Cell growth and serotonin regulation analyses on the human neuroendocrine cell line CNDT2.5
Su-Chen Li
Degree project inapplied biotechnology, Master ofScience (2years), 2009 Examensarbete itillämpad bioteknik 30 hp tillmasterexamen, 2009
Biology Education Centre and Department ofEndocrine Oncology, Medical Sciences Uppsala University Hospital, Uppsala University
Cell growth and serotonin regulation analyses on the human neuroendocrine cell line CNDT2.5
Su-Chen Li
Neuroendocrine tumors (NETs) are rare and slow-growing malignancies which, derive from enterochromaffin cells. High level of serotonin secretion results in the carcinoid syndrome.
The World Health Organization elucidated a clear classification of NETs according to tumor size, proliferation rate, location, differentiation and hormone production in 2000. Surgery and biotherapy are the most effective treatments to cure the patients. However, surgery can only cure the patients with primary tumors whereas the majority of patients have developed metastatic disease due to late diagnosis. Currently somatostatin analogues are effective to cure metastatic disease by controlling tumor growth and hormonal secretion. However, the mechanisms of somatostatin analogues cell growth inhibition are still unclear and how the patients acquire resistance to these drugs is still not understood.
The project aims at studying the effects of a somatostatin analogue (octreotide) on the human neuroendocrine cell line named CNDT2.5 and to establish a resistant cell line, by using 1 μM octreotide, from the wild type that we named CNDT2.5 LT. We studied cell proliferation by using cell counting kit and also investigated gene expression of P21, P27 and Ki67.
Somatostatin and dopamine chimera receptor signaling pathways affect cell growth. Gene expression analysis of the dopamine receptors is therefore, included in our study. We also analyzed serotonin production and ERK expression to distinguish the differences between the wild type and the resistant cells.
Cell proliferation assay shows that CNDT2.5 cells under long term 1 μM octreotide treatment grow more slowly than wild type cells. P21, P27 and Ki67 express both in untreated and octreotide treated cells that do not show any significant variation of gene expression according different time course. Serotonin production analysis did not show a clear variation in CNDT2.5 and CNDT2.5 LT while TPH1 gene expression increases after treating cells with octreotide for 24, 48 and 72 hours. The TPH1 gene has an important role in serotonin synthesis.
In conclusion, octreotide is an active drug to inhibit cell growth on CNDT2.5 cells. We will continue to work on our CNDT2.5 model to further investigating molecular mechanisms behind octreotide cell growth inhibition.
Contents
ABSTRACT………..1
ABBREVIATIONS………...4
INTRODUCTION History and Classification………...5
Incidence……….5
Diagnosis Urinalysis………6
Serum Analysis………6
Diagnostic Imaging……….6
Therapy………...7
Somatostatin and its Receptors………...7
Somatostatin and Dopamine Chimeric Compounds………...10
Serotonin and its Receptors………...11
Challenges………...11
AIMS of the PROJECT...12
RESULTS Anti-proliferative Effects of Octreotide………...13
Genes Expression in CNDT2.5 and CNDT2.5 LT (RT-PCR and Q RT PCR) Dopamine Receptor………...16
Genes Involved in the Cell Cycle………..16
Gene Expression Analyses Involved with the Serotonin Metabolism………17
Serotonin ELISA Analysis………...18
ERK (1/2) and Phosphor-ERK (1/2) Expression………...18
DISCUSSION...20
MATERIALS and METHODS Cell Culture………...21
Proliferation Studies and MTS Assays………..21
RNA Extraction and cDNA preparation………21
Reverse transcription PCR………22
Quantitative Real-Time PCR (Q RT-PCR)………...23
Protein Extraction……….23
Serotonin Enzyme-linked Immunosorbent Assay (ELISA)………..23
Western Blot Analysis………...24
ACKNOWLEDGEMENTS………25
REFERENCES………26
Abbreviations
5-HIAA 5-Hydroxyindoleacetic Acid 5-HT 5-Hydroxtryptamine (Serotonin)
CgA Chromogranin A
CDK Cyclin Dependent Kinase
CNDT2.5 LT CNDT2.5 Long Term Octreotide Treatment CNS Central Nervous system
CT Computed Tomography
DR Dopamine Receptors
EC Enterochromaffin
ELISA Enzyme-linked Immunosorbent Assay ERK Extracellular Signal-regulated Kinases FBS Fetal Bovine Serum
GI Gastrointestinal
GPCR G-Protein-Coupled Membrane Receptors HRP Horseradish Peroxidase
MAPK Mitogen Activated Protein Kinase NCI National Cancer Institute
NET Neuroendocrine Tumor
PET Positron Emission Tomography PI Proliferation Index
SI Small Intestine
SEER Surveillance Epidemiology and End Result SSA Somatostatin Analogue
SST Somatostatin
SSTR Somatostatin Receptor SST/D Somatostatin/Dopamine
SVA Statens Veterinärmedicinska Anstalt TPH Tryptophan Hydroxylases
TRP Transient Receptor Potential W.H.O World Healthy Organization
Introduction
History and Classification of Neuroendocrine Tumors
