The role of MCT1 and MCT4 in astrocyte lactate efflux

UPTEC X 08 048

Examensarbete 30 hp Oktober 2008

The role of MCT1 and MCT4 in astrocyte lactate efflux

Sepideh Lalehzari

Molecular Biotechnology Programme

Uppsala University School of Engineering

UPTEC X 08 048 Date of issue 2008-10 Author Sepideh Lalehzari

Title (English)

The role of MCT1 and MCT4 in astrocyte lactate efflux

Title (Swedish)

Abstract

Monocarboxylate transporters (MCTs) are a family of 14 members which are involved in the transport of lactate, pyruvate and ketone bodies. MCT1, 2 and 4 have been associated with lactate transport in the brain, MCT1 and MCT4 being responsible for the lactate efflux from astrocytes, and MCT2 responsible for the uptake of lactate into neurons. The transport of lactate is of interest because lactate has been shown to be an important energy substrate for neurons during activity. During neuronal activity, the transport of glucose directly into neurons is inhibited and astrocytes provide neurons with lactate as an alternative energy source, through a system called the “Astrocyte-neuron lactate shuttle” (ANLS). The transport of lactate and the function of MCTs are of interest because a link between cognitive impairment (a major symptom of Alzheimer’s disease) and reduction in energy metabolism in the brain has been established, as well as evidence suggesting that neurons are able to take up and utilise lactate as efficiently as glucose. In this project, the function of the MCTs in the brain is explored. Specifically, the role of the astrocyte-specific MCTs (1 & 4) is investigated by siRNA-mediated knockdown experiments. In addition, experiments to validate antibodies against the known MCTs in the brain (MCTs 1, 2 and 4) are performed.

Keywords

MCT, ANLS, Lactate transport, neuronal energy metabolism, antibody validation, siRNA knockdown

Supervisors Natalie Tigue GlaxoSmithKline

Scientific reviewer Mikael Thollesson

Institutionen för evolution, genomik och systematik , Uppsala Universitet

Project name Sponsors

Language English ^Security

ISSN 1401-2138 Classification

Supplementary bibliographical information

Pages 37

Biology Education Centre Biomedical Center Husargatan 3 Uppsala

Box 592 S-75124 Uppsala Tel +46 (0)18 4710000 Fax +46 (0)18 555217

The role of MCT1 and MCT4 in astrocyte lactate efflux

Sepideh Lalehzari

Sammanfattning

Glukos har länge ansets vara den energikälla som nervcellerna i hjärnan använder.

Men under senare år har laktat visat sig spela en stor roll i energimetabolismen i hjärnan, speciellt då nervcellerna är aktiva. Eftersom laktat inte kan tas upp direkt från blodet, får nervcellerna laktat via stödceller, astrocyter, genom ett system kallat Astrocyte Neuron Lactate Shuttle (ANLS). Laktattransporten mellan astrocyter och nervceller sker via specifika cellmembranproteiner som kallas monokarboxylate transporter (MCT).

MCT är en familj med fjorton medlemmar delaktiga i transporten av laktat, pyruvat och ketonkroppar. MCT befinner sig i de flesta organ i kroppen, såsom njuren, hjärtat och blodkärlen, men även hjärnan där man har hittat tre av dessa, nämligen MCT1, 2 och 4. MCT2 har hittats i nervceller ansvarig för laktatinflödet medan MCT1 och MCT4 befinner sig i astrocyter och är ansvariga för laktatutflödet.

Syftet med detta examensarbete var att validera antikroppar mot de tre MCT i hjärnan samt med hjälp av small interfering RNA-metoden, ta reda på MCT1 och MCT4 funktion i astrocyters laktatutflöde. Small interfering RNA-metoden går ut på att med hjälp av korta, specifika och komplimenterande RNA sekvenser degradera relevant mRNA. Följden blir att inget protein bildas och därmed kan proteinets funktion studeras i dess frånvaro.

Examensarbete 30hp

Civilingenjörsprogrammet Molekylär bioteknik

Uppsala universitet oktober 2008

Table of Content

Abbreviations...3

1. Introduction...4

1.1 Background...4

1.1.1 Alzheimer’s disease (AD) and neuronal anatomy ...4

1.1.2 Cells in the central nervous system...4

1.1.3 Energy metabolism in the brain and ANLS...5

1.1.4 Monocarboxylate transporters ...7

1.2 Aim of this project ...8

2. Material and methods...9

2.1 Cell culture...9

2.1.1 HEK 293 (MSRII) cells ...9

2.1.2 Rat cortical astrocytes...9

2.1.3 Cell viability determination ...9

2.1.4 Cell fixing and staining...10

2.2 Transfection ...10

2.3 Post-transfection ...10

2.3.1 Cell harvest ...10

2.3.2 Protein analysis ...10

2.3.2.1 Protein extraction ...10

2.3.2.2 Protein concentration determination...11

2.3.2.3 Western blot...11

2.3.3 Transcriptional profiling ...11

2.3.3.1 RNA extraction ...11

2.3.3.2 cDNA conversion...12

2.3.3.3 TaqMan...12

2.3.3.4 96-well format RNA extraction, cDNA conversion and TaqMan...12

2.3.4 Amplex Red Lactate Oxidase Assay...12

2.4 Tables...13

3. Results...15

3.1. Validation of MCT antibodies ...15

3.1.1. Transfection Optimisation of HEK 293 cells...15

3.1.2. Validation of antibodies against MCT1 and MCT2 ...18

3.1.2.1 MCT1...18

3.1.2.2. MCT2...20

3.2. siRNA knockdown of MCT1 and 4 in rat astrocytes...21

3.2.1. Transfection Optimisation of astrocytes ...21

3.2.2. Validation of different siRNAs for MCT1 and MCT4 ...24

3.2.3 Extended transfection period ...27

4. Discussion ...32

4.1 Validation of MCT antibodies ...32

4.2 siRNA knockdown of MCT1 and MCT4 in rat astrocytes...32

5. Acknowledgements...34

6. References...35

Abbreviations

AD Alzheimer’s disease

ANLS Astrocyte Neuron Lactate Shuttle

CSF Cerebrospinal fluid

GS GeneSilencer

LDH Lactate dehydrogenase

L2K Lipofectamine 2000

MCT Monocarboxylate transporter

mRNA Messenger RNA

NFT Neurofibrillary tangles

NP Neuritic plaques

qRT-PCR Quantitive real time polymerase chain reaction

siRNA Small interfering RNA

TCA cycle Tricarboxylic acid cycle

1. Introduction

1.1 Background

1.1.1 Alzheimer’s disease (AD) and neuronal anatomy

Alzheimer’s disease (AD) is a common form of degenerative dementia, representing half of the cases of progressive dementia in the elderly. Starting with a brief loss in short term memory, the disease develops giving rise to more severe conditions of cognitive impairment. Morphological studies of AD brains have revealed the existence of neuritic plaques (NP) and neurofibrillary tangles (NFTs) in the hippocampus, a region of the brain involved in learning and memory. Neuritic plaques are extracellular deposits of amyloid in the brain associated with deformation of glia cells in relevant areas and neurofibrillary tangles (NFTs) are protein aggregates formed within neurons [19].

