Gene Expression in Cbx1-/- and Cbx1+/+
Mouse Brains and Placentas
Lin Wang
Degree project inapplied biotechnology, Master ofScience (2years), 2009 Examensarbete itillämpad bioteknik 30 hp tillmasterexamen, 2009
Biology Education Centre and Sub-department ofDevelopment &Genetics, Uppsala University Supervisor: Reinald Fundele
List of abbreviation
Actβ actin, beta
AD Alzheimer's disease
Anxa2 annexin A2
Ascl2 achaete‐scute complex homolog 2
B6 C57BL/6
CAST CAST/EiJ
Cbx1/3/5 chromobox homolog 1/3/5
CD chromodomain
Cdkn1c cyclin‐dependent kinase inhibitor 1C
CSD chromoshadow domain
EST expressed sequence tag
FTLD‐U frontotemporal lobar degeneration with ubiquitinated inclusions
H19 H19 fetal liver mRNA
H3K9Me2/H3K9Me3 di‐ or trimethylated lysine 9 of histone H3 HMTase histone methyltransferase
HP1 heterochromatin protein‐1
IC2 imprinting center 2
Igf2 insulin‐like growth factor 2
IHC Immunohistochemistry
Kcnq1ot1 KCNQ1 overlapping transcript 1
LOI loss‐of‐imprinting
MGI Mouse Genome Informatics
M/M;C/M;M/C;S/M mating between female ×male mice (M stands for C57BL/6; C stands for CAST/EiJ; S stands for M. spretus)
MRC Medical Research Council
MSP M. spretus
Msuit mouse specific ubiquitously imprinted transcript 1 NCBI National Center for Biotechnology Information
Nnat Neuronatin
Npc2 Niemann Pick type C2
NTF3 neurotrophin 3
Peg3 paternally expressed 3
PEV position‐effect variegation
polyQ poly‐glutamine
Ptov1 prostate tumor over expressed gene 1 qRT‐PCR quantitative real time PCR
Rasgrf1 RAS protein‐specific guanine nucleotide‐releasing factor 1 RFLP restriction fragment length polymorphism
SNP single‐nucleotide polymorphism
Snrpn small nuclear ribonucleoprotein N Ube2K ubiquitin‐conjugating enzyme E2K9 Usp29 ubiquitin specific peptidase 29
Summary
Heterochromatin protein‐1 (HP1) is a nonhistone chromosomal protein that enables heterochromatin formation and gene silencing. Additional findings increasingly suggest new functionalities of HP1, such as stabilization of telomeres and control of gene expression, and others. However, the physiological function of HP1 remains unknown. A previous study, in which our laboratory participated, disrupted the murine Cbx1 gene, which encodes the HP1β isotype, and showed perinatal lethality of newborn mice. This is most probably caused by abnormal differentiation of the neuromuscular junctions in the diaphragm, which causes the newborn mice to suffocate. In addition, defective development of the cerebral cortex was observed. In the brain, microarray hybridizations were performed to identify genes that showed altered expression without HP1β; interestingly, a significant proportion of the genes found with differential expression in Cbx1‐/‐ brains are associated with neurodegeneration. Moreover, since HP1 is capable of gene silencing, the former study in placenta focused on loss‐of‐imprinting (LOI) due to homozygous mutation of Cbx1. The genes, Rasgrf1 (RAS protein‐specific guanine nucleotide‐releasing factor 1) and Nnat (neuronatin), showed LOI in a litter mate Cbx1‐/‐ placenta, not in liver and brain.
This study was carried out in an attempt to further confirm the previous discoveries. qRT‐PCR (quantitative real time PCR) and immunohistochemistry (IHC) were performed on Cbx1 wild‐type and mutant mouse brains to determine the neurodegeneration‐related genes’ abnormal expression levels. However, rather contradictory results were obtained, except for consistency of two brain genes: Igf2 (insulin‐like growth factor 2) and Anax2 (annexin A2), which were observed to be up‐regulated in Cbx1‐/‐ brains. In the placenta, Rasgrf1 and Nnat were shown to be expressed only in non‐maternal cells by IHC. LOI of Rasgrf1 was tested by RT‐PCR/RFLP (restriction fragment length polymorphism) analyses, but surprisingly, no imprinting of Rasgrf1 was found in the placenta. No RFLP was available for further LOI studies on Nnat.
