Pre- and postnatal growth failure with microcephaly due to two novel heterozygous IGF1R mutations and response to growth hormone treatment

(1)

Acta Paediatrica. 2020;109:2067–2074. wileyonlinelibrary.com/journal/apa

|

2067 Received: 9 September 2019

|

Revised: 21 January 2020

|

Accepted: 7 February 2020

DOI: 10.1111/apa.15218

R E G U L A R A R T I C L E

Pre- and postnatal growth failure with microcephaly due to two novel heterozygous IGF1R mutations and response to growth hormone treatment

Alexandra Gkourogianni

^1,2

| Anenisia C. Andrade

^1,2

| Björn-Anders Jonsson

³

|

Emma Segerlund

⁴

| Antje Werner-Sperker

⁴

| Eva Horemuzova

¹

| Jovanna Dahlgren

⁵

| Magnus Burstedt

³

| Ola Nilsson

^1,2,6

1Division of Pediatric Endocrinology, Department of Women’s and Children’s Health, Karolinska Institutet and University Hospital, Stockholm, Sweden

2Center for Molecular Medicine, Karolinska Institutet and University Hospital, Stockholm, Sweden

3Department of Medical Biosciences, Medical and Clinical Genetics, Umeå University, Umeå, Sweden

4Department of Pediatrics, Sunderby Hospital, Sunderby, Sweden

5Göteborg Pediatric Growth Research Center, Department of Pediatrics, Institute of Clinical Sciences, Sahlgrenska Academy, University of Gothenburg, Göteborg, Sweden

6School of Medical Sciences, Örebro University and University Hospital, Örebro, Sweden

This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.

Abbreviations: AITT, arginine-insulin tolerance test; BA, bone age; BMI, body mass index; CNV, copy number variation; DNA, deoxyribonucleic acid; FSS, Familial short stature; G, genitalia; GWAS, genome-wide association studies; HC, head circumference; Ht, height; IGF1R, Insulin-like growth factor 1 receptor; IGFBP-3, insulin-like growth factor binding protein 3; IGF-I, insulin-like growth factor 1; INSR, insulin receptor; ISS, idiopathic short stature; MLPA, Multiple ligation-dependent probe amplification analysis; mo, month; PCR, polymerase chain reaction; Ph, pubic hair; rhGH, recombinant human growth hormone; SDS, standard deviation score; SGA, small for gestational age; SS, short stature; WES, whole-exome sequencing; Wt, weight; yr, year.

Correspondence

Ola Nilsson, Department of Women’s and Child’s Health, Karolinska University Hospital, Solna, CMM, L8:01, SE-171 76 Stockholm, Sweden.

Email: ola.nilsson@ki.se Funding information

The work by ON, AG, ACA, was supported by grants from the Swedish Research Council (project K2015-54X-22736-01-4 &

2015-02227), the Swedish Governmental Agency for Innovation Systems (Vinnova) (2014-01438), Marianne and Marcus Wallenberg Foundation, the Stockholm County Council, the Swedish Society of Medicine, Novo Nordisk Foundation (grant NNF16OC0021508), Erik och Edith Fernström Foundation for Medical Research, Nyckelfonden, HKH Kronprinsessan Lovisas förening för barnasjukvård, Sällskapet Barnavård, Stiftelsen Frimurare Barnhuset i Stockholm, and Karolinska Institutet, Stockholm, Sweden, and Örebro University, Örebro, Sweden.

Abstract

Aim: To explore the phenotype and response to growth hormone in patients with heterozygous mutations in the insulin-like growth factor I receptor gene (IGF1R).

Methods: Children with short stature, microcephaly, born SGA combined with biochemical sign of IGF-I insensitivity were analysed for IGF1R mutations or dele- tions using Sanger sequencing and Multiple ligation-dependent probe amplification analysis.

Results: In two families, a novel heterozygous non-synonymous missense IGF1R vari- ant was identified. In family 1, c.3364G > T, p.(Gly1122Cys) was found in the proband and co-segregated perfectly with the phenotype in three generations. In family 2, a de novo variant c.3530G > A, p.(Arg1177His) was detected. Both variants were rare, not present in the GnomAD database. Three individuals carrying IGF1R mutations have received rhGH treatment. The average gain in height SDS during treatment was 0.42 (range: 0.26-0.60) and 0.64 (range: 0.32-0.86) after 1 and 2 years of treatment, respectively.