In early stages of AD, amyloid protein (the main constituent of neuritic plaques) in the neurons converts into a toxic form which initially damages the mitochondria in the synapse of the neurons leading to a reduction in energy metabolism. The secreted amyloid then covers the entire synaptic terminal of the neurons preventing them from secreting neurotransmitters, resulting in the neuronal death. At the same time, the microfilaments in neurons that are responsible for the transport of the mitochondria and important energy substrates to the synaptic termini are phosphorylated. The phosphorylation of microfilaments prevents transport of nutrition from the cell soma to the synapse also leading to neuronal dysfunction [15].

In addition it is known that, in AD brains, there are biochemical abnormalities, including a reduction in glucose metabolism in the hippocampus which has been observed through imaging of the hippocampus from AD patients [11]. A reduction in cognitive impairment can be achieved by treating patients with glucose, further supporting the notion that metabolic activity of the brain can affect such important functions as learning and memory [8].

1.1.2 Cells in the central nervous system

The nervous system is constructed of two type of cells; neurons and glial cells.

Neurons are responsible for the information processing part of the nervous system, and are composed of three main parts; a cell soma, an axon and numerous dendrites.

The cell soma is the main part of the neuron and works as a control centre. Dendrites are branched parts which help to extend the surface area of the neuron and are mainly responsible for receiving signals from neighbouring neurons. Each neuron contains a single axon, which is connected to a special part of the soma body named the axon hillock, and is responsible for the outgoing signals to other neurons [13].

Communication between neurons is in a form of neurotransmitter release from one

neuron to another through the synaptic space. The synapse is located at the terminus

of each axon and dendrites. The term presynapse refers to the synapse on the axon where the neurotransmitters are released and postsynapse refers to the synapse on dendrites were the neurotransmitter receptors are located [17].

Neurons represent approximately 10% of all the cells in the nervous system. The remaining cells in the nervous system are glia, which act as supporting cells. Three types of glial cell are present in the central nervous system; oligodendrocytes, ependymal cells, microglia and astrocytes [13]. Microglias have an immune function in the brain and are responsible for the removal of dead and unrecognized cells in the brain. Ependymal cells are responsible for both recovering and replacing cells in the brain as well as producing cerebrospinal fluid (CSF) in the ventricles.

Oligodendrocytes envelope the axons and act as protection [2]. Finally, astrocytes are star shaped cells with projections wrapped around neurons and/or blood vessels. In addition to the protecting properties of these cells, astrocytes are responsible for providing neurons with energy substrates from the circulation as well as maintaining the homeostasis of the extracellular fluid. Astrocytes communicate with neurons through chemical signalling and with each other through gap junctions [6].

1.1.3 Energy metabolism in the brain and ANLS

The fact that glucose is the main energy substrate for neurons is well established.

However, during the last few decades, the role of lactate as a link between glucose utilization and neuronal activity has generated growing interest. Different studies have shown that lactate is oxidized within the brain and can maintain neuronal activity as well as glucose [3]. Experiments have also shown that lactate is more cell-specific in the sense that it only gets utilised in neurons whereas glucose can be utilised both in astrocytes and neurons [1].

Lactate is metabolised from pyruvate by the enzyme lactate dehydrogenase (LDH), which also catalyses the reverse reaction. LDH isomers are comprised of four subunits of two different subunits: H- and M-type. Different studies have shown that the distribution of LDH in neurons differs from that in astrocytes. The isoform LDH1 seems to exist in a greater amount in neurons compared to astrocytes. In contrast, LDH5 is found in higher concentrations in astrocytes [7]. These two isomers differ structurally in that LDH1 is mainly comprised of four H subunits while LDH5 is constructed of four M subunits [12]. It is known that the M-type subunit is necessary for the forward reaction of lactate production [7] , suggesting that astrocytes are likely to be involved in the process of lactate production whereas the subunit composition of the neuronal LDH implies a role in lactate metabolism.

A model which may explain the findings above has been suggested and is called the Astrocyte Neuron Lactate Shuttle (ANLS), as it relates to the flux of lactate from astrocytes to neurons to provide energy during high neuronal activity, when energy from the neuron itself is in low supply.

According to this model (Figure 1), glutamate is released upon activation of

glutamergic neurons, leading to activation of AMPA receptors in neurons which

inhibits the influx of glucose into the cell by shutting down the glucose receptors,

needs replacing and this is proposed to be through astrocyte-derived lactate in the following way. The secreted glutamate is taken up by astrocytes through Na ⁺ transporters, i.e. the Na ⁺ / K ⁺ ATPase are activated in the astrocyte which further stimulates the utilisation of glucose in the astrocytes through glycolysis. From this glucose metabolism, lactate is produced and subsequently transported out of the cell into the extracellular fluid [9]. The glutamergic neurons then take up this lactate and utilise it during neuronal activity through the metabolism to pyruvate which then enters the TCA cycle where ATP is produced [16]. For every glutamate molecule imported into the astrocyte, one glucose molecule is then transported into the cell from which two lactate molecules are formed, making the utilisation of precious glucose more efficient [9].

Figure 1: A schematic figure of ANLS theory. Glucose is the main energy supply for neurons during rest (step 1). When neurons are activated, glutamate is released leading to activation of AMPA receptors which inhibits the glucose influx (Step 2 & 3).The secreted glutamate is taken up by astrocytes through Na ⁺ transporters. In doing so, the Na ⁺ / K ⁺ ATPase are activated in the astrocyte.

This further stimulates the utilisation of glucose in the astrocytes through glycolysis where lactate is

produced (step 5 & 6 ) and transported out to the extracellular fluid through MCT1 & 4. Lactate is

then taken up by neurons through MCT2 and is utilised during activity (step 7).

1.1.4 Monocarboxylate transporters

Since lactate is a hydrophilic substrate and can not diffuse through the cell membrane, specialised transporters are required for the efflux and influx of lactate out of the astrocytes and into the neurons. One family of transporters that are known to transport lactate is the monocarboxylate transporters (MCTs) [14].

The monocarboxylate transporter (MCT) family contains 14 members, of which MCTs 1-4 have been shown to be involved in the transportation of lactate, pyruvate and ketone bodies and are highly cell specific proteins. Less information is available for the function and location of the other members.

Structurally, all transporters have a 12 transmembrane helical domain where the N-, C- terminals and a large loop between transmembrane loop 6 and 7 are intracellular.

Differences between MCTs are mainly in these areas, while the transmembrane areas are conserved in all MCTs [5,20]. Transportation of monocarboxyl groups by MCT1- 4 occurs through a proton symport mechanism, where the MCT initially binds a proton, making the lactate anionic and changing the conformation of the transporter, allowing both the molecules across the membrane [14].

To function properly, MCT1 and 4 require a cofactor protein called basigin (CD147) and MCT2 requires embigin (gp70), which is a homologue of CD147. These two cofactors are glycoproteins involved in the transport of MCTs from the cytoplasm to the cell membrane. Both cofactor proteins consist of a common transmembrane domain with an extracellular N-terminal and a cytocolic C-terminus that differ slightly in sequence. As well as assisting the MCT to reach its correct cellular location, the presence of these cofactors is also required for activity of the MCTs [10,20].