Gastrointestinal neuroendocrine tumors (GI-NETs) of the dispersed neuroendocrine system derive from enterochromaffin (EC) cells. The most frequent GI-NET site is the ileum in the small intestine (SI) which is about 21% of all the NETs [1]. Otto Lubarsch found ileum carcinoid tumors from two patients during autopsy in 1888. Siegfried Obendorfer used the term karzinoide (carcinoma-like) to describe the tumors of the ileum, which represent a benign behavior rather than malignant behavior in 1907. Serotonin (5-HT), which is mainly produced in EC cells, was first found in an ileum carcinoid. Serotonin was recognized as the most important hormone in causing the carcinoid syndrome in 1950 [2, 3]. Carcinoid syndrome includes symptoms, such as: flushing, bronchospasm, heart disease and diarrhea [4, 5]. Williams and Sandler classified carcinoid tumors according to their embryologic site of origin in foregut- (respiratory tract, stomach, duodenum and pancreas), midgut- (small intestine, appendix cecum and proximal colon) and hindgut- (distal colon and rectum)-tumors in 1963 [4,
5]. Carcinoids were divided in typical or atypical tumors according to specific histological criteria. Typical carcinoids are well differentiated, less aggressive and the histologic pattern of their morphology is obviously distinguished, whereas, atypical carcinoid tumors are more aggressive and fast-growing tumors. Nevertheless, the classification by Williams and Sandler is not accurate to classify differences in relevant carcinoid tumors. Therefore, the World Health Organization (WHO) elucidated a clear classification of carcinoid tumors and also established a capable system in clinic in 2000. The classification is based on tumor size, proliferative rate, location, differentiation and hormone production. There are three main categories, well-differentiated endocrine tumor with benign or uncertain behavior (proliferation index [PI] <2%); well-differentiated endocrine tumors with low grade malignant behavior (PI between 2% and 15%), and poorly differentiated endocrine carcinomas with high grade malignant behavior (PI > 15%) [3, 6]
Incidence of Neuroendocrine Tomors
NETs are rare and the majority of them are found in the gastrointestinal tract. Fifty-five percent are in the small intestine and 30% are in the bronchopulmonary system. The incidence rate has increased from 1 to 5 per 100,000 people per year during last three decades. The incidence rates are different with race, gender and age according to Surveillance, Epidemiology, and End Result (SEER) Program of the National Cancer Institute (NCI). In the white population, incidence rates are slightly higher in females than in males; they are 2.47 and 2.58 per 100,000 people per year, respectively. However, the black population shows opposite epidemiology with an incidence higher in men than in women; the rates are 4.48 and 3.98 per 100,000 population per year. NETs are more common in older people and the average age at diagnosis is 61.4 years and the average of survival is around 6 years [3, 7, 8].
Diagnosis
To diagnose NETs is not easy because they are often slow growing and indolent at the early stage. Their diagnosis is often delayed until the metastasis stage when their symptoms are aggressive and curative approaches are not available. Some of the diagnostic techniques, which are useful in tumor identification and localization, are described below [3, 9].
Urinalysis
Five-hydroxyindoleacetic acid (5-HIAA), a serotonin metabolite is a useful marker to diagnose NETs. 5-HIAA probably can not be elevated in atypical carcinoids and can be a false positive result when patients are suffering from different diseases such as mastocytosis. The level of urine 5-HIAA can also be affected by medications and foods [3, 9, 10].
Serum Analysis
Chromogranin A (CgA) belongs to the granin family that is commonly expressed in neuroendocrine cells. CgA is a better diagnostic marker for atypical carcinoids compared to urine 5-HIAA test. False-positive results can be seen in the presence of renal impairment, liver failure, atrophic gastritis and inflammatory bowel disease [3, 9, 10].
Diagnostic Imaging
The biochemical diagnose of NETs can be verified by imaging diagnosis which plays a vital role in tumor localization. For instance, abdominal computed tomography (CT) is commonly used to identify and localize NETs and their metastases, however, the detection rate and sensitivity are poor [3, 9]. Furthermore, the use of radio-labeled receptor-binding peptide and scintigraphy provide information about diagnostic and therapeutic effect of various drugs. For instance, Octeroscan can localize primary tumor site by using radio-labeled octreotide which is a radio-labeled somatostatin analogue (SSA) with higher sensitivity. Positron emission tomography (PET) is a more modern radiologic technique to study tumors. PET is useful in quantifying the effects of medical treatment on metastatic disease [3, 10].
Therapy
There are few options to cure patients who are suffering from NETs. Surgery is the most effective treatment for patients with primary tumors. However, the majority of NETs patients have developed metastatic disease during the diagnosis. Chemotherapy and radiotherapy are generally not efficiency as therapeutic approaches. Biotherapy is more effective by using SSAs and interferon. SSAs are the best drug at the moment, very efficient in inhibiting carcinoid syndrome and controlling tumor growth and hormonal secretion comparing with other treatments [3, 9, 10].