Conclusion: Our study presents two heterozygous IGF1R mutations causing pre- and postnatal growth failure and microcephaly and also indicates that individuals with

(2)

1 | INTRODUCTION

The group of children born small for gestational age (SGA) is hetero- geneous and at risk of long-term metabolic complications, including increased risk of cardiovascular disease, insulin resistance and type 2 diabetes mellitus.^1,2 Most of the children exhibit spontaneous catch-up growth, while approximately 10% of the SGA population has no or incomplete catch-up growth and thus remain short.^1,2 In this subpopulation of SGA, genetic mutations causing growth failure may not be an uncommon finding.² Advances in genetic technology including chromosomal microarray, exome and genome sequencing have allowed for identification of several novel genetic causes of growth failure in the SGA without catch-up growth population.² These pathogenic genetic variants affect growth because they im- pair the function of genes important for skeletal growth at the level of the growth plate, the structure responsible for elongation of long bones and vertebrae.³ In general, the genes belong to one of the following functional groups: hormones and cytokines, paracrine fac- tors, cartilage extracellular matrix, intracellular pathways and funda- mental cellular processes.^2,3

The growth hormone—insulin-like growth factor 1 axis (GH–

IGF-I axis) is an important regulatory system that control growth plate chondrogenesis and therefore growth. Mutations in GH, GHR and downstream signalling genes, for example STAT5B mostly affects postnatal growth with only a modest effect on birth weight and length.⁴ In contrast, IGF-I is crucial for both pre- and postnatal growth as demonstrated by several individuals with pathogenic IGF1 variants presenting with a very low birth weight, birth length and head circumference.^5-8 The metabolic effects of IGF-I are mediated by the insulin-like growth factor I receptor (IGF1R), which is a heterotetrameric cell membrane-bound tyro- sine kinase, a member of the insulin receptor (INSR) family.^9-11 IGF-I insensitivity due to homozygous null mutations of the IGF1R gene (15q26.3) (MIM147370) is lethal in mice and likely in humans, whereas homozygous mutations with decreased receptor signalling can be compatible with life in humans.^8-10,12 In contrast, heterozygous IGF1R mutations often present with mild to moder- ate proportional short stature with variable degrees of intrauterine and postnatal growth failure, microcephaly, while IGF-I and IGFBP-3 levels are typically in the upper normal range or frankly elevated.^8,10,12,13

We report the genetic and clinical findings in two separate families, each with a novel heterozygous non-synonymous missense IGF1R variant.

2 | SUBJECTS AND METHODS 2.1 | Subjects

This study was approved by the Swedish Ethical Review Authority in Stockholm, Sweden, and written informed consent was obtained from all participants and their parents/legal guardians. The patients were identified from the recently initiated Karolinska Short Stature cohort which includes some children born SGA. Currently, these two patients are the first patients in this cohort to undergo sequencing of the IGF1R gene. Height, weight, head circumference were plotted on the Swedish growth charts and z-scores were calculated using the Swedish growth reference data.^14-16 Moreover for the sitting height and the sitting height index, we used the growth charts by Fredriks et al.¹⁵ The evaluation of puberty was assessed according to the methods described by Tanner et al, while BA was assessed according to the Greulich and Pyle method as described in our previous publi- cation.¹⁷ Finally, microcephaly was defined as an OFC more than two SDs below the appropriate mean.¹⁴

2.2 | A. Case reports 2.2.1 | A-1. Family 1

The proband is a prepubertal boy with a family history of autosomal dominant short stature (Figure 1A). He was born at gestational week heterozygous IGF1R mutations can respond to rhGH treatment. The findings highlight that sequencing of the IGF1R should be considered in children with microcephaly and short stature due to pre- and postnatal growth failure.

K E Y W O R D S

idiopathic short stature, IGF1R, IGFBP-3, IGF-I, GH treatment

Key Notes

• Identifying underlying genetic causes of idiopathic growth failure is important and enables more accurate information, limits unnecessary testing and may allow for specific treatment.

• In each of the two families, a heterozygous non-synonymous missense variant was identified in insulin-like growth factor I receptor (IGF1R).