The expression of MCTs 1, 2 and 4 has been demonstrated in the hippocampus of the brain and more specifically MCT2 expression has been shown to be limited to neurons, and MCTs 1 and 4 to astrocytes [14]. The localisation and kinetic properties of the three MCTs described point to a role of MCTs 1 and 4 in astrocytic lactate efflux, and MCT2 in neuronal lactate uptake, in the astrocyte-neurone lactate shuttle.

In addition to the different expression profiles of each MCT, they also have different

properties and functions afforded by their kinetic properties. MCT1 and MCT4 have

shown to have a higher K m value for lactate than MCT2. This means that MCT1 and

MCT4 have a low affinity for lactate, making them more suitable for lactate efflux

while MCT2 with its low K m , is suitable for lactate influx [18].

1.2 Aim of this project

As mentioned previously, a connection between Alzheimer’s disease and energy metabolism in the hippocampus has been postulated. A closer investigation into energy metabolism in the brain, in particular the astrocyte-neuron lactate shuttle, will further help to develop new approaches to prevent the cell death observed in AD.

Since little is known about the entire MCT family and the function of each member separately, this project will investigate the role of MCT1 and MCT4 in lactate efflux from rat astrocytes. It is anticipated that the results from these experiments will determine whether these two MCTs are the only transporters involved in astrocytic lactate efflux, and if that is the case, which one plays the critical role.

The experiments to be performed will utilise siRNA technology to knock down the level of each MCT mRNA (individually and in combination) in rat astrocytes. In order to do this successfully, it will be necessary to determine the optimal transfection reagent for astrocytes as they are primary cells and thus more difficult to manipulate compared to established cell lines. Also, three different siRNAs for each MCT will be tested in order to determine which one is most efficient at knockdown. The level of MCT mRNA will be determined by Taqman (quantitative real time polymerase chain reaction (qRT-PCR)) and measurements of protein level will be assessed by Western blot. The effect of MCT knockdown on lactate efflux will also be tested by measuring the level of lactate in the media.

In order to determine the amount of each MCT at the protein level, specific antibodies

must be used. At the time of starting this project, attempts to identify specific

antibodies for each of the MCTs involved in the ANLS had failed. Therefore,

identification of specific antibodies was a key aspect of this project. Using a cell line

expressing the MCT of interest is one way of providing a positive control for such

studies. Therefore, the optimisation of the transfection conditions for the transient

expression of MCTs in an easy to manipulate cell line (HEK 293) was performed, and

the resulting cell lines were used in order to validate a number of antibodies for

MCT1, 2 and 4.

2. Material and methods

2.1 Cell culture

2.1.1 HEK 293 (MSRII) cells

HEK 293 cells were maintained in T75 flasks containing DMEM/F-12 medium (Invitrogen, 21331-020) supplemented with 10% fetal bovine serum (HI FBS, Invitrogen,) and 1% L-glutamine (Invitrogen) in a humidified atmosphere containing 5% CO 2 at 37 ^◦ C. When the cells reached confluency they were passaged (1:10) by treatment with a cell detachment reagent, Accutase (Sigma). The cells were washed twice with 20 ml PBS, followed by treatment with 3 ml of Accutase for 5 minutes at 37 ^◦ C. Seven ml of media was added and the cells spun down (1000 rpm for 5 min) to pellet the cells. The cells were resuspended in media and one tenth of the cells were added to a T75 flask containing fresh media.

Confluent cells were dissociated as described above, twentyfour hours prior to transfection. The number of cells was determined using a CEDEX instrument and the required number of cells was seeded onto the appropriate plasticware into fresh media.

2.1.2 Rat cortical astrocytes

Cortical astrocytes from postnatal day 0-2 Sprague Dawley rats (GSK Laboratory Animal Facility, Harlow) that had been grown in vitro for 14 days were provided.

Astrocytes were maintained in “enriched medium” which comprises MEM medium (Invitrogen, GIBCO, 51200-046) including 4mM L-glutamine (Invitrogen), 25mM glucose (Sigma), 10% fetal bovine serum (HI FBS, Invitrogen, GIBCO) and 1%

Penicillin/Streptomycin (Invitrogen) in a humidified atmosphere containing 10% CO 2

at 37 ^◦ C. Twenty-four hours prior to use, the cells were dissociated using 10 ml trypsin in PBS (1:10 dilution) (Invitrogen) for 5 minutes. 40 ml of media was added, and the cell suspension was spun down. The cells were resuspended in 10 ml of enriched media and counted using the CEDEX instrument. The required number of cells were then placed into the appropriate plates containing enriched media.

2.1.3 Cell viability determination

The viability of cells following transfection was tested using the Cell Proliferation

Reagent WST-1 kit (Roche), exactly as stated in the manufacturer’s protocol. The

absorbance was measured by spectrophotometer (Wallac VictorV) at 450 nm.

2.1.4 Cell fixing and staining

Cells were fixed using 4% paraformaldehyde for 10 minutes, followed by 3 washing steps with PBS. Staining of the cell nuclei was performed using 0.2% Hoechst stain (Invitrogen). The cells were then visualised under the microscope (Olympus) and analysed with the Cell ^F (Soft imaging system, Olympus).

2.2 Transfection

All transfections were performed according to the manufacturer’s instructions.

Briefly, for Lipofectamine 2000 (Invitrogen) and GeneSilencer (Genlantis), the DNA and transfection reagents are incubated in Opti-MEM media separately for 5 minutes prior to mixing and further incubation for a further 20 minutes. For FuGene HD, the DNA and transfection reagent were mixed together in the first instance, followed by a 15 min incubation. The transfection complexes were then added to the cells of interest, either directly to cells in normal media (in the case of HEK cells) or to cells in opti-MEM (for astrocytes). Cells were incubated for the required amount of time prior to cell harvest. In some instances, the transfection complex-containing media was removed and replaced with normal media after 4-6 hours incubation.

2.3 Post-transfection

2.3.1 Cell harvest

Following transfection, the cells were harvested in order to extract protein and/or RNA for subsequent analyses. In some instances, the cells were detached using Accutase (HEK cells) or trypsin (rat astrocytes) as described above using the appropriate volumes of reagents. The cell pellets were washed twice with PBS and then resuspended in the appropriate volume of protein or RNA extraction buffers (see later). In other instances, the cells were lysed directly in the cell culture plate using either protein or RNA extraction buffers.

2.3.2 Protein analysis

2.3.2.1 Protein extraction

Cells were solubilised using a lysis buffer, RIPA buffer (Sigma), containing protease

inhibitors (10 ml RIPA buffer + one protease inhibitor cocktail tablet (Complete Mini,

EDTA-free)). Samples were centrifuged for two minutes at 14000 rpm to remove the

cell debris, and the supernatant was transferred to new tube and processed

immediately or stored at -20 ^◦ C for future analyses.