Introduction
Heterochromatin protein‐1 (HP1) obtained its name because of its association with heterochromatin (James and Elgin, 1986), the condensed state of chromatin with limited transcription. HP1 was first discovered in Drosophila as a suppressor of the silencing effect of heterochromatin in position‐effect variegation (PEV) (Eissenberg et al., 1990), which is a variegation caused by the silencing of a gene when it is placed near or within heterochromatin.
Since this first observation HP1 has been shown to function in heterochromatin formation and gene silencing in many organisms (Fanti and Pimpinelli, 2008).
Evolutionary conservation and gene organization
Later studies showed that the HP1 family is highly evolutionarily conserved, and that it exists in almost all eukaryotic organisms (Lomberk et al., 2006). The conservation of HP1 function has been shown by cross‐species experiments: HP1 gene in Schizosaccharomyces, which is named swi6, can be successfully replaced by murine HP1 (Wang et al., 2000); besides, human HP1 is able to substitute for Drosophila HP1, rescuing homozygous mutants of Su(var)2‐5, the gene encoding HP1 in Drosophila, from lethality (Norwood et al., 2004). In mammals there are three HP1 protein isotypes, HP1α, HP1β and HP1γ, which are encoded by chromobox homolog 5 (Cbx5), Cbx1, and Cbx3 respectively (Jones et al., 2000). HP1α and HP1β are localized mainly in heterochromatin, while HP1γ is found in both heterochromatin and euchromatin (Minc et al., 2000). Although Cbx1, Cbx3 and Cbx5 encode proteins with such distinct localization patterns, they are approximately 65% identical (Vermaak et al., 2005).
Structural features
All three HP1 isotypes consist of a conserved N‐terminal chromodomain (CD) and a conserved C‐terminal chromoshadow domain (CSD), connected by a hinge region (Lomberk et al., 2006).
The chromodomain binds to di‐ or trimethylated lysine 9 of histone H3 (H3K9Me2, H3K9Me3) (Lachner et al., 2001), the epigenetic marks for gene silencing. The chromoshadow domain can interact with proteins containing the consensus pentapeptide PXVXL (Thiru et al., 2004). The linker is believed to affect the regulation of HP1 protein, such as localization and interactions (Lomberk et al., 2006) (Fig. 1). Although the functions are different, the chromodomain shares identical amino‐acid with the chromoshadow domain (Cowieson et al., 2000). One hypothesis suggests that, based on the fact of high similarity between the two domains, HP1 encoding genes could have arisen from a duplication of one of these domain encoding genes (Lomberk et al., 2006).
Fig. 1 The conserved structure of HP1 proteins. Any HP1 isotype is made up of the chromodomain (CD) at the N terminus (N) and the chromoshadow domain (CSD) at the C terminus (C) linked by the hinge region. The functions of different domains are also indicated.
Function
A wide range of functions have been discovered for HP1. The most common function of HP1 is heterochromatin formation and gene silencing. As mentioned above, this activity involves interaction between the chromodomain and the histone modifications H3K9Me2 and H3K9Me3, the epigenetic marks for gene silencing (Lachner et al., 2001). The chromodomain folds into a globular conformation consisting of an antiparallel three‐stranded β sheet and an α helix in the carboxy‐terminal segment (Ball et al., 1997). The hydrophobic groove formed on one side of the β sheet provides the appropriate environment for the chromodomain to dock onto the methyl K9 histone H3 mark. In fact, it has been proposed that, expect for chromodomain, chromoshadow domain of HP1 also participates in the heterochromatin binding activity. A model has been suggested on this interaction, with an involvement of the specific HP1‐interacting histone methyltransferase (HMTase). In this model, HMTase methylates H3K9, creating a binding site for the chromodomain, while interacting with chromoshadow domain. In this way, heterochromatin with a repressed gene activity is formed (Fanti and Pimpinelli, 2008).
