especially sensitive to decay (Higgins et al, 2015). Thus, mitochondrial primers and intact fish skulls would be possible requirements to transfer this method to fish.
Rarely found in archaeological settings, fins are more commonly used in modern times for barcoding and population studies (Díaz et al, 2019; Balazik et al, 2012). Fin clipping is a method used to non-invasively sample fins for these purposes and in a population conservation sense would be a preferred sampling method for existing species. DNEasy® Blood and Tissue kits have successfully extracted amplifiable DNA from O. nerka, once again showing that the DNA extracted from this study could perhaps with adjustments to PCR protocols and primers produce clean bands (Smith, 2011). Fresh fins can be expected to have higher extractable DNA concentrations compared to boiled fins, which would work for the advantage of preservation as these samples are rarely, if ever, found boiled. One notable exception would be shark fin soup. Whether shark fins and fish fins can be expected to withstand heat treatment to the same degree is dubious, since sharks are cartilaginous fish and S.
salar are bone fish and their fins have different structures. The differences in extractable
DNA concentrations could be due to boiled fins retaining the DNA rather than making it more accessible for extraction. Alternatively, boiled fins could be more elastic and resistant to crushing. Other methods where crushing is not required exist and could obtain different results.
5.2 PCR Troubleshooting
The gel electrophoresis resulted in smears for the M13-tailed CO1 primer pair after conducting PCR on fresh bone samples. Several protocol modifications were attempted to gain clean bands without notable results. Because the DNA extraction was successful it is likely elements during PCR that caused the smears. There could be several reasons for the smears, one being the primers.
The fragments produced by the primers were a concern. Fragments up to 500 bp targeting the CO1 gene have previously been produced by another study, not much smaller than the 654 bp fragments the M13-tailed primers used for this study should have produced (Ivanova, 2007). In contrast, the cee primers would have produced 969 bp long fragments had it succeeded. For samples with degraded DNA fragments below 400 bp originating from multiple-copy genes are preferable because they are simpler to detect due to more effective amplification (Parsons et al, 2005). Fresh or boiled DNA is not expected to be degraded to the extent ancient DNA would but the less sensitive option in a multiple-copy, mitochondrial gene still generated smears, indicating that an amount of amplification has occurred. Considering that temperatures from 58 °C down to 48 °C did not yield bands another choice of nuclear gene primer could be preferable. Aside from targeting different regions the main difference between the primers targeting CO1 was the presence of an M13-tail. 40 to 60 bp long tails increase sequence quality in (Binladen, 2018). However, the tails in this study were under 20 bp long, which may not be impactful enough.
Further examining the methodology, the extractions differ in the proteolysis step and PCR protocol. The proteolysis step for Piskata (2017) extended overnight rather than the 1 hour recommended by the manufacturer’s instructions, which we followed. Allowing proteolysis to work for longer would perhaps rid the muscle samples of excess proteins, which can obstruct PCR. Prolonged proteolysis could possibly remove excess proteins from bone, fish or scale samples as well. In this study a few samples were left incubating overnight but they were not applied to PCR due to time constraints. When the spin columns containing bone and fin samples were centrifuged tissue films covered the filtering membrane, obstructing passage for liquid unless the centrifugation was repeated several times. This could have prevented both chemicals and residue proteins from correctly filtering, instead remaining above the filter until the final elution. The responsible reagents would most likely be chemicals
Chemical contamination can be gauged by the A260/A230 ratio. 2.0 to 2.2 is the value
range acceptable samples would have (Matlock, 2015). Similarly, a Nanodrop measured A260/A280 ratio of 1.8 is mostly pure DNA and would be the desired outcome
(Matlock, 2015). The samples used in this study for PCR had A260/A280 ratios of 1.8 to
2.0, but the A260/A230 ratios were often lower than optimal. This could be due to poor
filtering and could affect the PCR and gel electrophoresis. However, poor ratios do not necessarily correlate with failed PCR amplifications because relatively little DNA is required for amplification (Piskata, 2017).