Somatostatin and its Receptors
SST is a small polypeptide hormone, which consists of two natural forms. They are 14 and 28 amino acids peptides that bind with high affinity to five specific subtypes of SST receptors (SSTR1, SSTR2, SSTR3, SSTR4 and SSTR5). SST specific interactions to the five receptors transduce the different effects. The signaling pathways of the five receptors are similar. They can inhibit adenyl cyclase, activating phosphotyrosine phosphatase and modulating mitogen activated protein kinase (MAPK) via G-protein dependent mechanisms [12, 13]. After ERK phosphorylation, cdk inhibitor p27KIP1 is activated; P21WAF1/C1P1 is up-regulated that inhibit transcription of the cyclin (Ki-67). The association of an increase of P21WAF1/C1P1 and a down regulation in Ki-67 cause growth arrest (Figure 1) [14]. The development of synthetic analogues such as octreotide and lanreotide, depends on the very short half-life of the natural compounds. SST and its analogues function as hormonal secretion inhibitors and decrease carcinoid syndrome or inhibiting tumour progression. Cytostatic and cytotoxic mechanisms are involved in the anti-tumor effect of SSAs [12, 13]. The fragment, Phe – Trp – Lys – Thr, of SST is necessary for their biological activity, which is enhanced when LTrp replaces by DTrp.
The four amino acids are conserved and the fragment is recognized and bound by the different SSTRs. Octreotide activity has been increased by using the Trp chemical substitution (Figure 2) [15].
Figure 1 SSTR activation influences MAPK signaling pathways. Inhibition of cell growth by activated ERK, results in the activation of P27KIP1 and P21WAF1/C1P1 upregulation, whereas, Ki67 is inhibited.
Modified from [14 and 17]
Figure 2 Fourteen SST amino acids sequence (upper). Octreotide 8 amino acids sequence (Lower). The conserved essential fragment is in red [15].
Somatostatin and Dopamine Chimeric Compounds
Dopamine (D) is a neurotransmitter controlling motor and emotional behavior. There are five subtypes of dopamine receptors (DR1 DR2, DR3, DR4 and DR5). DRs are divided into two subfamilies DR1-like (DR1 and DR5) and DR2-like (DR2, DR3 and DR4) [16].
Both SSTR and DR families are G-protein-coupled membrane receptors (GPCR) [16]. Studies on rat neuronal cells and transfected primary human embryo kidney, HEK293, cell line and ovary of Chinese hamster called CHO-K1 cell line, proved that the extra-membrane SSTR and DR might interact to form heterodimers with increased functional activity. SST/D chimeric compounds may affect cell growth by using a variety of signaling pathways (Figure 3) [17, 28].
Figure 3.SST/D chimera-induces dimerisation of SSTR and DR. SST/D chimeric compounds JNK activation results in up-regulating P21WAF1/C1P1, meanwhile, the transcription of the cyclin (Ki-67) is inhibited. The pathway causes growth arrest. Modified from [14 and 17]
Serotonin and its Receptors
Serotonin (5-hydroxtryptamine, 5-HT) plays a vital role in signaling pathways of both central and peripheral nervous systems. EC cells synthesize serotonin by using tryptophan hydroxylases 1 (TPH1), while neurons activate a different form of tryptophan hydroxylases named TPH2. Serotonin receptors are classified into seven families, with the exception of 5-HT3, which forms ligand-gated cation channels, the other ones belong to GPCR [18, 19]. EC cells express 5-HT2C, 5-HT3 and 5-HT4 receptors [19]. Carcinoid syndrome relates to high level of serotonin production and secretion, which can be controlled by somatostatin analogues [20].
The majority of the endocrine cells in the SI are serotonin producing and releasing EC cells.
EC cells are on the mucosal surface and release serotonin into the gut. The released serotonin can stimulate vagal afferents and enteric nerves that affect a variety of GI responses [21].
Challenges
NETs have been studied during the last century. However, the growth and spread of tumors can not be efficiently controlled by either biotherapy or chemotherapy [11]. Furthermore, SSAs are mainly used to inhibit cell growth, hormonal secretion and extending patients lifetime.
However, the mechanisms of SSAs inhibiting cell growth are still unclear and how the patients acquire resistance to these drugs is still not understood [3, 12]. Specific novel markers are needed to identify NETs at the early stage of the disease to skip delayed patients diagnosis at the stage of metastasis [3].
In order to approach the challenges, it is essential to explore the molecular mechanism behind SSA by using proper cell lines for in vitro studies. Furthermore, to investigate SSA signaling pathways and serotonin secretion may elucidate the resistance establishment phenomenon.
Aims of the Project
The project intends to study the effect of SSAs on the human neuroendocrine cell line named CNDT2.5 and to establish the resistant cell line from the wild type. This may be useful as an in vitro model for understanding tachyphylaxis development. Furthermore, we explored cell proliferation by using MTS assay and also examined gene expression of P21, P27 and Ki67 which are important targets to study cell proliferation [14, 18]. The cyclin dependent kinase (CDK) inhibitors P21 (CDKN1A) and P27 (CDKN1B) are two important cell cycle regulators
[25]. Ki67 protein (MKI67) is a marker for cell proliferation that determines the growth fraction of a given cell population [26]. The novel drug somatostatin/dopamine (SS/D) chimera-induces dimerisation of somatostatin and dopamine receptors (SSTR and DR) affect cell growth. Therefore, gene expression analysis of DR subtypes has been included to understand whether the novel drug can be efficiently used on CNDT2.5 cells. Serotonin production may be a vital indicator to distinguish the difference between the wild type and the resistant cells. It is also important to investigate gene expression of essential target genes involved in serotonin production, release and metabolisms such as TPH1 and TRPA1 [18, 21]. TRPA1 belongs to the transient receptor potential (TRP) channel family and is highly expressed in the EC cells. TRPA1 is relevant to release serotonin from EC cells [21].