2.3.2.2 Protein concentration determination

The protein content of each cell lysate was measured using the Pierce BCA Protein Assay Kit (Thermo scientific), using bovine serum albumin (BSA) as a protein standard, exactly according to the manufacturer’s protocol. Where necessary a ten- fold dilution of each cell lysate was used. The absorbance was measured by the Spectra Max Plus at 450 nm and the results were analysed with Softmax Pro software.

2.3.2.3 Western blot

Ten µg of each cell lysate was prepared in a final volume of 40 µl containing 4 µl sample reducing agent (10x) (NuPAGE, Invitrogen), 10 µl LDS sample buffer (4x) (NuPAGE, Invitrogen) and nuclease free water (Ambion) and heated for 10 min at 80 ^◦ C. Samples were loaded on 1.5mm x 10well 4-12% Bis-Tris Gel (Novex, NuPAGE, Invitrogen) and run for one hour and thirty minutes at 150 V in the presence of MOPS SDS running buffer (NuPAGE, Invitrogen) and 500 µl antidioxidant (NuPAGE, Invitrogen) in the middle chamber. The molecular weights were determined by comparison to the Protein Molecularweight Marker (Odyssey, LI- COR) which was loaded on the same gel.

Gels were blotted using the iBlot Dry Blotting System (Invitrogen) using the Regular iBlot Gel transfer Stacks Nitrocellulose kit (Invitrogen). The membrane, containing the transferred proteins, was blocked using a solution containing 50% Blocking buffer (Odyssey, LI-COR) and 50% PBS pH 7.4 for one hour at room temperature or alternatively at 4 ^◦ C overnight. Primary and secondary antibodies were diluted in a solution of 50% Blocking buffer (Odyssey, LI-COR), and 50% PBS pH 7.4 0.2%

Tween 20 (Sigma) before adding to the membrane. Each antibody incubation was performed for one hour in room temperature or at 4 ^◦ C overnight followed by four times five minutes washes of the membrane by 0.1% Tween 20 (Sigma) in PBS pH 7.4. The final wash was done in only PBS pH 7.4 prior to scanning of the membrane by the Odyssey scanner (Odyssey, LI-COR) and analysed with Odyssey 2.1 software (Odyssey, LI-COR).

2.3.3 Transcriptional profiling 2.3.3.1 RNA extraction

Cells were solubilised using, RLT lysis buffer (Qiagen) containing 1% β-

mercaptoethanol and the RNA was extracted using the RNeasy mini kit (Qiagen)

following “Animal Cell Spin Technology” protocol. For the lysis homogenization

step, QIAshredder spin columns (Qiagen) were used and the optional “Elimination of

genomic DNA contamination” with DNAse digestion step was performed. After

RNA purification, the concentration of RNA was detected using the NanoDrop

instrument. A subsequent additional DNAseI-treatment with the DNA-free kit

(Ambion) was also performed.

2.3.3.2 cDNA conversion

cDNA was synthesised using the Quantitech reverse transcription kit (Qiagen).

Reverse transcription was performed in triplicate reactions together with one “minus reverse transcriptase” negative control.

2.3.3.3 TaqMan

Taqman was performed in a final reaction volume of 25 µl as follows:

5 µl cDNA

12.5 µl Taqman 2 x PCR Master Mix (Applied Biosystems) 2.5 µl primer and probe mix

5 µl Nuclease-Free water (Ambion).

The primer and probe mix contains 9 µM forward primer, 9 µM reverse primer and 1µM probe, each primer and probe targeting the relevant sequence. Samples were run on the ABI PRISM 9700 instrument (Applied Biosystems), in optical reaction plates (ABI PRISM, Applied Biosystems) using the following cycling parameters:

95 ^◦ C for 15 seconds

60 ^◦ C for one minute, 40 cycles

Results were analysed using 7000 system SDS software (Applied Biosystems).

Subsequently, the copy number for each sample was calculated, the “minus reverse transcriptase” value subtracted and the resulting target copy number was divided by the GAPDH copy number, correcting for cell number. An average of the 3 replicates was calculated and plotted using the Prism 4 software (GraphPad Software Ltd).

2.3.3.4 96-well format RNA extraction, cDNA conversion and TaqMan

For rat astrocytes siRNA experiments that were performed in 96-well plates, RNA was extracted from cell lysates using the Qiagen BioRobot Universal System. For cDNA synthesis 10 µl of RNA samples were transferred to new microplates and the RT-PCR were run with ABI GeneAmp PCR System 9700 thermal cycler. Two microliter cDNA samples were then transferred to a 384-well plate for Taqman as described above.

2.3.4 Amplex Red Lactate Oxidase Assay

For measurement of lactate from the media of rat astrocytes, it was necessary to

change the medium to one that contained less serum, as serum contains a high amount

of lactate, and would reduce the signal to background ratio. Thus, 6 hours prior to

removal of the media for lactate measurement, the media was changed to basal

medium containing MEM medium (Invitrogen, GIBCO, 51200-046) including 5 mM

glucose(Sigma), 1% fetal bovine serum (HI FBS, Invitrogen, GIBCO) and 1%

Penicillin/Streptomycin (Invitrogen), 19 mM NaHCO 3 . In cases where L-glutamate should be present, 5 mM L-glutamine (Invitrogen) was added to the medium.

In order to accurately quantitate the level of lactate in the media, lactate standards were used (six between 0-1nmoles and six between 1-10 nmole, prepared according to the lactate assay kit (Biovision)). For the standards 20µl assay buffer (sodium phosphate (Sigma)) and 25 µl basal media was added to each standard sample. For the samples 25 µl of the media collected from the treated astrocytes were transferred to a microplate and 25 µl sodium phosphate buffer (SIGMA) was added to each well.

Fifty microliter of a solution mix containing: 50 mM sodium phosphate buffer (SIGMA), 2 U Lactate oxidase (Applied Enzyme Technologies), 0.2 U Horse radish Peroxidase (Pierce) and 250 µM Amplex Red (Invitrogen) were added to both standard and testing samples. The absorbance was measured by spectrophotometer (VictorV) at 590 nm. Results were analysed by Wallac 1420 Manager (Wallac software).