Apart from heterochromatin formation and gene silencing, HP1 has been identified with several other functions. HP1 mutation in Drosophila leads to multiple fusions of telomeres, causing extensive chromosome breakages, which indicates that HP1 has a function in stabilization of telomeres (Fanti et al., 1998). In mammals, HP1 proteins are found to be involved in recruiting the cohesion complex and kinetochore proteins, the proteins necessary for chromosome segregation at mitosis (Zhang et al., 2007). Studies show that HP1 participates in regulation of euchromatic gene expression, with a correlation with RNA (Piacentini et al., 2003; Brower‐Toland et al., 2007). Besides, one recent study discovered that in mammalian cells HP1β is involved in DNA damage repair together with casein kinase 2 (Ayoub et al., 2008).
More and more HP1 interacting molecules have been discovered in recent years; however, the precise functions of the three heterochromatin proteins in mammalian cells are not well known.
HP1β, encoded by Cbx1, is the most studied out of these three proteins.
Neurodegeneration
A previous study from the laboratory has shown that homozygosity for a null Cbx1 mutation causes perinatal lethality of new born mice, which is most likely due to deficient formation of neuromuscular junctions (Aucott et al., 2008). Moreover, the Cbx1‐/‐ fetuses exhibited abnormal cerebral cortex development, associated with reduced proliferation of neuronal precursors, widespread cell death and edema; the in vitro cultures of neuroshperes from Cbx1‐/‐ brains indicate a severe genomic instability (Aucott et al., 2008).
In order to identify genes with altered expression that might potentially be directly regulated by binding of HP1β, the protein encoded by Cbx1, microarray hybridizations were performed on Cbx1‐/‐ and Cbx1+/+ brains. DNA microarray technique is largely used to measure changes in gene expression levels. It consists of a series of DNA probes which hybridize a cDNA sample each so as to quantify the expression level; probe‐target hybridization is usually quantified by detection of fluorescence signal; quantified signals are compared with each other to calculate the
“fold change”, which is a way of describing how much larger or smaller one gene’s expression level is compared with another. In brain, it was found that significant numbers of genes were differentially expressed between Cbx1‐/‐ and Cbx1+/+. Interestingly, a significant proportion of
the differentially expressed brain genes are associated with neurodegeneration, such as Ube2K (ubiquitin‐conjugating enzyme E2K9) (de Pril et al., 2007) and Npc2 (Niemann Pick type C2) (Naureckiene et al., 2000) et al.. The abnormal histology of Cbx1‐/‐ mouse brains as well as the findings on neurodegeneration related genes that showed altered expression levels in Cbx1 mutant brains strongly suggested a function of HP1β in brain development. Attentions, therefore, were attracted to reveal the role of HP1β in neurodegeneration.
Loss‐of‐imprinting (LOI)
Together with discovery of defective development of the brain in Cbx1‐/‐ mice, unpublished results show that the placenta is another organ that exhibits abnormal development in the absence of Cbx1 (Yu et al., unpublished). In the placenta, previous work focused on the study of LOI due to homozygous mutation of Cbx1. Imprinted genes are epigenetically marked by DNA methylation or histone modifications and are normally expressed from only one parental allele (Lewis et al., 2004). It was found that imprinting in mouse placenta is controlled by repressive histone methylation rather than DNA methylation (Lewis et al., 2004). As HP1 proteins are able to bind to the H3K9Me2 and H3K9Me3 so as to lead to gene silencing, the idea was to determine whether loss of HP1β, leads to imprinting changes in the placenta.
First, 6 imprinted genes mapping to distal chromosome 7, the chromosomal region containing the imprinting center 2(IC2) (Lewis et al., 2004), were analyzed in Cbx1‐/‐ and Cbx1+/+ placentas.