Results
Anti-proliferative Effects of Octreotide
Four different number of cells 1250, 2500, 5000 and 10000 were seeded and only the lower amount of cells (1250) illustrated a significant difference between non-treated and octreotide treated after 7 days (Figure 4). Two and four days after seeding, in the presence or absence of octreotide the rate of cell growth shows no variation in BON, CNDT2.5 and CNDT2.5 LT.
However, 7 days after seeding treated cells show clearly inhibition of cell growth (Figure 4).
It clearly appears that after 7 days of treatment CNDT2.5 LT are still inhibited by the octreotide. However, CNDT2.5 LT lost the capacity to grow as fast as CNDT2.5. The cells are changing behaviors depending on the octreotide long term treatment (Figure 5).
BON
0.000 0.250 0.500 0.750 1.000
2 Day 4 Day 7 Day
OD
BO N WT BO N +O ct
CNDT2.5 WT
0.000 0.250 0.500 0.750 1.000
2 Day 4 Day 7 Day
OD
C NDT2.5 W T C NDT2.5 +O ct
CNDT2.5 LT
0.000 0.250 0.500 0.750 1.000
2 Day 4 Day 7 Day
OD
C NDT2.5 LT C NDT2.5 LT +O ct
Figure 4 Cell proliferation comparisons between 1μM octreotide treated and non-treated on BON, CNDT2.5 and CNDT2.5 LT cells. 1250 cells were seeded and a clear inhibition of cell growth appeared after 7 days of 1μM octreotide treatment.
After 7 days treatment
0.000 0.250 0.500 0.750 1.000
CNDT 2.5 CNDT 2.5 LT
Cell line
OD
Untreated Oct. treated
Figure 5 Remarkable octreotide anti-proliferation effects on CNDT2.5 cells. Differences between 1μM octreotide un-treated and treated by using MTS assay after 7 days of treatment. CNDT2.5 cells grow faster than CNDT2.5 LT both in the presence or absence of 1μM octreotide treatment.
Genes Expression in CNDT2.5 and CNDT2.5 LT (RT-PCR and Q RT PCR)
Dopamine Receptor
CNDT2.5 and CNDT2.5 LT cells express the dopamine receptors, DR2, DR4 and DR5; both cell lines have higher expression of DR4 and DR5 and lower expression of DR2. However, CNDT2.5 and CNDT2.5 LT cells are not expressing DR1 and DR3 (Table 2).
Table 2 Gene expression of dopamine receptors analyzed by RT-PCR Cell line
Gene CNDT2.5 CNDT2.5 LT
DRD1 ND ND
DRD2 + +
DRD2* + +
DRD3 ND ND
DRD4 +++ +++
DRD5 +++ +++
*: Primers detect one transcript out of two ND: Not detected
+: Weak expression +++: Strong expression
Genes Involved in the Cell Cycle
Genes controlling the cell cycle such as P21, P27 and Ki67, are highly expressed in CNDT2.5 and CNDT2.5 LT (Table 3). However, when we investigated these genes on total RNA of the treated cells, according to time course from time 0 to 72 hours by using Q RT-PCR; we did not detect any significant variation of gene expression according different time of treatments and no obvious difference by cell line comparison (data not shown).
Table 3 Gene expression of P21, P27 and Ki67 analyzed by RT-PCR Cell line
Gene CNDT2.5 CNDT2.5 LT
Ki 67 +++ +++
P21 +++ +++
P27 +++ +++
P27* +++ +++
*: Primers detect one transcript out of two +++: Strong expression
Gene Expression Analyses Involved with the Serotonin Metabolism
In our study, TRPA1 is expressed neither in CNDT2.5 nor in CNDT1.5 LT (Table 4). TPH1 gene expression from Q RT-PCR analysis shows that CNDT2.5 LT expresses more TPH1 than CNDT2.5. Comparing the different time of treatments with octreotide, TPH1 gene expression enhances when cells were under longer treatment in CNDT2.5 and CNDT2.5 LT cells (Figure 6).
Table 4 Gene expression of TRPA1 and TPH1 analyzed by RT-PCR Cell line
Gene CNDT2.5 CNDT2.5 LT
TRPA1 ND ND
TPH1 ++ ++
ND: Not detected ++: Mild expression
TPH 1
0 1 2 3 4
Untreated 24H 48H 72H
Relative Expression
CNDT 2.5 CNDT 2.5 LT
Figure 6 TPH1 analyses by using Q RT-PCR. Gene expression of THP1 increases both in CNDT2.5 and CNDT2.5 LT after treatment with octreotide for 24, 48 and 72 hours. CNDT2.5LT has a higher expression of TPH1 compared to CNDT2.5. Ct values were calculated and the data evaluated using the 2-ΔΔCT method. β-actin, from each individual sample, was used for normalization. Average values from triplicate samples with standard deviations are shown plotted.