2.4 Tables

Table 1: Transfection reagents used in this project

Transfection reagent Company suitable for

FuGene HD Roche Plasmid

Lipofectamine 2000 Invitrogen Plasmid, siRNA

Lipofectamine RNAiMAX Invitrogen siRNA

GSK 250190 GSK siRNA

GeneSilencer Genlantis siRNA

Table 2: siRNAs validated for siRNA knock down of MCT1 and MCT4 siRNA (Invitrogen) sequence

MCT1

1 = SLC16A1RSS302946 GCGGUGGUAGUUGGAGCCUUCAUUU 2 = SLC16A1RSS302947 CCUCUCUACCCUGGCUCCACUUAAU 3 = SLC16A1RSS302948 GGCACCUUUGUCUACGACCUAUGUU

MCT4

1 = SLC16A3RSS330603 GGACGCAACGAAAGUUUACAAGUAU

2 = SLC16A3RSS330604 UCUACCUCUUCAGCUUUGCCAUGUU

3 = SLC16A3RSS330605 CGGCAGGUUUCAUAACAGGGCUCAA

Table 3: Primer and probes used for Taqman RT-PCR

Target Primer Sequence (5´-3´) Probe (5´-3´)

GAPDH Forward CAAGGTCATCCATGACAACTTTG Reverse GGGCCATCCACAGTCTTCTG

ACCACAGTCCATGCCATCACTGCCA

GFP Forward CTGCTGCCCGACAACCA Reverse TGTGATCGCGCTTCTCGTT

TACCTGAGCACCCAGTCCGCCCT

rat MCT1 Forward GCATCTACGCGGGAGTCTTT Reverse AGGTCCATCAACGTCTCAAACA

TTTGCCTTTGGTTGGCTCAGCTCC

rat MCT4 Forward TTTCATCATCACGGGCTTCTC Reverse CATGCATGAGCTCCTTGAAAAA

TATGCCTTCCCCAAAGCGGTCAGTG

rat MCT2 Forward CAATCATGTTCACTGGCATATGC

Reverse AACGTAGACCACCAAAGCTGTGT

CTCCTCTGCCCCCTAGCCCATTCC

Table 4: Antibodies used in western blot experiments

no Target Company Product Species

Raised

in Dilution in 10mls 2o Ab (Odyssey) 2 MCT1 SCBT sc-50324 H Rabbit 1:200 50 μl goat a-rabbit 680 4 MCT1 SCBT sc-14917 R Goat 1:200 50 μl donkey a-goat 800 5 MCT1 Millipore AB3540P R Rabbit 1:500 20 μl goat a-rabbit 680

5 MCT2 Millipore AB3542 R, m Rabbit 1:500 20 μl goat a-rabbit 680 6 MCT2 SCBT sc-14926 M, r Goat 1:200 50 μl donkey a-goat 800 7 MCT2 SCBT sc-50323 M, r Rabbit 1:50 200 μl goat a-rabbit 680

2 MCT4 SCBT sc-14932 H +R Goat 1:200 50 μl donkey a-goat 800 5 MCT4 SCBT sc-50329 H, R, M Rabbit 1:200 50 μl goat a-rabbit 680 6 MCT4 USB M4470-29B H, R, M Rabbit 1:500 20 μl goat a-rabbit 680

1 MCT5 Abcam ab11110 H Goat 1:500 20 μl donkey a-goat 800 2 MCT5 Millipore AB3318P H Rabbit 1:250 40 μl goat a-rabbit 680 3 MCT5 USB M4470-40A H Rabbit goat a-rabbit 680

N/A V5 Serotec MCA 1360 N/A Mouse 1:5000 2 μl goat anti-mouse 800

N/A Tubulin Sigma T5168 H Mouse 1:5000 2 μl goat anti-mouse 800

3. Results

3.1. Validation of MCT antibodies

In order to assess the extent of knockdown of a particular target of interest at the protein level, it is essential that a specific antibody is used. For the MCT proteins studied in this project, the only transporter for which a specific antibody has already been identified is MCT4. For the MCT1 and MCT2 proteins, specific antibodies were yet to be found. In order to identify such specific antibodies, a cell line that endogenously expresses the protein of interest could be used as a positive control. A more unambiguous way of identifying a specific antibody to a protein, however, is to overexpress the protein of interest in a cell line that is easy to transfect (eg HEK 293 cells), using non-transfected cells as a negative control. In this way, it is easy to identify the protein that has been overexpressed. In order to do this, however, it is necessary to optimise the delivery of the protein-encoding plasmid to the chosen cell line. In this project the cell line HEK293 is employed as it is a routinely used, easy to transfect cell line. The transfection reagent Lipofectamine 2000 (L2K) is also used, as it has been used extensively in previous studies.

3.1.1. Transfection Optimisation of HEK 293 cells

Optimisation of the conditions for transfection into HEK293 cells was performed using a vector encoding V5-tagged rat MCT4, by varying both the amount of plasmid DNA and Lipofectamine 2000 (L2K). The viability of the cells was assessed by microscopy and the level of overexpression was determined at the mRNA level by quantitative PCR (TaqMan) and at the protein level using antibodies recognising the V5 tag, or a previously validated MCT4-specific antibody (see table 4).

In a preliminary experiment, it was observed that cells treated with 10 µl of

Lipofectamine 2000 showed a significant decrease in cell viability compared to those

treated with 1.3 µl (Figure 3a). There was also a slight decrease in cell viability when

5 µl L2K was used. As a result, no further experiments were performed using 10 µl

of transfection reagent.

T1 T2 T3 T4 T5 T6

Tubulin

MCT4-v5

B)

C) A)

Figure 3: Transfection optimisation of HEK293 cells using the pcDNA3.2_MCT4-V5 vector.

0.66 x 10 ⁶ of HEK 293 cells plated in 6-well plates in 3ml of media were transfected in duplicate for 48hr with 1.3µg, 2.6µg or 4µg of pcDNA3.2-rMCT4-V5 DNA with 1.3µl (i), 5µl (ii) or 10µl (iii) of L2K:

T1: 1.3µl L2k / 1.3µg DNA, T2: 5µl L2K / 1.3µg DNA, T3: 1.3µl L2k / 2.6µg DNA, T4: 5µl L2K/ 2.6µg DNA, T5: 1.3µl L2K / 4µg DNA,, T6: 5µl L2K / 4µg DNA.

A. Cell viability was determined by standard microscopy. Panel (iii) shows that incubation with 10µl of L2K leads to significant cell death as observed by the large number of rounded cells.

B. The level of MCT4-V5 overexpression was determined by Western blot detecting the V5 tag of the MCT4 protein. Lysates from transfected cells were prepared and subjected to SDS-PAGE, followed by Western blot using the anti-V5 antibody and an anti-tubulin antibody as a loading control.

C. RNA extracted from transfected HEK lysates was converted to cDNA and TaqMan was performed using the relevant primers and probes.

(i) (ii) (iii)

T1 T2 T3 T4 T5 T6

0 1 2 3

targ et /G A P D H

The TaqMan data from this preliminary experiment demonstrated a 60-fold increase

in MCT4 mRNA level in the cells treated with 5 µl L2K compared to those treated

with 1.3 µl, regardless of the amount of transfected DNA plasmid (Figure 3C). At the

protein level, clear bands at ~40 kDa are observed for samples transfected with 5 µl of

L2K and 2.6 µg and 4 µg of DNA plasmid (lanes T4 and T6), which correlated well

with the increased expression at the mRNA level. Surprisingly there was no band

observed in the 5µl L2K / 1.3 µg DNA sample (Figure 3B, T5 lane).

Since good levels of overexpression were observed when using 5µl L2K, but there was concern over cell viability associated with L2K, an experiment was performed to test the effect of changing the media 5 hours post-transfection on cell viability and transfection efficiency, as well as lowering the amount of transfection reagent to find the threshold for optimal transfection for MCTs.