• The findings suggest that individuals with heterozygous IGF1R variants respond to growth hormone treatment and also that sequencing should be considered in short children born small for gestational age.

(3)

40 to non-consanguineous parents of northern European decent. At birth, he was small for gestational age (SGA); birth weight 2890 g (−2.0 SDS), birth length 49 cm (−1.6 SDS) and a head circumference of 33.0 cm (−2.15 SDS).¹⁶ At age 6 years 10 months, he presented with a concern of short stature (Figure 2A). Clinical examination revealed proportional short stature, Ht 112 cm (−2.3 SDS), (sitting

height index 53%; −0.1 SDS), Wt 17.3 kg (−2 SDS); BMI 13.8 k/m² (−1.3 SDS), with no dysmorphic features, and a small head circumference (48.7 cm; −2.3 SDS)^14,15 (Table 1). Endocrine evaluation was sig- nificant for elevated levels of IGF-I 350 μg/L (normal range: 54-284) and IGFBP-3 6457 μg/L (normal range: 2125-5777), and a delayed bone age (CA-BA = −1 y 10 mo) with markedly delayed ossification F I G U R E 1 Pedigrees: A, Family 1. B, Family 2. The arrows indicate the proband. Individuals carrying IGF1R mutations are indicated by solid symbols while mutation-negative individuals are indicated by open symbols. The height SDS of each individual is indicated

F I G U R E 2 Growth charts of individuals with heterozygous non-synonymous, missense IGF1R variants. A, Proband in Family 1. B, Father of proband in Family 1. C, Proband of Family 2. The dot of each arrow represents the subject's chronological age (CA) and height and the arrowhead represents the bone age. Lines indicate periods with GH treatment. F, father's height; M, mother's height; TH, target height

(4)

of carpal bones (corresponding to only 2 years 0 months) (Figure 3A, Table 1).

At the age of 7 years 11 months, he was started on rhGH treatment at a dose of 33 mcg/kg/d which was subsequently increased to 42 mcg/kg/d at 8 years 6 months (Figure 2A). Psychomotor development had been normal with some concerns for symptoms of attention deficit and hyperactivity noted.

The father (age 38 years) had been born at full term (gestation week 39) to non-consanguineous Swedish parents. He was SGA with a low birth weight 2200 g (−3.8 SDS), low birth length 45 cm (−3.56 SDS), but normal head circumference of 35 cm (−0.15 SDS).

He had also been evaluated for childhood short stature at 9 years 2 months (Height: 117 cm; −3.5 SDS, HC: 48.3 cm; −2.7 SDS) and had been treated with rhGH (46 mcg/kg/d) starting at the TA B L E 1 Clinical characteristics of IGF1R mutation positive individuals

Subject

Proband 1 (V:1)

Father (IV:1)

PGM (III:5)

PAu (III:6)

PUn (III:9)

Proband 2 (III:1) Sex

Age^a (y, mo)

M 6 y 10 mo

M 9 y 2 mo

F F M F

7 y 10 mo

GA

(wk) 40 39 40

BL (cm, SDS)

49 (−1.6)

45 (−3.56)

47 (−2.5) BW

(g, SDS)

2.890 (−2)

2.200 (−3.8)

2.800 (−1.9) B-HC

(cm, SDS)

33 (−2.15)

35 (−0.15)

33 (−1.5) Height

(cm, SDS)

112 (−2.3)

117^b (−3.5)

155 (−2.1)

155 (−2.3)

167 (−2)

113.4 (−2.9) HC

(cm, SDS) 48.7

(−2.3) 48.3

(−2.7) 51.5

(−2.2) 52.5

(−2.6) 49.7

(−2.1) BMI

(k/m², SDS)

13.8 (−1.3)

15.2 (−0.4)

13 (−1.9) CA

BA ΔBA-CA (y, mo)

6 y 10 mo 5 y 0 mo

−1 y 10 mo

15 y 3 mo 13 y 7 mo

−1 y 8 mo

6 y 6 mo 3 y 6 mo

−3 y 0 mo

IGF-1

(μg/L, RR) 350

(54-284) 397^c

(109-527) 295^d

(39-168) 254

(41-269) IGFBP-3

(μg/L, RR)