Serotonin ELISA Analysis
We used an available commercial ELISA kit to determine the serotonin concentration of 1μM
octreotide in different treated cells and untreated cells. The serotonin levels do not show any clear difference between CNDT2.5 and CNDT2.5 LT when treated with octreotide for 24 hours or untreated. However, CNDT2.5 LT contained more serotonin than CNDT2.5 at 48 and 72 hours of treatment (Figure 7).
Serotonin ELISA Assay
0 5 10 15 20 25
Untreated 24H 48H 72H
Conc. (ng/mL)
CNDT 2.5 CNDT 2.5 LT
Figure 7 Serotonin ELISA analyses. Serotonin concentration does not show a clear difference between CNDT2.5 and CNDT2.5 LT until 48 hours of treatment. CNDT2.5 LT has a higher serotonin level than CNDT2.5 after 48 and 72 hours of octreotide treatment.
ERK (1/2) and Phosphor-ERK (1/2) Expression in CNDT2.5 and CNDT2.5 LT
The Western blot analysis indicates that unphosphorlated ERK1/2 appeares both in CNDT2.5 and CNDT LT (Figure 8A). Protein expression level does not show any significant variation even though the cells are treated with 1μM octreotide at different time. Active, phospho-ERK1/2 is neither in CNDT2.5 nor in CNDT2.5 LT (data not shown).
(A)
(B)
(C)
Figure 8 Western blot analysis of ERK1/2 after 24, 48 and 72 hours treatment (orders from right to left). (a) Non-active, unphosphorylated ERK1/2 is expressed in all the samples. However, there was no phospho-ERK1/2 found in any sample. (b) β-actin housekeeping protein, control for ERK1/2 abtibody. (c) β-actin housekeeping protein, control phospho-ERK1/2 antibody.
Discussion
Octreotide plays a vital role in the symptomatic management of NETs and also has anti-proliferation effect on tumor growth [12, 13]. In our project, we found that octreotide inhibited CNDT2.5 cell growth using 1 μM octreotide and treating cells for 7 days. When cells were seeded at the concentration of more than 2500 cells per well, cell proliferation was no different between untreated and treated cells. Therefore, cells may be seeded in a smaller amount (1250 cells per 100 μL per well or less cells) in 96-well plates. Furthermore, we analyzed P21, P27 and Ki67 gene expression by using Q RT-PCR to distinguish differences depending on the time of octreotide treatment. P21, P27 and Ki67 were expressed both in CNDT2.5 and CNDT2.5 LT. However, there was no gene expression difference comparing the different treatments. We would like to change the time course to continue investigating variant gene expression in wild type and long term treatment cells. We will then study Western blot analysis or immunohistochemistry (IHC) on patients’ samples.
Dopamine is an important regulator in the control of hormonal secretion. We briefly examined dopamine receptors and found that DR2, DR4 and DR5 are expressed in CNDT2.5 and CNDT2.5 LT. DR2 is relevant to the signaling pathways that are responsible to cell proliferation and cell death via p38 MAPK and ERK activation and DR2 is also an essential receptor to interact with SSTR [17]. Furthermore, the SSTR and DR chimeric compounds can heterodimerize controlling the intracellular signal transduction pathways that affect cell growth [14, 17]. DR2 is expressed in the CNDT2.5 cell line. Our further studies will investigate the effects of SSA and SSTR/DR chimera on a variety of cell lines and cell signaling pathways. MAPK signaling pathway is important in the regulation of cell proliferation, differentiation and apoptosis. We explored ERK1/2 and phospho-ERK1/2 by using Western blot analysis, the activated, phosphorylated ERK1/2 was not expressed in CNDT2.5 and CNDT2.5 LT in the presence or absence of the treatment. The experiment may be improved by changing incubation time of octreotide following Lesche and colleagues work in 2009 [27].
In our project, we studied intracellular serotonin using serotonin ELISA kit. We could not find a clear variation between the different time course points. However, TPH1 gene expression analyzed by Q RT-PCR indicated that TPH1 had increased after 1 μM octreotide treatment.
This may mean that serotonin production might differ in the cells treated and not-treated with 1 μM octreotide. We may therefore investigate serotonin release instead of intracellular serotonin production to elucidate how octreotide influences its release.
In conclusion, octreotide is an active drug which has inhibition capacity of cell growth of CNDT2.5 LT cells; which have not become resistant yet. However, they started slow growth compared to CNDT2.5.
Materials and Methods
Cell Culture
The human cell line CNDT2.5 originated from a liver metastasis from a patient with a primary ileum NET. CNDT2.5 cells were cultured in Dulbecco’s Modified Eagle’s Medium:
Nutrient Mixture F-12 (DMEM/F12) media (Gibco, 11320) supplemented with 10% fetal bovine serum (FBS) (Sigma-Aldrich), 1% penicillin-streptomycin (Statens Veterinärmedicinska Anstalt, Uppsala, Sweden, SVA), 1% vitamins (Gibco), 1% sodium pyruvate (Gibco), 1% L-glutamine (SVA), 1 % non-essential amino acids (Gibco) and 1 % HEPES buffer (SVA) at 37°C in 5% CO2.