Comparing the level of MCT4 overexpression for the cells treated with 2.5 µl and 5 µl L2K by TaqMan (Figure 4B), it is clear that 2.5 µl L2K is not sufficient to elicit the significant level of overexpression observed with 5 µl L2K. The Taqman results with 5 µl L2K show an ~2-fold higher transfection efficiency for cells transfected without subsequent media change compared to those subjected to media change, and this is also demonstrated by Western blot (Figure 4A; T4-6 compared to T1-3).

M T1 T2 T3 T4 T5 T6

Tubulin

MCT4-v5

B)

Figure 4: The effect of media change and L2K on MCT4-V5 overexpression from HEK293 transfected cells.

0.66 x 10 ⁶ of HEK 293 cells plated in 6-well plates in 3ml of media were transfected in duplicate for 48hr with:

T1&4: 5µl L2K/ 1.3µg DNA, T2&5: 5µl L2K/

2.6µg DNA, T3&6: 5µl L2K/ 4µg DNA, T4&8: 5µl L2K/ 1.3µg DNA, T5&10: 5µl L2K/

1.3µg DNA, T6&12: 5µl L2K/ 1.3µg DNA.

Blue and green = no media change; red and yellow = media change (6 hours post- transfection).

A. Lysates from MCT4-V5 transfected cells were prepared and subjected to SDS-PAGE, followed by Western blot using the no. 4 anti- MCT4 antibody (see table 4) and an anti- tubulin antibody as a loading control.

B. RNA extracted from transfected HEK lysates was converted to cDNA and TaqMan was performed using the relevant primers and probes (see table 3).

T1 T2 T3 T4 T5 T6 T7 T8 T9 T1 0

T1 1 T1 2 0 . 0

0 . 5 1 . 0 1 . 5

t r a n s f e c t i o n c o n d i t i o n

ta rg e t/G A P D H

A)

3.1.2. Validation of antibodies against MCT1 and MCT2

A number of antibodies raised against MCT1 and MCT2 were tested, in order to identify those that could detect rat MCT1 and MCT2. HEK cells were transfected with constructs encoding rat MCT1 or MCT2 with and without C-terminal V5 epitope tags, in order to identify the overexpressed proteins by Western blot using a validated anti-V5 antibody. Taqman was also performed in order to demonstrate overexpression at the mRNA level.

3.1.2.1 MCT1

Three antibodies for MCT1 from different suppliers, and raised against different epitopes were tested. Figure 5B illustrates that both constructs encoding MCT1 are capable of overexpression of MCT1 mRNA. The level of overexpression, however, is approx. 15% that of the level of GFP overexpression from the same vector backbone.

Figure 5A shows that there is no detection of MCT1 by any of the 3 MCT1-specific antibodies, but the V5-specific antibody is able to detect the MCT1-V5-expressing lysates.

M 1 2 3 M 1 2 3

M 1 2 3 M 1 2 3

Figure 5: MCT1 antibody validation.

0.66 x 10 ⁶ HEK cells were transfected in 6-well plates with 5µl L2K and 4µg of each DNA construct encoding either MCT1, MCT1-V5, GFP (as a positive control), or an empty vector (pcDNA3.2).

A. Lysates from transfected cells were prepared and subjected to SDS-PAGE, followed by Western blot using the 3 MCT1-specific antibodies and an anti-V5 antibody ((i) Ab no. 2; (ii) Ab no. 4, (iii) Ab no. 5, (iv) anti-V5 Ab; see table 4). An anti-tubulin antibody was also used as a loading control. Lane M = marker, 1 = MCT1, 2 = MCT1- V5, 3 = mock (empty vector).

B. RNA extracted from transfected HEK lysates was converted to cDNA and TaqMan was performed using the relevant primers and probes (see table 3).

B)

m oc k

GF P

m oc k

M CT 1 MCT

1-V5 0

5 10 15

ta rg e t/ G APDH

A)

(i) (ii)

(iii) (iv)

50

37

(kDa)

As 5µl L2K did not elicit a significant level of overexpression of MCT1, a subsequent experiment was performed in order to compare the transfection reagents Lipofectamine 2000 (L2K) and FuGene HD. Higher amounts of L2K than used in the previous experiment, and three different FuGene HD concentrations were used. For L2K, the effect of changing the media 24 hours post-transfection, was also tested.

HEK cells were transfected with the pcDNA3.2-MCT1-V5 construct and TaqMan and Western blotting were performed to detect the level of MCT1 at the mRNA and protein levels, respectively.

The TaqMan data (Figure 6B) shows that an approx. 2-3-fold higher level of MCT1 mRNA is obtained when cells are transfected with FuGene HD, especially when 6 or 8µl is used. There does not seem to be any difference in cells that were subjected to a 24 hr post-transfection media change (L2K only), compared to those that were not.

Figure 6A shows that, as observed at the mRNA level, the amount of MCT1-V5 protein also increases in cells transfected with FuGene HD.

Lysates from the FuGene transfected cells were then subjected to Western blotting using the MCT1-specific antibodies but no detection of MCT1 was observed (data not shown).

M 1 2 3 4 5 6 7 8 9

MCT1-V5

L2k _5u

l_ -M L2 k_6u

l_ -M L2k

_7u l_ -M Fu gen

e_4 ul

Fu gen e_6

ul

Fu gen e_8

ul

L2k_5 ul _+M L2k

_6 ul _+M L2 k_7

ul _+M 0

5 10 15

M CT1 /G APDH

Figure 6: MCT1 antibody validation.

0.66x10 ⁶ HEK293 cells were transfected in duplicate 6-well plates (one for protein and one for RNA extraction) with 4µg MCT1-V5 and either L2K or FuGene HD, with or without a 24hr post- transfection media change.

Samples 1-3 = L2K tranfections without media change (5µl, 6µl,7µl); 4-6 = FuGene HD transfections (4µl, 6µl, 8µl); 7-9 L2K transfections without media change (5µl, 6µl,7µl).

A. Lysates from transfected cells were prepared and subjected to SDS-PAGE, followed by Western blot using the anti-V5 antibody (see table 4).

B. RNA extracted from transfected HEK lysates was converted to cDNA and TaqMan was performed using the relevant primers and probes (see table 3).

A) B)

Figure 7: MCT2 antibody validation.

0.66x10 ⁶ HEK cells were transfected in 6-well plates with 5µl L2K and 4µg of each DNA construct encoding either MCT1, MCT1-V5, GFP (as a positive control), or an empty vector (pcDNA3.2).

A. Lysates from transfected cells were prepared and subjected to SDS-PAGE, followed by Western blot using the 3 MCT2-specific antibodies and an anti-V5 antibody ((i) Ab no. 5;

(ii) Ab no. 6, (iii) Ab no. 7, (iv) anti-V5 Ab; see table 4). An anti-tubulin antibody was also used as a loading control. Lane M = marker, 1 = MCT1, 2 = MCT1-V5, 3 = mock (empty vector).

B. RNA extracted from transfected HEK lysates was converted to cDNA and TaqMan was performed using the relevant primers and probes (see table 3).