6457 (2125-5777)

4.365 ^c (3.100-7.900)

6294 ^d (2055-5594)

5839 (2164-6012) IGF1R

mutation

e c.3364G > T p.Gly1122Cys

f c.3530G > A p.Arg1177His Clinical

Manifestations At presentation

ISS, SGA, delayed BA, microcephaly ADHD

ISS, SGA, delayed BA, microcephaly Scoliosis

ISS ISS

microcephaly ISS

microcephaly

ISS, SGA, delayed BA, microcephaly, joint mobility, DDH, mother's cousins:

Ehlers Danlos Abbreviations: BA, bone age; B-HC, birth head circumference; BL, birth length; BMI, body mass inde; BW, birth weight; DDH, developmental dysplasia of the hip; GA, gestational age; HC, head circumference; IGF-1, insulin like growth factor 1; IGF1R, insulin like growth factor 1 receptor;

IGFBP-3, insulin like growth factor binding protein 3; ISS, idiopathic short stature; mo, month; Pau, paternal aunt’; PGM, paternal grandmother; Pun, paternal uncle; RR, reference range; SDS, standard deviation score; SGA: small for gestational age; wk, week; Y, year; ΔBA-CA, difference between bone age and chronological age.

aAge at presentation.

bHeight of probant's father at the beginning of rhGH treatment (age: 9.17y).

cIGF-I & IGFBP-3 levels 5 months after the end of rhGH treatment (age: 18.75 y).

dIGF-I & IGFBP-3 levels measured the day of the examination (age: 67.6 y).

eHeterozygous non-synonymous missense mutation.

fDe Novo mutation.

(5)

same age (Figure 1A, Figure 2B). At age 15 years 3 months, he was in midpuberty (Ph4/G4, testes volume 10 mL) and his BA was delayed (13 years 7 months). Treatment was discontinued at 18 years 9 months of age (Figure 2B) at which time he had stopped growing and his height was 168.5 cm (SDS −1.8; Δheight SDS +1.7; Figure 1A, Table 1). During rhGH therapy mild scoliosis was noted but this did not progress nor require any interventions. Five months after stopping treatment, evaluation confirmed elevated GH secretion with spontaneous and stimulated (AITT) maximum peaks of 28 and 81 mg/L, respectively.

Proband 1 has an unaffected younger brother (3.1 years) with normal height 96 cm (−0.5 SDS), and a relatively tall mother 176.8 cm (+1.1 SDS) (Figure 1A, Table 1). In addition, the paternal grandmother and 2 of her 4 siblings also had short stature, and small head circumferences (Figure 1A, Table 1).

2.2.2 | A-2. Family 2

The patient is a prepubertal female with no family history of short stature and born at gestational week 40 to non-consanguineous Swedish parents of normal heights (mother's Ht 170.6 cm [+ 0.5 SDS]; father's Ht 175 cm [−0.8 SDS]; mid-parental target height [MPH]: 166.3 cm [−0.2 SDS]) (Figure 1B). She was born SGA (birth weight 2800 g [−1.9 SDS]; birth length 47 cm [−2.5 SDS]) and her head circumference was at the lower part of the normal range (33 cm; [−1.5 SDS]). She also had developmental dysplasia of the hip (DDH). At 7 years and 10 months, her height was 113.4 cm (−2.9 SDS), weight 16.8 kg (−2.4 SDS), BMI 13 kg/m² (−1.9 SDS), sitting height index (53%, 0.1 SDS) and presented microcephaly HC 49.7 cm (−2.1 SDS) (Figure 2C, Table 1). Clinical examination showed a

slim, proportional, prepubertal female with delayed bone age (CA- BA = 3 years 0 months) with ossification of carpal bones being even more delayed (more than 4 years delayed) (Figure 3B), joint laxity (Beighton score 9/9),¹⁸ but no dysmorphic features or signs indica- tive of a syndrome or skeletal dysplasia (Table 1). She has reached her developmental milestone on time and is now a healthy, active, social child and an average student in school.