5.3 Limitations
Sample weight could affect the amount of extractable DNA, as muscle and scale samples weighted around 10 to 25 mg while the fin and bone samples were likely over those values. This could lead to an overestimation of extractable DNA from the latter two, as more mass involves more extractable DNA, thus inflating the numbers from fins and bones. The statistical test comparing tissues within the same treatment would be affected, as higher weight would give higher DNA concentrations. The comparisons between treatments would not be affected to the same degree because those compare the same tissues and whether they contain the same amount of DNA.
Tissue disintegration is not as serious a problem for genetical barcoding as it is for morphological identification. There are uncertainties as to what degree the harsh conditions tissues can withstand when buried in archaeological sites without affecting DNA integrity. Elevated temperature is one concern. Several tissues such as muscle, fins and scales disintegrate quite quickly in warmer climates compared to if they were stored in lower temperatures. A 2 °C temperature raise in soil causes a two-fold reduction of both nuclear and mitochondrial DNA half-lives in teeth (Higgins, 2015). Because the samples in this study were not repeatedly exposed for cycles of heat and cold, which would be a realistic scenario, the DNA extractions do not reflect the systematic exposure archaeological remains weather. This will contribute to an overestimation of DNA available for extraction from various tissues. Soil pH may further affect DNA stability. DNA decays at an increasingly faster rate when exposed to acidic pH compared to neutral pH (Allentoft, 2012). For an adequate DNA concentration comparison between fresh and aged tissues, additional DNA degradational aspects such as bacterial decomposition and sunlight need to be considered.
5.4 Conclusion
The conclusion is that while certain tissues do not differ in DNA concentration after being boiled prolonged exposure to abiotic factors constantly lower concentrations. Knowing that certain tissues have increased, decreased or the same amount of extractable DNA when boiled is useful because one can judge if DNA degradation has, in addition to abiotic factors, happened due to cooking. Buried bones would be expected to contain the same amount of extractable DNA regardless of treatment and eventual DNA degradation is due to abiotic factors rather than cooking. Similarly, cooked fin samples would be expected to contain less extractable DNA compared to fresh samples and if the samples were exposed to weathering the DNA degradation would partly be because of boiling. Because DNA degradation is common in aged remains it is important to consider that mitochondrial genes would be preferred before nuclear genes due to them being multiple-copy. Amplifying shorter fragments would be more viable on degraded DNA and thus primers would have to produce such fragments.
5.5 Societal and ethical aspects
Proper barcoding in animals is beneficial for several reasons. Inexpensive, reliable identification methods enable species verification of existing or extant species in industrial or archaeological contexts. For remains found in archaeological sites species identification can highlight the possible hunting grounds and habitation expansion of elder humanity. This can further our understanding of history from an ecological point of view. Industrial usage may utilize identification to verify whether a certain processed product contains the species it claims to and expose faulty claims, be they accidental or intentional.
6 Acknowledgements
I would like to thank my supervisor Jenny Hagenblad for her guidance and assurance and Linn Jarnehammar for the useful discussions.
7 References
Allentoft, E., Collins, M., Harker, D., Haile, J. Oskam, C.L., Hale, M.L et al. (2012) The half-life of DNA in bone: measuring decay kinetics in 158 dated fossils.