M 1 2 3 M 1 2 3 M 1 2 3 M 1 2 3

m ock G FP

m oc k MC

T2 MC

T2-V5 0

5 10 15

ta rg e t/ G A P D H

B) A)

MCT2-V5 Tubulin

(iii) (iv)

(i) (ii)

37 kDa 50 kDa

3.1.2.2. MCT2

As previously described for MCT1, three different MCT2 specific antibodies from different suppliers and raised against different epitopes were tested, using lysates from MCT2, or MCT2-V5 overexpressing cells. Again, the V5 antibody was used as a positive antibody control.

Using the V5-specific antibody, a band of approx. 40kDa is detected in lane 2 (Figure

7A), which contains the MCT2-V5 transfected lysate. The molecular weight

corresponds to the expected size of MCT2, and the band is not present in the other 2

lanes, containing lysates from either mock- or MCT2-transfected cells, demonstrating

that it does indeed recognise V5-tagged MCT2. Using antibodies 5 and 6, no bands

of this expected size is observed in lanes 2 of each blot, suggesting that the antibodies

do not detect MCT2 in these lysates. Antibody 7, however, does detect a protein of

the equivalent size in lane 2, aswell as a protein of slightly lower mw, which is likely

to be the untagged MCT2 protein. Antibody 7 also appears to detect another protein of higher molecular weight, but as this band is present in all lanes, it is likely to represent a non-specific product.

As observed, for MCT1, the level of MCT2 mRNA was not as high as that of GFP in the parallel transfections, although the level of MCT2 was slightly higher than that of MCT1, being approx. 30% of the level of GFP (Figure 7B).

3.2. siRNA knockdown of MCT1 and 4 in rat astrocytes

In order to successfully knockdown the level of MCT1 and/or MCT4 protein in rat astrocytes it was necessary to first establish which transfection reagent was optimal for siRNA delivery, and then to determine which siRNA reagents were capable of eliciting the best level of knockdown. Once this was established, further experiments looking at the effect of MCT knockdown on lactate efflux in rat astrocytes could be performed.

3.2.1. Transfection Optimisation of astrocytes

In order to determine the optimal means of delivery of siRNAs to rat astrocytes, four different transfection reagents (Gene Silencer (Genlantis), Lipofectamine 2000 (Invitrogen), GSK250910 (GSK) and RNAiMAX (Invitrogen)) were used to deliver BLOCK-IT (Invitrogen), a red fluorescent duplex, that has the same properties as an siRNA. By using this reagent, it was possible to visually ascertain the level of delivery to rat astrocytes.

Figure 8 illustrates that Gene Silencer (Panel A) and Lipofectamine 2000 (Panel B) gave the best level of delivery, as observed by the large number of red fluorescent cells. All three amounts of these transfection reagents gave satisfactory delivery of the florescence oligo, however, the best results were obtained when the highest volume of each transfection reagent was used ie 1.5 µl of Gene Silencer and 0.5 µl of Lipofectamine 2000. 100 nM of BLOCK-IT also gave more fluorescent cells than 50 nM. A low level of delivery was obtained with the remaining two transfection reagents RNAimax and GSK250190 (Figure 8, panels C and D).

Following on from this result, the effect of media change on the delivery of 100 nM

BLOCK-IT to rat astrocytes using the optimised amounts of Gene Silencer (1.5µl)

and L2K (0.5 µl) was tested. Comparing panels A and B (Gene Silencer) and C and

D (L2K) in Figure 9, it is clear that a 6 hr post-transfection media change improves

the level of delivery of the BLOCK-IT reagent. This is probably due to an adverse

effect of the presence of the transfection reagent on the rat astrocytes during the

prolonged incubation time.

A B 50nM BLOCK-IT

100nM BLOCK-IT i)

ii)

C D

i)

ii)

Figure 8: Optimisation of delivery of BLOCK-IT to rat astrocytes.

1.5 x 10 ⁵ astrocytes in each well of a 96-well plate were transfected with 50nM or 100nM of

the red fluorescent oligo, BLOCK-IT (Invitrogen) and one of four different transfection

reagents. Each transfection reagent was tested at three different concentrations (bold = image

shown above): Panel A = Gene Silencer (0.5µl, 1µl, 1.5µl) , Panel B = Lipofectamine 2000

(0.1µl, 0.25µl, and 0.5µl), Panel C = GSK250190 (2.5 µg/µl, 5 µg/µl, 7.5 µg/µl) and Panel D =

RNAimax (0.1µl, 0.2µl and 0.3µl). (i) Cells were subjected to staining using the nuclei stain

Hoechst, and images from the fluorescence microscope were captured. (ii) Cells were

A B

C D

Figure 9: The effect of a 6 hour post-transfection media change on the delivery of BLOCK-IT to rat astrocytes.

1.5 x 10 ⁵ astrocytes in each well of a 96-well plate were transfected with 100nM of BLOCK-IT (Invitrogen) and Gene Silencer (Panels A and B; 1.5µl) or Lipofectamine 2000 (Panels C and D; 0.5µl).

Cells were transfected for 48 hours and were either left in the transfection reagent-containing media (Panels A and C), or were subjected to a media change 6 hrs after transfection (Panels B and D). (i) Cells were subjected to staining using the nuclei stain Hoescht, and images from the fluorescence

i)

ii)

i)

ii)

3.2.2. Validation of different siRNAs for MCT1 and MCT4

In order to knockdown the endogenously expressed MCT1 and MCT4 levels in rat astrocytes, cells were transfected with four different siRNAs targeting each MCT, using the optimised conditions determined above for both Gene Silencer and Lipofectamine 2000. BLOCK-IT transfections were performed in parallel in order to confirm that delivery had taken place and also as a negative siRNA control. Cells were transfected for 24 hours in the first instance in order to determine which siRNA reagents to pursue further.

Figure 10, showing fluorescent microscope images taken of the BLOCK-IT transfected cells, suggest that delivery to the rat astrocytes in this experiment was successful. To test the possibility that the health of the astrocytes was adversely affected by incubation with the 2 transfection reagents, a WST-1 assay was performed on the cells following the 24 hour transfection period. The results (Figure 11) suggest that incubation with Gene Silencer negatively affects the health of the rat astrocytes, such that the cell viability is approximately 60% of that of untransfected cells, whereas the cell viability of the L2K-treated cells was an acceptable 80%. As a result, no further analyses were performed on Gene Silencer-treated cells and only the L2K-treated cells were used for measurement of lactate and mRNA levels.

GS 50nM GS 100 nM

L2k 50nM L2k 100 nM

Figure 10: Confirmation of delivery of BLOCK-IT to rat astrocytes. 1.5 x 10 ⁵ astrocytes in each

well of a 96-well plate were transfected with 50nM or 100nM of BLOCK-IT (Invitrogen) and 0.5µl

L2K, alongside the siRNAs being tested. Cells were transfected for 24 hours and were subjected to a

media change 6 hrs after transfection. Cells were visualised under a fluorescence microscope in order to

detect the red fluorescent oligo, and images were captured.