Endocrine evaluation revealed an IGF-I and IGFBP-3 at the upper level of normal at 254 μg/L (normal range: 41-269) and IGFBP-3 5839 μg/L (normal range: 2164-6012), respectively, and an over- night spontaneous GH secretion profile with several peaks above 10 (maximum peak 15 μg/L) and an average GH level of 4.2 mcg/L. The combined clinical picture led to the suspicion of mild IGF-I insensitivity (Table 1). At the age of 9 years 4 months, rhGH therapy was started at a dose of 30 mcg/kg/d and her IGF-I level remained at the upper part of normal (366 μg/L [normal range: 68-396]) (Figure 2C).

Her rhGH regimen was subsequently increased to 42 mcg/kg/d at the age of 11 years.

2.3 | Sequencing and MLPA analysis

DNA extracted from each proband was used, and the entire coding region and the highly conserved exon-intron splice junctions of the IGF1R were sequenced (both DNA strands) and analysed using the reference sequence NM_000875.3 (CENTOGENE Laboratory). Multiple ligation-dependent probe amplification (MLPA, CENTOGENE Laboratory) analysis of the IGF1R locus was also performed to exclude any deletions or duplications. For identified missense variants, population frequency was evaluated using the GnomAD database.¹⁹ Computational analysis by Polyphen-2, F I G U R E 3 Bone age (BA) x-ray films of

probands. BA was assessed according to the Greulich and Pyle method by a single blinded, expert reader. A. Proband family 1 is a male with a delayed bone age (CA:

6 y 10 mo, BA: 5 y 0 mo, CA-BA: −1 y 10 mo) with markedly delayed ossification of carpal bones (corresponding to a BA of only 2 y 0 mo). B, Proband family 2 is a female with a delayed BA (CA: 6 y 6 mo, BA: 3 y 6 mo, CA-BA: −3 y 0 mo) with ossification of carpal bones being even more delayed (corresponding to only 2 y 3 mo)

(6)

SIFT, MutationTaster and Align-GVGD predicted these variants as probably damaging. Moreover, the variants were classified as likely pathogenic according to ACMG guidelines.²⁰

Detected IGF1R mutations were confirmed by Sanger sequenc- ing in probands and family members of family 1 using the following primers: forward 5′– CGGTGCCCAGATTGAACAAA- 3′ and reverse 5′– TTAGTTCTTGCCCAGACCTG– 3′. For family 2, carrier testing of parents was performed by CENTOGENE Laboratory.

3 | RESULTS

In each family, Sanger sequencing of IGF1R identified a rare variant, not present in the GnomAD¹⁹ or any disease-associated database.

The heterozygous non-synonymous missense IGF1R variant pre- dicted to affect protein function by 4 of 4 in silico prediction tools (Polyphen-2, SIFT, MutationTaster and Align-GVGD). No deletion or duplication within or including the IGF1R gene was detected by MLPA analysis in either of the probands.

In family 1, the identified IGFR1 c.3364G > T variant is predicted to result in the amino acid change p.(Gly1122Cys), with large physiochemical differences. It is located in the tyrosine kinase catalytic domain at an amino acid position that is highly conserved (from Caenorhabditis elegans to Homo sapiens). It was detected in all af- fected individuals, including the proband, the father and the paternal grandmother and 2 of 4 siblings of the paternal grandmother, but not in the unaffected mother, younger brother or any other unaffected family member (Figure 1A; Table 1). Due to perfect co-segregation, absence in public databases, and its location in the catalytic domain, this variant was classified as likely pathogenic according to ACMG guidelines.²⁰

In family 2, a de novo (not present in mother or father) missense variant c.3530G > A, p.(Arg1177His) (Table 1) was identified. A normal 46XX karyotype of the proband as well as maternity and paternity of the parents was confirmed by SNP array analyses. Similarly to proband 1, the mutation of proband 2 was located in a highly conserved nucleotide and amino acid position, but with smaller physiochemical differences between the amino acids (as visualised by Alamut v.2.7.1). Computational analysis by Polyphen-2, SIFT, MutationTaster and Align-GVGD predicted this variant as probably damaging. This variant has been identified previously by us²¹ and recently by Walenkamp et al.¹³ It is classified as likely pathogenic according to ACMG guidelines.²⁰