For these genes, Ascl2 (achaete‐scute complex homolog 2), Cdkn1c (cyclin‐dependent kinase inhibitor 1C), H19 (H19 fetal liver mRNA), Igf2 (insulin‐like growth factor 2), Kcnq1ot1 (KCNQ1 overlapping transcript 1), and Msuit (mouse specific ubiquitously imprinted transcript 1), no evidence of LOI was found. After this several imprinted genes that do not map to distal 7, such as Peg3 (paternally expressed 3), Usp29 (ubiquitin specific peptidase 29), Snrpn (small nuclear ribonucleoprotein N), Rasgrf1 (RAS protein‐specific guanine nucleotide‐releasing factor 1) and Nnat (neuronatin), were analyzed by RT‐PCR/RFLP (restriction fragment length polymorphism).
RFLP is a variation of DNA sequence that can be examined by digesting with restriction enzymes and analyzing the size of the product fragments by gel electrophoresis. It was found that only Rasgrf1 (on chromosome 9) and Nnat (on chromosome 2) showed LOI due to loss of HP1β specifically in placenta, but not in liver and brain.
Aim
The aim of this project was to confirm the discoveries from the former studies on the effect of homozygous mutation of Cbx1 on mouse brain and placenta. In the brain, to verify the expression levels of the neurodegeneration related genes, which showed abnormal expression in the previous study in Cbx1‐/‐ brains, techniques such as qRT‐PCR and IHC were used. In the placenta, IHC was performed to first reveal the expression patterns together with levels of Rasgrf1 and Nnat in both Cbx1+/+ and Cbx1‐/‐ placentas, and RT‐PCR/RFLP was followed aiming to confirm LOI in Cbx1‐/‐ placentas.
Results
Mice analyzed
For neurodegeneration study, matings between Cbx1+/‐×Cbx1+/‐ mice were set up to generate Cbx1+/+ and Cbx1‐/‐ mice. PCR based genotyping was done to determine the genotype of each embryo (Fig.2).
Fig. 2: Genotype PCR on Cbx1. The PCR product of Cbx1 wild type allele is of 249 bp, while the disrupted Cbx1 allele is of 1.6 kb (Aucott et al. 2008).
Table 1 shows the number of litters and the number of embryos whose genotypes were analyzed.
Litter Embryonic day
Embryo number
Dead Cbx1+/+ Cbx1+/‐ Cbx1‐/‐
M/M 1 E18 11 0 4 6 1
M/M 2 E18 8 0 3 2 3
M/M 3 E18 9 0 1 6 3
M/M 4 E18 9 1 2 3 3
M/M 5 E16 12 5 2 2 3
Table 1: for neurodegeneration study, 12 Cbx1+/+ and 13 Cbx1‐/‐ embryos from 5 litters were obtained.
In the study for neurodegeneration, two pairs of embryo brains of both wild‐type and Cbx1 mutant at day E16 were analyzed by qPR‐PCR (Table 2).
Litter Cbx1+/+ Cbx1‐/‐
qRT‐PCR done in this study M/M 5 M/M 5.1 M/M 5.4 M/M 5.7 M/M 5.6
Table 2: qRT‐PCR data obtained from previous and current studies. Mice were generated by matings between B6 female and male.
For LOI study, matings and genotyping were done previously. Information written here serves as a background for my study. Matings between Cbx1+/‐ mice and CAST were set up to generate mice heterozygous for Rasgrf1CAST and Rasgrf1B6 (Yu, et al., unpublished). Table 3 shows the number of litters and number of embryos whose genotypes were analyzed.
Litter Embryonic day
Embryo number
Dead Cbx1+/+;
Rasgrf1CAST/ Rasgrf1B6
Cbx1+/‐;
Rasgrf1CAST/ Rasgrf1B6
Cbx1‐/‐;
Rasgrf1CAST/ Rasgrf1B6
C/M 1 E18 8 0 0 0 0
M/C 1 E18 11 1 0 0 0
M/C 2 E18 4 0 0 0 0
C/M 2 E18 7 1 1 0 0
M/C 3 E18 7 6 0 0 0
C/M 3 E18 5 0 0 0 0
C/M 4 E18 6 0 1 0 2
M/C 4 E18 2 0 0 0 1
C/M 5 E18 7 0 0 2 0
Table 3: for LOI study, 2 Cbx1+/+; Rasgrf1CAST/Rasgrf1B6 and 3 Cbx1‐/‐; Rasgrf1CAST/Rasgrf1B6 embryos together with placentas from 9 litters were obtained.