GS_Sep_MCT1

U ntr an sfected GS on ly B lo ck-i

t 50

B lo ck-i t 100

si R N A 1_10n M

si R N A 1_20n M

si R N A 1_50n M

si R N A 1_100n M

si R NA 2_10n

M

si R N A 2_20n M

si R N A 2_50n M

si R NA 2_100n

M

si R N A 3_10n M

si R N A 3_20n M

si R NA 3_50n

M

si R N A 3_10 0n M 0

20 40 60 80 100 120

C e ll v ia b il it y

GS_Sep_MCT4

U ntr an sfected GS on ly B lo ck-i

t 50

B lo ck-i t 100

si R N A 1_10n M

si R N A 1_20n M

si R N A 1_50n M

si R N A 1_100n M

si R NA 2_10n

M

si R N A 2_20n M

si R N A 2_50n M

si R NA 2_100n

M

si R N A 3_10n M

si R N A 3_20n M

si R NA 3_50n

M

si R N A 3_10 0n M 0

20 40 60 80 100 120

C e ll v ia b il it y

L2K_Nat_MCT4

U nt rans fect

ed L2K

onl y

B lock- it 50 Bl ock-

it 100 si R N A1 _10nM

si RN A1_

20nM si RN

A 1_ 50nM si R N A1_

100nM si RN

A2_

10nM si RN

A 2_ 20nM si R N A2_

50nM

si RN A 2_1

00 nM si RN

A 3_ 10nM si R N A3_

20nM si RN

A3_

50 nM

si R N A3 _1 00nM 0

20 40 60 80 100 120

C e ll v ia b ili ty

L2K_Nat_MCT1

Un tr an sf ect ed L2K

o nl y B lo ck -it 5 0

Bl oc k- it 10 0

si R N A1 _1 0n M si R N A1 _2 0n M

siR N A1 _5 0n M siR

N A1 _10 0n M

si R N A 2_1 0n M

siR N A2 _2 0n M

siR N A2 _50

nM

si R N A 2_1 00 n M

siR N A3 _1 0n M

siR N A3 _20

nM

si RN A3 _5 0n M siR

N A3 _1 00n M 0

20 40 60 80 100 120

C e ll v ia b ilit y

Figure 11: Cell viability of rat astrocytes following transfection with Gene Silencer and L2K. 1.5 x 10 ⁵ astrocytes were plated in each well of a 96-well plate (6 replicates per condition). Cells were either left untransfected (black bars), incubated with L2K (0.5µl) or Gene Silencer (1.5µl) only (white bars), Block-IT at 50 or 100nM (red bars), or siRNAs 1-3 (blue, yellow and green) against either MCT1 or MCT4. Cells were transfected for 24 hours and were subjected to a media change 6 hrs after transfection. After 24h, the viability of the cells was measured using the WST-1 assay.

L2K: MCT1 L2K: MCT4

Gene Silencer: MCT1 Gene Silencer: MCT4

The level of knockdown of the MCTs was analysed by Taqman, not only to determine the level of the MCT being knocked down, but also to assess whether or not the level of the other MCT was affected, eg whether knockdown of MCT1 caused an up- regulation of the level of MCT4 mRNA, and vice versa. Figure 12 shows that for MCT1, significant knockdown of up to 90% was achieved, in particular with siRNA no. 2. For MCT4 a lower level of knockdown was achieved, with the best knockdown being elicited by siRNA no. 2 at the highest concentration. Figure 12 also illustrates that when MCT4 is knocked down, there is no difference in levels of MCT1, indicating that there is no compensatory mechanism at this time post-transfection.

When MCT1 is knocked down there appears to also be an unexpected reduction in the

level of MCT4 mRNA. This is unlikely to be due to the MCT1 siRNAs also targeting

MCT4 as the targeting sequences are specific to each MCT, and the reason for this

has yet to be resolved.

L2K_Nat_MCT1

U nt ra nsfe cted L2 K o

nly Bl oc k-i t 5 0

B lo ck-i t 10

0

si RNA1_10n M

si RN A1_2

0n M

si R NA1_50n M

si RNA 1_ 100n

M

si RN A2_10

nM

si RNA2_20n M

si RNA 2_ 50n

M

si R NA2_100n M

si RNA3_10n M

si RN A3_2

0n M

si R NA3_50n M

si RNA 3_ 100n

M 0

20 40 60 80 100 120 140

M C T1 (% of Bl ock- it 100nM )

L2K_Nat_MCT4

U nt ra nsfe cted L2 K o

nly Bl oc k-i t 5 0

B lo ck-i t 10

0

si RNA1_10n M

si RN A1_2

0n M

si R NA1_50n M

si RNA 1_ 100n

M

si RN A2_10

nM

si RNA2_20n M

si RNA 2_ 50n

M

si R NA2_100n M

si RNA3_10n M

si RN A3_2

0n M

si R NA3_50n M

si RNA 3_ 100n

M 0

20 40 60 80 100 120 140

m RNA ( % of Bl ock -i t 100n M )

siRNA knockdown of MCT4 siRNA knockdown of MCT1

Figure 12: Levels of MCT1 and 4 mRNA in rat astrocytes following transfection with siRNAs targeting MCT1 and 4. 1.5 x 10 ⁵ astrocytes were plated in each well of a 96-well plate (6 replicates per condition). Cells were either left untransfected (black bars), incubated with L2K (0.5µl) or Gene Silencer (1.5µl) only (white bars), Block-IT at 50 or 100nM (red bars), or siRNAs 1-3 (blue, yellow and green) against either MCT1 or MCT4. Cells were transfected for 24 hours and were subjected to a media change 6 hrs after transfection. After 24h, the cells were lysed in RLT buffer and RNA was extracted using the RNeasy kit (Qiagen). RT-PCR was then performed and TaqMan on the resulting cDNA allowed the quantification of MCT mRNA. The MCT/GAPDH average for the 6 replicates was then calculated and divided by the value obtained for the 100nM BLOCK-IT control to obtain the percentage value plotted here.

MCT4_MCT1-knockdown

U nt ran sf ect

ed L2 K o nly

B lock- it 50 B lo ck-

it 100

si R N A 1_1 0n M

si RN A1 _20n

M

si R N A 1_5 0n M

si R N A 1_ 100 nM

si R N A 2_ 10n M

si RN A 2_20

nM

si R NA 2_ 50n

M

siR N A 2_ 100

nM

si R NA 3_ 10n

M

si R N A 3_2 0n M

si RN A3 _50n

M

si RN A3 _10

0n M 0

20 40 60 80 100 120 140

M C T4 (% o f Bl o ck- it 100n M ) MCT1_MCT4-knockdown

Untr an sfec

ted L2K only

Bl oc k-i t 5 0 Bl ock

-it 1 00

si RN A1_

10nM

si RN A1_

20 nM

si RN A 1_ 50nM si R NA1_1

00n M

si RN A2_

10nM

si RN A2_

20nM

si RN A2_

50 nM

si R NA2_1 00nM

si RN A3_

10n M

si RN A3_

20nM

si R N A3_

50nM

si R NA 3_1

00nM 0

20 40 60 80 100 120 140

M C T1 ( % of Bl oc k- it 10 0nM )