In our study, 3 individuals with IGF1R mutations have received rhGH treatment. The father of proband 1 was treated with rhGH for 9 years at a relatively high dose (46 mcg/kg/d). His height SDS increased from −3.5 at start of treatment to −1.8 SDS (168.5 cm), which is his adult height (Figure 2B). The proband of family 1 has received 2.5 years of rhGH treatment (max rhGH dose: 42 mcg/

kg/d) and has gained 16.8 cm (Δheight SDS + 0.95) from his height at the start of treatment (Figure 2A). In contrast, the proband of family 2 has been treated with a similar dose (42 mcg/kg/d) and gained 14.2 cm (Δheight SDS + 0.34) during 2.2 years of rhGH

treatment (Figure 2C). During rhGH treatment, the average gain in height SDS in the 3 individuals reported here were 0.42 (range:

0.26-0.60) and 0.64 (range: 0.32-0.86) after 1 and 2 years of treatment, respectively.

4 | DISCUSSION

In this study, we identified two novel heterozygous IGF1R mutations by direct Sanger sequencing of the IGF1R gene in two unrelated probands and the father of proband 1.

The identified variants were not present in any population or disease-associated database.

The variants are likely pathogenic because the phenotypes of the two probands fit well with previously described patients with heterozygous mutations in the IGF1R who also exhibited variable degrees of pre- and postnatal growth failure, microcephaly and biochemical signs of IGF-I resistance. In addition, the de novo variant c.3530G > A p.(Arg1177His) of proband 2 which we reported as an abstract in 201²² was just recently reported in a family with autosomal dominant short stature and a similar phenotype (small for gestational age and microcephaly)¹³ thus confirming the pathogenicity of the variant. These clinical characteristics are also consistent with the known biological role of IGF1R and the combination of symptoms and clinical findings have not been described in any other known condition. Moreover, the variants are extremely rare, and they are both located in highly conserved nucleotide and amino acid posi- tions. The mutations are predicted to be damaging by several methods for in silico analysis. Finally, in family one the variant segregates with the phenotype, and in family two, the variant is a de novo variant with confirmed paternity.

Mutations of the IGF1R cause prenatal and postnatal growth failure with microcephaly in affected individuals, who all fail to thrive despite elevated IGF-I and IGFBP-3 levels.8,9,11,23-25 Indeed, both probands and the father of proband 1 were born SGA without catch-up growth resulting in proportional short stature with microcephaly.²⁵ IGF1R mutations are rare in the general popula- tion, but may be a fairly common cause of short stature in children born small for gestational age (SGA). For example, one report sug- gests that it may be as common as 1%-2% in children born SGA²⁶ and may thus explain 10% or more of short stature in SGA popu- lations of children with both pre- and postnatal growth failure.²⁶

Moreover, heterozygous mutations, as in our patients, have been associated primarily with mild to moderate short stature. While usu- ally no catch-up is seen, in one case partial catch-up growth has been reported.²³ Consistently, all of the affected individuals in the current study had microcephaly and normal psychomotor development with normal or only mildly affected cognitive functions. In contrast, com- pound heterozygous or homozygous mutations have been shown to cause severe growth failure, microcephaly as well as moderate to severe developmental and speech delays, mental retardation.10,13,27,28

In mice, homozygous deletion of Igfr1 is even incompatible with life.⁹ Interestingly, the father of proband 1 had a much lower birth weight

(7)

than proband 1 (−3.8 SDS vs −2.0; Table 1). This may at least in part be due to the fact that the father, in contrast to the son, was born to an affected mother. This phenomenon that the IGF1R deficiency in the mother affects the growth of the foetus has previously been described to contribute to the phenotypic variability of the IGF1R deficiency syndrome⁹ but not confirmed in the large cohort by Walenkamp et al.¹³

Similar to children with GH receptor mutations, our patients exhibited delayed bone ages with carpal bones being more delayed than tubular and long bones, thus indicating the importance of IGF signalling for osteogenesis, especially of carpal bones.

All 3 individuals with IGF1R mutations treated with rhGH in- creased their height SDS during treatment and the average gain in height SDS after 1 year (+0.42 SDS) and 2 years (+0.64 SDS) are similar to previous reports¹³ and less than reported for short children born small for gestational age.²⁹ This may suggest that individuals with heterozygous IGF1R mutations respond to rhGH treatment, which is consistent with previous observations suggesting that the IGF resistance caused by heterozygous IGF1R mutations can be overcome by rhGH treatment⁹ but that the response is variable.