The RT‐PCR/RFLP analyses for the LOI study were performed in this project using the two Cbx1+/+;
Rasgrf1CAST/ Rasgrf1B6 and three Cbx1‐/‐; Rasgrf1CAST/Rasgrf1B6 placentas, as described in Table 2.
For both neurodegeneration and LOI studies, genes’ expression levels as well as expression patterns were obtained by IHC. IHC was done on brains and placentas of Cbx1+/+ and Cbx1‐/‐
fetuses (Table 4). Only the median part of brains and placentas at day E18 were taken for analyses.
Litter Cbx1+/+ Cbx1‐/‐
IHC on brain M/M 1 M/M 1.6 M/M 1.2 IHC on placenta M/M 1 M/M 1.1 M/M 1.2 Table 4: Mouse brains and placentas used for IHC.
Neurodegeneration studies on Cbx1‐/‐ mouse brains
A previous study had described perinatal lethality of Cbx1‐/‐ new‐born mice, which is likely due to abnormal development of the brain; aberrant cerebral cortex development was found, associated with reduced proliferation of neuronal precursors and widespread cell death and edema (Aucott et al., 2008). To identify the alterations in gene expression that underlie and/or accompany abnormal cerebral cortex development in Cbx1‐/‐ brain, microarray hybridization was performed on brains of embryonic day E18 wild‐type and mutant mice using the OCI 15k and 7.4k mouse cDNA microarrays (http://www.microarrays.ca/products/types.html). Those double‐spotted arrays contained 15,264 and 7,407 sequence‐verified, non‐redundant mouse expressed sequence tag (ESTs) from the National Institute of Aging (http://lgsun.grc.nia.nih.gov/) resulting in a set of approximately 22,600 ESTs. An EST is a short sub‐sequence from a cDNA sequence, which can be used to identify gene transcripts. At a p value of < 0.001, 189 ESTs were identified that exhibited
altered expression in Cbx1‐/‐ as compared to wild‐type brains. Database searches for the annotated genes showed that many of those have known functions in brain development and function and that a subset of those genes is involved in different neurodegenerative processes.
Examples in this subgroup are shown in Table 5.
Gene Fold change value
Ube2K 0.69
Npc2 1.81
Anxa2 2.41
Igf2 5.08
Ptov1 2.95
NTF3 0.80
Table 5: A previous study using microarray hybridization detected several neurodegeneration related genes with altered expression levels in Cbx1‐/‐ mouse brains compared with Cbx1+/+ brains.
UBE2K, the protein product of Ube2K (ubiquitin‐conjugating enzyme E2K9), interacts with huntington protein (Mishra M. et al. 2007; de Pril et al., 2007). The protein is causally involved in Huntington’s disease, which is a neurodegenerative disease caused by dominant mutations that expand the number of glutamine codons within an existing poly‐glutamine (polyQ) repeat sequence of the huntington gene (Hatters, 2008). A direct link to neurodegeneration has also been shown for Npc2 (Niemann Pick type C2), the gene whose mutation causes Niemann‐Pick disease, type C2 (Naureckiene et al., 2000). This is an autosomal recessive lipid storage disorder that affects the viscera and central nervous system. Neurodegeneration in NPC starts very early in life and is fatal. For the other genes mentioned above, no such direct link to neurodegeneration has been described, however their functions in normal and diseased brain still make them interesting. NTF3 (neurotrophin 3) is a member of the neurotrophic factor family, which regulates survival and differentiation of mammalian neurons. NTFs are lacking in early stages of Alzheimer's disease (AD), but are found in enhanced concentrations in brains with severe AD. Intensive research mostly in rodents has recently led to first promising clinical trials of intracerebral neurotrophin application, indicating that neurotrophins will be part of new pharmacological strategies concerning AD (Schulte‐Herbrüggen, 2008). For Igf2 (insulin‐like growth factor 2), in vitro neuroprotective function against the toxic activity of beta‐amyloid has been demonstrated (Jarvis et al., 2007). To the best of my knowledge, no in vivo tests have shown a neuroprotective function of Igf2. Anxa2 (annexin A2) was shown to be highly upregulated in a specific form of neurodegeneration, frontotemporal lobar degeneration with ubiquitinated inclusions (FTLD‐U), however, its function is at present not clear (Mishra et al., 2007). Ptov1 (prostate tumor over expressed gene 1), which was identified being overexpressed in prostate cancer (Santamaría et al., 2005), was selected not because it is directly involved in neurodegeneration, but because its translated protein, PTOV1 was found to interact with the lipid raft protein flotillin‐1, which was discovered being involved in AD (Rajendran et al.,2007).