CNDT2.5 long term (CNDT2.5 LT) was cultured in the same condition as CNDT2.5 but CNDT2.5 LT was treated by using 1 μM octreotide (Novartis) since November 2008 every second day till the beginning of May 2009. We then treated the cells everyday to keep full octreotide activity in order to induce drug resistance.
Proliferation Studies and MTS Assays
CNDT2.5, CNDT2.5 LT and BON cells were seeded on 96-well plates at the concentration of 1250, 2500, 5000 and 10000 cells; 100 μL per well. BON cells were used as a positive control and each sample was seeded in triplicate. Half of the samples were treated and the rest of the samples were not treated with 1 μM octreotide every second day.
The 3-(4,5-Dimethylthiazol-2-yl)-5(3-carboxymethonyphenol)-2-(4-sulfophenyl)-2H-tetrazo- lium, inner salt (MTS) is a colorimetric assay to establish the number of viable cells [23]. The intensity of viable cells is measured by reading absorbancy at 490nm. MTS assays were analyzed 2, 4 and 7 days after seeding the cells by CellTiter 96® Aqueous One Solution Cell Proliferation Assay (Promega), according to manufacturer’s instruction.
RNA Extraction and cDNA preparation
Total RNA was extracted from CNDT2.5 and CNDT2.5 LT treated with 1 μM octreotide for 24, 48 and 72 hours by using RNeasy® Mini Kit (Qiagen) and RNA quality was evaluated by using Agilent RNA 6000 Nano Reagents Part І (Agilent Technologies). Genomic DNA contamination, total RNA integrity and ratio of 28S and 18S bands are properly pictured by using the Agilent 2100 Bioanalyzer (Agilent Technologies). DNA contamination is removed using DNA-free™ DNase treatment and removal reagents (Ambion). Total RNA (2 μg) from each preparation was reverse transcribed by using SuperScript® ш Reverse Transcriptase (Invitrogen). Non-reverse transcriptase controls were includes as negative controls.
Reverse transcription PCR
Total RNA was extracted from CNDT2.5 and CNDT2.5 LT and cDNA was prepared for the PCR amplification with following genes: the five dopamine receptors (DR1, DR2, DR3, DR4
and DR5), TPH1, TRPA1, P21, P27 and Ki67. PCR amplification was performed with the following protocol: 95°C for 4 minutes, 40 cycles of 45 seconds denaturing at 95°C, 30 seconds of annealing at 60°C and 1 minute of extension at 72°C and then followed by an elongation at 72°C for 10 minutes. PCR products were analyzed, by electrophoresis on 2.5%
agarose gels; they were visualized by ethidium bromide staining. The primers and the amplicon sizes are illustrated in table 1.
Quantitative Real-Time PCR (Q RT-PCR)
Q RT-PCR was performed by using Applied Biosystems 7500 Fast Real –Time PCR system.
cDNA (100 ng/μL) in 5.5μL of water was mixed with 200 nM of forward and reverse primers (1 μL) and 12.5μL of 2X Power SYBR Green PCR Master Mix (Applied Biosystems).
Primers sequences are showed in table 1.
The cDNA was amplified with the following condition: 50°C for 2 minutes, 95°C for 10 minutes and 40 cycles at 95°C for 15 seconds and 60°C for 1 minute. Primer-dimers presence can be detected by using the melting point analysis. We involved negative controls without templates and each experimental sample was analyzed in triplicate. Average expression data from triplicate was obtained from the threshold cycle number (Ct) and evaluated by 2-ΔΔCT
method [24]. Data was normalized by using β-actin as a housekeeping gene.
Table 1 Primers sequences used in RT and Q RT PCR
Primer Sequence (5'- 3')
Gene Forward Reverse Size (bp) β-actin GGAGAAGATGACCCAGATCATG ACAGCCTGGATAGCAACGTACA 69 DRD1 GACCACCACAGGTAATGGAAAG AAGAAAGGTAGCCAACAGCACA 141 DRD2 CGAGCATCCTGAACTTGTGTG GCGTTATTGAGTCCGAAGAGG 172 DRD2* CTCCTCCATCGTCTCCTTCT CGGTGCAGAGTTTCATGTCC 188 DRD3 GTACAGCCAGCATCCTTAATCTCT ACAGAAGAGGGCAGGACACA 168 DRD4 GACGCCCTTCTTCGTGGT GACAGTGTAGATGACGGGGTTG 130 DRD5 CTGGGCTAACTCCTCACTCAAC ATTGCTGATGTTCACCGTCTC 130 Ki67 GCCCCAACCAAAAGAAAGTCT AGCTTTGTGCCTTCACTTCCA 133 P21 GGCAGACCAGCATGACAGATT GCGGATTAGGGCTTCCTCTT 73 P27 TGGAGAAGCACTGCAGAGAC GCGTGTCCTCAGAGTTAGCC 252 P27* CTGCAACCGACGATTCTTCTACT GGGCGTCTGCTCCACAGA 101 TRPA1 GAGAGTCCTTCCTAGAACCATATCTGA CATGAGGACAATTGGGACAAATATT 104 TPH1 GAAGATGCAAAGGAGAAGATG GACCTTAGCAAGGGCATCAC 175
*: Primers detect one transcript out of two
Protein Extraction
Total cell lysate protein was used to extract proteins from CNDT2.5 and CNDT2.5 LT treated with octreotide for 24, 48 and 72 hours. Cells were homogenized in ice-cold radioimmuno precipitation assay (RIPA) lysis buffer (10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 150 mM NaCl, 1% Triton X-100, 0.5 % deoxycholic acid (Sigma), 0.1% SDS, 1 mM Pefabloc SC and 1 complete mini tablet (Roche) in 10 ml) Protein concentration was assayed using Coomassie Plus – The Better Bradford Assay (Pierce).