However, this is based on the observation of single patients treated with rhGH. To properly assess the magnitude of response to rhGH therapy in IGF1R deficiency, a randomized, controlled trial in patients with this condition is needed.

In summary, this study presents two novel non-synonymous, heterozygous IGF1R variants associated with IGF-I resistance, short stature, microcephaly and delayed BA. Both variants are rare and affect highly conserved nucleotide and amino acid residues. The variant of family 1 cosegregates perfectly with the phenotype within the 3 generations available for testing and the variant of family 2 was a de novo mutation. The three affected individuals were treated with rhGH with moderate responses supporting the hypothesis that rhGH treatment partially can overcome the mild IGF-I resistance in patients with heterozygous IGF1R mutations.

In accordance with previous reports, our findings indicate that heterozygous IGF1R mutations are relatively common in short chil- dren who were short at birth, have small head circumferences and biochemical signs of IGF-I resistance. Consequently, genetic evalua- tion of IGF1R should be considered in individuals with this constella- tion of clinical signs and symptoms.

ACKNOWLEDGEMENTS

We would like to thank the children and their families for participat- ing in the study as well to Henrik Haapaniemi for his assistance to this project.

CONFLIC T OF INTEREST

The authors have no conflicts of interest to declare.

ORCID

Alexandra Gkourogianni https://orcid.

org/0000-0002-6907-1072

Jovanna Dahlgren https://orcid.org/0000-0002-9637-3439

Ola Nilsson https://orcid.org/0000-0002-9986-8138

REFERENCES

1. Zanelli SA, Rogol AD. Short children born small for gestational age outcomes in the era of growth hormone therapy. Growth Horm IGF Res. 2018;38:8-13.

2. Finken MJJ, van der Steen M, Smeets CCJ, et al. Children born small for gestational age: differential diagnosis, molecular genetic evalua- tion, and implications. Endocr Rev. 2018;39(6):851-894.

3. Baron J, Savendahl L, De Luca F, et al. Short and tall stature: a new paradigm emerges. Nat Rev Endocrinol. 2015;11(12):735-746.

4. Mehta A, Hindmarsh PC, Stanhope RG, et al. The role of growth hormone in determining birth size and early postnatal growth, using congenital growth hormone deficiency (GHD) as a model. Clin Endocrinol. 2005;63(2):223-231.

5. Woods KA, Camacho-Hubner C, Savage MO, Clark AJ. Intrauterine growth retardation and postnatal growth failure associated with deletion of the insulin-like growth factor I gene. N Engl J Med.

1996;335(18):1363-1367.

6. Walenkamp MJ, Karperien M, Pereira AM, et al. Homozygous and heterozygous expression of a novel insulin-like growth factor-I mu- tation. J Clin Endocrinol Metab. 2005;90(5):2855-2864.

7. Netchine I, Azzi S, Houang M, et al. Partial primary deficiency of insulin-like growth factor (IGF)-I activity associated with IGF1 mutation demonstrates its critical role in growth and brain development.

J Clin Endocrinol Metab. 2009;94(10):3913-3921.

8. Wit JM, Oostdijk W, Losekoot M, van Duyvenvoorde HA, Ruivenkamp CA, Kant SG. Mechanisms in endocrinology: novel genetic causes of short stature. Eur J Endocrinol. 2016;174(4):R145-R173.

9. Walenkamp MJ, Losekoot M, Wit JM. Molecular IGF-1 and IGF-1 receptor defects: from genetics to clinical management. Endocr Dev.

2013;24:128-137.

10. Kansra AR, Dolan LM, Martin LJ, Deka R, Chernausek SD. IGF re- ceptor gene variants in normal adolescents: effect on stature. Eur J Endocrinol. 2012;167(6):777-781.

11. Klammt J, Kiess W, Pfaffle R. IGF1R mutations as cause of SGA.

Best Pract Res Clin Endocrinol Metab. 2011;25(1):191-206.

12. Gannage-Yared MH, Klammt J, Chouery E, et al. Homozygous mutation of the IGF1 receptor gene in a patient with severe pre- and postnatal growth failure and congenital malformations. Eur J Endocrinol. 2013;168(1):K1-7.