Asis, A.M.J.M, Lacsamana, J.K.M., Santos, M.D. (2016) Illegal trade of regulated andprotected aquatic species in the Philipines detected by DNA barcoding. Mitochondrial DNA, 27, 1, p 659-666. DOI:10.3109/19401736.2014.913138
Barta, J.L., Monroe, C., Crockford, S.J., Kemp, B.M. (2014) Mitochondrial DNA preservation across 3000-year-old northern fur seal ribs is not related to bone density: Implications for forensic investigations. Forensic Science International, 239, p 8-11. DOI : 10.1016/j.forsciint.2014.02.029
Balazik, M.T., McInich, S.P., Garman, G.C., Latour, R.J. (2012) Age and Growth of Atlantic Sturgeon in the James River, Virginia, 1997–2011. Transactions of
the American Fisheries Society, 141, 4, p 1074-1080. DOI:
10.1080/00028487.2012.676590
Binladen, J., Thomas, M., Gilbert, M.T.P., Campos, P.F, Willerslev, E. (2018) 5’-Tailed sequencing primers improve sequencing quality of PCR products. BioTechniques, 42, 2, p 174-176. https://doi.org/10.2144/000112316
da Silva, G. A., Bernardi, T. L., Carvalho Schaker, P. D., Menegotto, M., & Valente, P. (2012) Rapid Yeast DNA Extraction By Boiling And Freeze-Thawing Without Using Chemical Reagents And DNA Purification. Brazilian Archives and Technologies, 55, 2, p 319–327.
Díaz, C., Böhle, G., Wege, F., Teigeler, M., Eilebrecht, E. (2019) Fast Multiplex real time PCR method for sex-identification of medaka (Oryzias latipes) by non-invasive sampling. MethodsX, 6, p 587-593. DOI: 10.1016/j.mex.2019.03.011
Drancourt, M., Aboudharam, G., Signoli, M., Dutour, O., Raoult, D. (1998) Detection of 400-year-old Yersinia pestis DNA in human dental pulp: An approach to the diagnosis of ancient septicemia. Proceedings of the National Academy of Sciences of the United States of America, 95, 21, 12637-40. DOI: 10.1073/pnas.95.21.12637
Fernandes, J.M.O., Macqueen, D.J., Lee, H.-T., Johnston, I.A. (2008). Genomic, evolutionary, and expression analyses of cee, an ancient gene involved in normal growth and development. Genomics, 91, p 315–325. https://doi-org.e.bibl.liu.se/10.1016/j.ygeno.2007.10.017
Grealy, A., Douglass, K., Haile, J., Bruwer, C., Gough, C, Bunce, M. (2016) Tropical ancient DNA from bulk archaeological fish bone reveals the subsistence practises of a historic coastal community in southwest Madagaskar. Journal of Archaeological Science, 75, p 82-88. http://dx.doi.org/10.1016/j.jas.2016.10.001
Hafsa, A. B., Nabi, N., Zellama, M. S., Said, K., & Chaouachi, M. (2016). A new specific reference gene based on growth hormone gene (GH1) used for detection and relative quantification of Aquadvantage® GM salmon (Salmo salar L.) in food
products. Food Chemistry, 190, 1040–1045.
https://doi-org.e.bibl.liu.se/10.1016/j.foodchem.2015.06.064
Herrero, B., Vieites, J.M., Espiñera, M. (2011) Authentication of Atlantic salmon (Salmo salar) using real-time PCR. Food Chemistry. 127, 3, p 1268-1272.
https://doi.org/10.1016/j.foodchem.2011.01.070
Higgins, D., Rohrlach, A.B., Kaidonis, J., Townsend, G., Austin, J.J. (2015) Differential Nuclear and Mitochondrial DNA Preservation in Post-Mortem Teeth with Implications for Forensic and Ancient DNA Studies. PLoS One, 10, 5. DOI: 10.1371/journal.pone.0126935
Ivanova, N.V, Zemlak, T.S, Hanner, R.H., Hebert, P.D.N. (2007) Universal primer cocktails for fish DNA barcoding. Molecular Ecology Notes, 7, p 544-548. doi: 10.1111/j.1471-8286.2007.01748
Kolmann, M.A, Elbassiouny, A.A., Liverpool, E.A, Lovejoy, N.R. (2017) DNA barcoding reveals the diversity of sharks in Guyana coastal markets. Neotropical Ichthyology, 15, 4. DOI:10.1590/1982-0224-20170097
Lambrides, A.B.J., Weisler, M.I. (2015) Applications of vertebral morphometrics in Pacific Island archaeological fishing studies. Archaeology in Oceania, 50, 2, p 53-70. DOI: 10.1002/arco.5059
Matlock, B. (2015) Assessment of Nucleic Acid Purity. Thermo Fisher Scientific. USA.