Serotonin Enzyme-linked Immunosorbent Assay (ELISA)
The serotonin ELISA was used for the quantitative determination of serotonin in total cell lysate. The measurement was performed by using a commercially available serotonin ELISA Kit (Immune Biological Laboratories) following manufacturer’s instructions. CNDT2.5 and CNDT2.5 LT were treated with octreotide for 24, 48 and 72 hours. Total lysate (400 μg) were used for serotonin detection.
Western Blot Analysis
Protein samples (50 μg) were resolved by 10% of SDS PAGE and transferred to 0.45 μm nitrocellulose membranes (Bio-Rad). The membranes were blotted with a rabbit polyclonal antibody, p44/42 MAPK (ERK 1/2), in 1: 1000 dilution (9102, Cell Signaling Technology) and rabbit polyclonal antibody phospho-p44/42 MAPK (pERK1/2), diluted 1 in 1000 (9101, Cell Signaling Technology). The membranes were then washed and incubated with a peroxidase-conjugated anti-mouse/rabbit antibody (Roche). The blots were visualized using Lumi-LightPLUS Western Blotting Substrate (Roche) and the membranes were then stripped (stripping buffer: 2% SDS, 62.5mM Tris-HCl, pH6.8 and 100mM 2-mercaptoethanol) at room temperature for one hour. After stripping the membranes were re-blotted by using a goat polyclonal β-actin antibody diluted 1 :1000, that is an endogenous control antibody (Santa Cruz Biotechnology) and horseradish peroxidase (HRP)-conjugated donkey anti-goat in 1:5000 dilution (Santa Cruz biotechnology) was used as secondary antibody. The blots were visualized by using Lumi-LightPLUS Western Blotting Substrate (Roche).
Acknowledgements
I have been helped by many people to finish the degree project. First of all, thanks to my supervisor Valeria Giandomenico who gave me the chance to learn a lot of lab work, write scientific papers and improve my presentation skills. I have done the project in two departments, Clinical Immunology at Rudbeck and Endocrine Oncology, Medical Sciences at Uppsala University Hospital.
People helped me to perform my work at Rudbeck Laboratory as follow
Thanks to Prof. Magnus Essand who provided literature support. To perform MTS assay, Justyna Leja that offered me experimental design tips and data analysis. Graciela Elgue kindly assisted me in performing ELISA array. It was a great time to work with people at Clinical Immunology, Rudbeck Laboratory as following: Angelica Loskog, Angelika Danielsson, Andrew, Fribeg, Kerstin Anger, Di Yu, Sara Mangsbo, Lisa Christiansson, Linda Gustavsson, Camilla Lindqvist, Ole Forsberg and Victoria Rashkova.
I also want to thank people at Endocrine Oncology, Medical Sciences, Uppsala University Hospital. Prof. Kjell Öberg provided the best support for my lab work. There are also many friendly and kindly people as follow: Åsa Forsberg, Dhana Aronsson, Malin Grönberg, Jan Saras and Janet Cunningham.
During this period, Tao Cui who is one member of our team gave me a great help when I first join the group and also keep helping me all the time. Giovanni Di Meglio is the other team member who taught me cell culture and offered medical knowledge to me.
Finally, thanks to my lovely family giving me full support.
References:
1. Siddique, Z.L., Drozdov, I., Floch, J., Gustafsson, B.I., Stunes, K., Pfragner, R., Kidd, M.
and Modlin, I.M. 2009. KRJ-1 and BON cell lines: Defining an appropriate entrochrimaffin cell neuroendocrine tumor model. Neuroendocrinology, doi 10.1159/000209330.
2. Modlin, I.M., Latich, I., Kidd, M., Zikusoka, M and Eick, G. 2006. Therapeutic options for gastrointestinal carcinoids. Clinical Gastroenterology and Hepatology 4: 526-547.
3. Pinchot, S. N., Holen, K., Sippel, R.S. and Chen, H. 2008. Carcinoid tumors. The Oncologist 13: 1255-1269.
4. Spiller, R. 2007. Recent advances in understanding the role of serotonin in gastrointestinal motility in functional bowel disorders: alterations in 5-HT signaling and metabolism in human disease. Neurogastroenterol Motil 19: 25-31.
5. Barakat, M. T., Meeran, K. and Bloom, S. R. 2004. Neuroendocrine tumors.
Endocrine-Related Cancer 11: 1-18.