In order to verify precise expression levels of genes of interest, qRT‐PCR was performed on Igf2, Ptov1, Anxa2 and Npc2 using two pairs of Cbx1‐/‐ and Cbx1+/+ brains, E16 litter mate embryos.
However, rather unexpected results were obtained. Generally the qRT‐PCR results showed smaller fold change value of each tested gene between mutant and wild‐type, compared with what was found by microarray analyses. Only the up‐regulation of Igf2 was confirmed. Anxa2, which had
been shown to be enhanced by a factor of 2.41 in the microarray hybridizations, exhibited no change in the qRT‐PCR analyses. Ptov1, Npc2, which had shown to be up‐regulated by microarray, were found to be down‐regulated in Cbx1‐/‐ brain by qRT‐PCR (Fig. 3). Thus, the previous microarray results could not be verified by qRT‐PCR.
Fig. 3: qRT‐PCR of Igf2, Ptov1, Anxa2 and Npc2 in the brain of two pairs of Cbx1+/+
and Cbx1‐/‐ E16 mouse embryos from one litter. Expression levels were shown as fold change, that is the relative gene expression (% of Actβ) in Cbx1‐/‐ brain divided by the relative gene expression (%
of Actβ) in Cbx1+/+ brain.
At the same time, it was decided to analyze the expression patterns on the protein level by an in situ technique, IHC. IHC was done on Ube2K, Anxa2 and NTF3, with both E18 Cbx1‐/‐ and Cbx1+/+ mouse brains. As shown in Fig. 4A,B, the staining of Ube2K showed overall expression of Ube2K at day E18 in both Cbx1 mutant and wild‐type brains; but no significant difference showing altered expression of Ube2K was observed. For Anxa2 (Fig. 4C‐H), both Cbx1‐/‐ and Cbx1+/+ brains at day E18 showed specific staining at stem brain, mid brain and vessel cells; after the same treatment, a deeper staining of Cbx1‐/‐ brain was observed, which indicates a higher expression level of Anxa2 in brains from Cbx1 mutant mice than in Cbx1 wild‐type mice. As to NTF3 (Fig. 4I,J), an overall staining was observed from both Cbx1‐/‐ and wild‐type mouse brains, showing no specific differences in terms of expression level or expression pattern. To sum up, compared with previous microarray results, a higher expression level of Anxa2 in the Cbx1‐/‐
brain was confirmed by the IHC result; however, this altered expression was not observed by qRT‐PCR analyses. The down‐regulation of Ube2k and NTF3 as found by microarray analyses, could not be confirmed by IHC results. However, during IHC processing, we noticed that the tissue of Cbx1‐/‐ brains was very soft and in some cases of almost pasty consistence; the fragmentized Cbx1‐/‐ brain tissue can be observed from all Cbx1‐/‐ brain slides. The aberrant histology of Cbx1 mutant mouse brain tissue reveals that the absence of Cbx1 leads to abnormal development of brain.