13. Walenkamp MJE, Robers JML, Wit JM, et al. Phenotypic features and response to gh treatment of patients with a molecular defect of the IGF-1 receptor. J Clin Endocrinol Metab. 2019;104(8):3157-3171.

14. Wikland KA, Luo ZC, Niklasson A, Karlberg J. Swedish population-based longitudinal reference values from birth to 18 years of age for height, weight and head circumference. Acta Paediatr.

2002;91(7):739-754.

15. Fredriks AM, van Buuren S, van Heel WJ, Dijkman-Neerincx RH, Verloove-Vanhorick SP, Wit JM. Nationwide age references for sitting height, leg length, and sitting height/height ratio, and their diagnostic value for disproportionate growth disorders. Arch Dis Childhood. 2005;90(8):807-812.

16. Niklasson A, Albertsson-Wikland K. Continuous growth reference from 24th week of gestation to 24 months by gender. BMC Pediatr.

2008;8:8.

17. Gkourogianni A, Andrew M, Tyzinski L, et al. Clinical characteri- zation of patients with autosomal dominant short stature due to Aggrecan mutations. J Clin Endocrinol Metab. 2017;102(2):460-469.

18. Smits-Engelsman B, Klerks M, Kirby A. Beighton score: a valid measure for generalized hypermobility in children. J Pediatr.

2011;158(1):119-123, 123, e1–4.

(8)

19. Karczewski KJ, Francioli LC, Tiao G, et al. Variation across 141, 456 human exomes and genomes reveals the spectrum of loss- of-function intolerance across human protein-coding genes.

2019;bioRxiv:531210.

20. Richards S, Aziz N, Bale S, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recom- mendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med.

2015;17(5):405-424.

21. Andrade AC, Gkourogianni A, Segerlund E, et al. Short stature due to two novel heterozygous IGF1R mutations and response to GH treatment. Abstract at 10th International meeting of pediatric en- docrinology. Horm Res Paediatr. 2017;88(suppl 1):130–131.

22. Anderson P, Doyle LW. Neurobehavioral outcomes of school-age children born extremely low birth weight or very preterm in the 1990s. JAMA. 2003;289(24):3264-3272.

23. Ocaranza P, Golekoh MC, Andrew SF, et al. Expanding genetic and functional diagnoses of IGF1R haploinsufficiencies. Horm Res Paediatr. 2017;87(6):412-422.

24. Okubo Y, Siddle K, Firth H, et al. Cell proliferation activities on skin fibroblasts from a short child with absence of one copy of the type 1 insulin-like growth factor receptor (IGF1R) gene and a tall child with three copies of the IGF1R gene. J Clin Endocrinol Metab.

2003;88(12):5981-5988.

25. Yang L, Xu DD, Sun CJ, et al. IGF1R variants in patients with growth impairment: four novel variants and genotype-phenotype correla- tions. J Clin Endocrinol Metab. 2018;103(11):3939-3944.

26. Ester WA, Hokken-Koelega AC. Polymorphisms in the IGF1 and IGF1R genes and children born small for gestational age: results of large population studies. Best Pract Res Clin Endocrinol Metab.

2008;22(3):415-431.

27. Ester WA, van Duyvenvoorde HA, de Wit CC, et al. Two short children born small for gestational age with insulin-like growth factor 1 receptor haploinsufficiency illustrate the heterogeneity of its phe- notype. J Clin Endocrinol Metab. 2009;94(12):4717-4727.

28. Walenkamp MJ, Wit JM. Genetic disorders in the GH IGF-I axis in mouse and man. Eur J Endocrinol. 2007;157(suppl 1):S15-26.

29. Sas T, de Waal W, Mulder P, et al. Growth hormone treatment in children with short stature born small for gestational age: 5-year results of a randomized, double-blind, dose-response trial. J Clin Endocrinol Metab. 1999;84(9):3064-3070.

How to cite this article: Gkourogianni A, Andrade AC, Jonsson B-A, et al. Pre- and postnatal growth failure with microcephaly due to two novel heterozygous IGF1R mutations and response to growth hormone treatment. Acta Paediatr. 2020;109:2067–

2074. https://doi.org/10.1111/apa.15218