6. Klöppel, G., Rindi, G., Anlauf, M., Perren, A. And Komminoth, P. 2007. Site-specific biology and pathology of gastroenteropancreatic neuroendocrine tumors. Virchows Arch 451:S9-S27.
7. Carmen Jacobs, RN, OCN®. 2009. Neuroendocrine tumors a rare finding: Part I. Clinical Journal of Oncology Nursing, doi 10.1188/09.CJON.21-23.
8. Yao, J. C., Hassan, M., Phan, A., Dagohoy, C., Leary, C., Mares, J. E., Abdalla, E. K., Fleming, J. B., Vauthey, J. N., Rashid, A. and Evans, D. B. 2008. One hundred year after
“Carcinoid”: Epidemiology of and prognostic factors for neuroendocrine tumors in 35, 825 cases in the United States. Journal of Clinical Oncology 26: 3063-3072.
9. Robertson, R. G., Geiger, W. J. and Davis, N. B. 2006. Carcinoid tumors. American Family Physician 74: 429-434.
10. Modlin, I. M., Kidd, M., Latich, I., Zikusoka, M. N. and Shapiro, M. D. 2005. Current status of gastrointestinal carcinoids. Gastroenterology 128: 1717-1751.
11. Höpfner, M., Schuppan, D. and Scherübl. 2008. Treatment of gastrointestinal neuroendocrine tumors with inhibitors of growth factor receptors and their signaling pathways: Recent advances and future perspectives. World Gastroenterol 14: 2461-2473.
12. Hubina, E., et al. 2006. Somatostatin analogues stimulate p27 expression and inhibit the MAP kinase pathway in pituitary tumors. European Journal of Endocrinology 155:
371-379.
13. Grozinsky-Glasberg, S., Shimon, I., Korbonits, M. And Grossman, A. B. 2008.
Somatostatin analogues in the control of neuroendocrine tumors: efficacy and mechanisms.
Endocrine-Related Cancer 15: 701-720.
14. Kidd, M., Drozdov, I., Joseph, R., Pfragner, R., Culler, M and Modlin,I. 2008. Differential cytotoxicity of novel somatostatin and dopamine chieric compounds on
15. Pohl, E., Heine, A. and Sheldrick, G. M. 1995. Structure of octreotide, a somatostatin analogue. Acta Crystallographica 51: 48-59.
16. Srirajaskanthan, R., Watkins, J., Marelli, L., Khan, K. And Caplin, M. E. 2009. Expression of somatostatin and dopamine 2 receptors in neuroendocrine tumors and the potential role for new biotherapies. Neuroendocrine Tumors 89: 308-314.
17. Ferone, D., et al. 2005. Somatostatin and dopamine receptor expression in lung carcinoma cells and effects of chimeric somatostatin-dopamine molecules on cell proliferation. 289:
1044-1050.
18. Gershon, M. D. and Tack, J. 2007. The serotonin signaling system: from basic understanding to drug development for functional GI disorder. Gastroenterology 132:
397-414.
19. Hansen, M. B. and Witte, A. B. 2008. The role of serotonin in intestinal luminal sensing and secretion. Acta Physiologica 193: 311-323.
20. Spiller, R. 2007. Recent advances in understanding the role of serotonin in gastrointestinal motility in functional bowel disorder: alterations in 5-HT signaling and metabolism in human disease. Neurogastroenterol Motil 19: 25-31.
21. Nozawa K., et al. 2009. TRPA1 regulates gastrointestinal motility through serotonin release from enterochromaffin cells. PNAS 106: 3408-3414.
22. Van Buren ∏, G., et al. 2007. The development and characterization of a human midgut carcinoid cell line. Clinical Cancer Research 13: 4704-4712.
23. Patel, M. I., Tuckerman, R and Dong, Q. 2005. A pitfall of the 3-(4,5-Dimethylthiazol-2-yl)-5(3-carboxymethonyphenol)-2-(4-sulfophenyl)-2H-
tetrazolium (MTS) assay due to evaporation in wells on the edge of a 96 well plate.
Biotechnology letters 27: 805-808.
24. Lival, K. J. and Schmittgen, T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and 2-ΔΔCT method. Methods 25: 402-408.
25. Abukhdeir, A. M. and Park, B. H. 2008. P21 and p27: role in carcinogenesis and drug resistance. Expert Reviews, doi 10.1017/S1462399408000744.
26. Scholzen, T. and Gerdes, J. 2000. The Ki-67 protein: from the known and unknown.
Journal of Cellular Physiology, 182: 311-322.
27. Lesche, S., Lehmann, D., Nagel, F. Schmid, H. A and Schulz, S. 2009. Differential effects of octreotide and pasireotide on somatostatin receptor internalization and trafficking in Vitro. Journal of Clinical Endocrinology and Metabolism, 94: 654-661.
28. Baragli, A., Alturaihi, H., Watt, H. L., Abdallah, A. And Kumar, U. 2007.
Heterooligomerization of human dopamine receptor 2 and somatostatin receptor 2 co-immunoprecipitation and fluorescence resonance energy transfer analysis. Cellular Signalling, 19: 2304-2316.