Cbx1+/+ Cbx1‐/‐
Fig. 4: IHC on both Cbx1+/+ and Cbx1‐/‐ mouse brains at days E18 from mice M/M1.6 (Cbx1+/+) and M/M1.2 (Cbx1‐/‐). A,B: staining of Ube2K on Cbx1+/+ and Cbx1‐/‐ mouse brains showed no specific difference. C‐H: Anxa2 was shown expressing in stem brain, mid brain and vessel cells(G,H) in both Cbx1+/+ and Cbx1‐/‐ mouse brains; the staining was generally deeper in Cbx1‐/‐ brain (arrows); E‐H were stained by hematoxylin after IHC. I,J: staining of NTF3 showed no specific difference between Cbx1+/+ and Cbx1‐/‐ mouse brains.
LOI studies
A former study carried out in the laboratory found LOI of Rasgrf1 and Nnat in Cbx1‐/‐ placenta (Fig. 8A). In my project, a new mouse strain derived from CSAT×B6 matings was used to verify the LOI discovery.
Anxa2
First, IHC of Rasgrf1 and Nnat was decided to be performed on both Cbx1‐/‐ and Cbx1+/+
placentas. The reason was that, no previous studies have been done on the expression patterns of Rasgrf1 and Nnat in placenta, so it would be rather interesting to see the localizations where these two genes are expressed, as well as how the absence of HP1β, affects their expression.
Moreover, since the placenta of eutherian mammals is composed of both maternal cells and non‐maternal cells, which are called “zygote‐derived” (Georgiades et al., 2002), the genotypes of maternal cells and zygote‐derived cells could be different. In this study, all the female mating mice were of Cbx1+/‐, so LOI in placenta could be found only in Cbx1‐/‐ zygote‐derived cells.
Therefore, the expression patterns of Rasgrf1 and Nnat in placenta, that is, if Rasgrf1 and Nnat are expressed in maternal cells or not, should be decided. Here it should be noted that, “the genotype of the placenta” refers to the genotype of zygote‐derived cells in this paper.
IHC was performed to identify cells expressing Rasgrf1 and Nnat, using both Cbx1‐/‐ and Cbx1+/+
placentas at days E18. As shown in Fig. 6A,B, staining of Rasgrf1 can be observed only in trophoblast cells in both Cbx1‐/‐ and Cbx1+/+ placentas. Being one kind of zygote‐derived cells, trophoblast cells are the cells differentiating from the fertilized egg and forming the outer layer of a blastocyst, which provide nutrients to the embryo (Fig. 5). For Nnat, as shown in Fig. 6C‐F, staining can be observed from spongiotropholast and chorionic plate of both Cbx1‐/‐ and Cbx1+/+ placentas. Spongiotrophobalst is of trophectodermal origin, belonging to zygote‐derived cells, with the function to increase the surface area for exchange of nutrients, oxygen and waste between the fetus and its mother (Rinkenberger and Werb, 2000). Chorionic plate is where the placenta bounds on its fetal aspect, consisting of the fused amnion and chorion, which are all zygote‐derived (Georgiades, et al., 2002). Beside of expression patterns, no difference of expression levels of Rasgrf1 and Nnat between Cbx1‐/‐ and Cbx1+/+ can be observed from IHC tissue slides (Fig.6A‐F).
Fig.5 Placental development in the mouse. Early development of the mouse embryo from embryonic day (E) 3.5‐E12.5, showing the origins of the extra‐embryonic lineages and the components of the placenta. ICM, inner cell mass. (After Rossant & Cross, 2001)
Cbx1+/+ Cbx1‐/‐
Fig. 6: IHC on both Cbx1+/+ and Cbx1‐/‐ mouse placentas at days E18 mice M/M1.1 (Cbx1+/+) and M/M1.2 (Cbx1‐/‐).
A,B: IHC of Rasgrf1 on Cbx1+/+ and Cbx1‐/‐ mouse placentas both showed staining of trophoblast cells (arrows). C‐F:
staining of Nnat showed its expression in spongiotropholas t(C, D arrows) and chorionic plate (E,F arrows) in both Cbx1+/+ and Cbx1‐/‐ mouse placentas.