https://assets.thermofisher.com/TFS-Assets/CAD/Product-Bulletins/TN52646-E-0215M-NucleicAcid.pdf [Accessed 15-04-2019]
Meissner, H., Fevolden, S.E., Amundsen, P.A., Praebel, K. (2013) Evaluation of three methods for high throughput extraction of DNA from challenging
fish tissues. Conservation Genetics Resources, 5, 3, p 733-735. DOI: 10.1007/s12686-013-9893-9
Mohan, D., Appa Rao, K.B.C., Dixit, A., Ali, S. (1994) Assessment of amplicons in the DNA from boiled tissue by PCR and AP-PCR amplification. Genetic Analysis: Biomolecular Engineering, 12, p 57-62.
Motalib Hossain, M.A., Uddin, S.M.K., Chowdhury, Z.Z., Sultana, S., Johan, Mohd Rafie et al. (2019) Universal mitochondrial 16S rRNA biomarker for mini-barcode to identify fish species in Malaysian fish products. Food Additives and Contaminants: Part A, 36, 4, p 493-506. Doi: 10.1080/19440049.2019.1580389
Muhammad, H., Iqbal, Z., Iqbal, M.U., Younas, T., Bashir, Q. (2016) An efficient method for DNA isolation from fish fin. Pakistan Journal of Agricultural Sciences, 53, 4 p 843-850. DOI:10.21162/PAKJAS/16.3998
Nicola, G.G., Elvira, B., Jonsson, B., Ayllón, D., Almodóvar, A. (2018) Local and global climatic drivers of Atlantic salmon decline in southern Europe. Fisheries Research, 198, p 78-85. DOI: 10.1016/j.fishres.2017.10.012
Parsons, K.M., Piertney, S.B., Middlemas, S.J., Hammond, P.S., Armstrong, J.D. (2005) DNA-based identification of salmonid prey species in seal faeces. Journal of Zoology, 266, 3, p 275-281. DOI: 10.1017/S0952836905006904
Piskata, Z., Pospisilova, E., Borilova, G. (2017) Comparative study of DNA extraction methods from fresh and processed yellowfin tuna muscle tissue. International Journal of Food Properties, 20, p 430-443. DOI: 10.1080/10942912.2017.1297953
Smith, M.J., Pascal, C.E., Grauvogel, Z., Habicht, C., Seeb, J.E., Seeb, L.W. (2011) Multiplex preamplification PCR and microsatellite validation enables accurate single nucleotide polymorphism genotyping of historical fish scales. Molecular Ecology Resources, 11, 1, p 268-277. DOI: 10.1111/j.1755-0998.2010.02965.x
Thermo Fisher. (No date available) PCR Troubleshooting Guide. https://www.thermofisher.com/se/en/home/life-science/cloning/cloning-learning- center/invitrogen-school-of-molecular-biology/pcr-education/pcr-reagents-
enzymes/pcr-troubleshooting.html?fbclid=IwAR3ovy31ZejKIBZRqq_aS3NRoFw70sNVzng59Vn BPp-ngTz_orSU21zh1UE [Accessed 20-05-2019]
Turanov, S.V., Kartavtsev, Y.P., Zemnukhov, V.V., Balanov, A.A., Lipinsky, V.V., Lee, Y.H., Jeong, D. (2016) DNA-barcoding of perch-like fishes (Actinopterygii: Perciformes) from far-eastern seas of Russia with taxonomic remarks for some groups. Mitochondrial DNA, 27, 2, p 1188-1209. DOI: 10.3109/19401736.2014.945525
QIAGEN. (2006) DNEasy® Blood & Tissue Handbook.
Xing-Xing, S. Liang, D., Zhang, P. (2012) The Development of Three Long Universal Nuclear Protein-Coding Locus Markers and Their Application to
Osteichthyan Phylogenetics with Nested PCR. PLoS One.
doi:10.1371/journal.pone.0039256
Yang, D.Y, Cannon, A., Saunders, S.R. (2004) DNA species identification of archaeological salmon bone from the Pacific Northwest Coast of North America.
Journal of Archaeological Science, 31, 5, p 619-631.
https://doi.org/10.1016/j.jas.2003.10.008
Weigt, L.A., Driskell, A.C., Baldwin, C.C., Ormos, A. (2012) DNA Barcodes: Methods and Protocols. Humana Press, 858, p 109-126. DOI: 10.1007/978-1-61779-591-6_6
8 Appendix
Table 2. Compilation of the samples and their respective treatments, weights, nucleic acid concentration and NanoDrop ratios.
Treatment Tissue Sample Weight (mg) Nucleic acid concentration (ng/ul) A280/A260 A260/230 Boiled Muscle 1 10 556.9 2.02 1.03 Boiled Muscle 2 20 405.3 2.11 1.96 Boiled Muscle 3 10 195.6 2.09 2.25 Boiled Muscle 4 10 305 2.13 2.07 Boiled Muscle 5 20 458.9 2.13 2.15 Boiled Muscle 6 15 393.2 2.13 2.3 Fresh Muscle 1 20 106.3 2.13 2.35
Fresh Muscle 2 10 130.7 2.14 2.42 Fresh Muscle 3 20 49.3 2.11 1.99 Fresh Muscle 4 15 72.6 2.09 2.22 Fresh Muscle 5 15 65.9 2.07 2.34 Fresh Muscle 6 10 178.3 2.11 2.33 Boiled Scales 1 10 114.2 2.06 2.3 Boiled Scales 2 10 99.6 2.1 2.27 Boiled Scales 3 10 138.9 2.07 2.23 Boiled Scales 4 10 128.4 2.06 2.23 Boiled Scales 5 20 112.8 2.06 2.26 Boiled Scales 6 10 153.4 2.11 2.07 Boiled Bones 1 * 180.5 1.47 0.25 Boiled Bones 2 * 215.9 1.21 0.24 Boiled Bones 3 * 273.3 1.66 0.33 Boiled Bones 4 * 198.8 1.33 0.26 Boiled Bones 5 * 75.9 1.66 0.3 Boiled Bones 6 * 133.7 1.78 0.41 Fresh Bones 1 * 167 1.85 0.55 Fresh Bones 2 * 84.9 1.73 0.36 Fresh Bones 3 * 103.2 1.93 0.75 Fresh Bones 4 * 95.9 2.06 0.27 Fresh Bones 5 * 136.9 1.79 0.27 Fresh Bones 6 * 94.2 1.86 0.4 Boiled Fins 1 ** 90.4 1.93 0.23 Boiled Fins 2 ** 53.3 2.03 0.26 Boiled Fins 3 ** 57.8 2.19 0.29 Boiled Fins 4 ** 35.9 2.1 0.24 Boiled Fins 5 ** 28.6 2.17 0.27 Boiled Fins 6 ** 72.2 1.98 0.23 Fresh Fins 1 ** 77.5 1.9 1.91 Fresh Fins 2 ** 219.9 2.01 2.21 Fresh Fins 3 ** 141.4 1.99 2.19 Fresh Fins 4 ** 170.2 2.08 2.23
Fresh Fins 5 ** 171.8 2.01 2.03
Fresh Fins 6 ** 55.8 1.99 2.74
* Weight not indicated due to each sample consisting of one vertebra.