In order to study LOI using RFLP, cross matings between B6 and CAST were continuously set up so as to generate mice with heterozygouse alleles of aiming genes. RFLP was found for Rasgrf1 between B6 and CAST but not for Nnat, so the further analyses on LOI only focused on Rasgrf1.
Knowing the expression pattern of Rasgrf1, that is, Rasgrf1 is only expressing in zygote‐derived cells, RNA and DNA were extracted from half of the complete placentas, with Cbx1+/+;
Rasgrf1CAST/Rasgrf1B6 and Cbx1‐/‐; Rasgrf1CAST/Rasgrf1B6 genotypes. Genotyping PCR was done to select the placentas of the right genotypes, among the pre‐selected Cbx1+/+ and Cbx1‐/‐ mice (Fig. 7).
Fig.7: PCR based genotyping of Rasgrf1 (heterozygous or homozygous Rasgrf1CAST and Rasgrf1B6). Rasgrf1 lies on chrom 9. at 50 cM, while the polymorphic microsatellites used for genotyping lies on chrom 9. at 49 cM (D9Mit291) and 52 cM (D9Mit35) respectively. Heterozygosity of both D9Mit35 and D9Mit291 PCR products was considered as heterozygous for Rasgrf1; conceptuses heterozygous for either D9Mit35 or D9Mit291 but homozygous at the other locus were not taken as the genotype of Rasgrf1 could not be decided.
As mentioned above, the previous study found LOI for Rasgrf1 in placenta. Rasgrf1 gene has been found to be an imprinted gene paternally expressed in mice (Plass et al., 1996). This study, however, found the expression of Rasgrf1 from both alleles (Rasgrf1CAST and Rasgrf1B6) in both Cbx1+/+ and Cbx1‐/‐ placentas. As shown in Fig. 8, only Rasgrf1B6 allele could be digested by restriction enzyme, while Rasgrf1CAST could not. If Rasgrf1 gene is imprinted in wild‐type mice, which means it is only expressing from the paternal allele, that is the Rasgrf1B6 allele in this case, there should be only digested two bands showing on the gel; the un‐digested band from Cbx1+/+
indicates an expression of Rasgrf1 from also the Rasgrf1CAST allele, that is the maternal allele, which should not express if Rasgrf1 is imprinted (Fig. 8). Both expression from Rasgrf1CAS and Rasgrf1B6 alleles from Cbx1+/+ and Cbx1‐/‐ placentas indicates that there is no imprinting of Rasgrf1 in mouse placenta, which is a contradictory discovery from previous result.
Fig.8: LOI studies in placentas. A: previous study (Yu, et al., unpublished) found LOI of both Rasgrf1 and Nnat in Cbx1‐/‐ mouse placenta.
“+/+” is Cbx1+/+ and “‐/‐” is Cbx1‐/‐. For Rasgrf1, both maternal allele (B6) and paternal allele (MSP) were expressing in Cbx1 mutant placenta;
for Nnat, a small amount of maternal expression (MSP) was shown in Cbx1‐/‐ placenta. While in this study, RT‐PCR/RFLP analysis showed no differential LOI between Cbx1+/+ and Cbx1‐/‐
placentas at days E18 (B and C). B: Rasgrf1B6 allele was digested by restriction endonuclease HYP8I while Rasgrf1CAST was not. C: In both Cbx1+/+ and Cbx1‐/‐ placentas, expression from both Rasgrf1CAST and Rasgrf1B6 were found, no matter the paternal allele was from B6 or CAST.
Discussion
Neurodegeneration
The results of qRT‐PCR and IHC analyses with genes of interest (Igf2, Ptov1, Anxa2, Npc2, Ube2K and NTF3) on both Cbx1+/+ and Cbx1‐/‐ brains were rather contradictory with the previous results from microarray analyses. For IHC analyses, only Anxa2, which showed up‐regulated expression level in Cbx1‐/‐ brain, confirmed the microarray result; for Ube2K and NTF3, no down‐regulation in Cbx1‐/‐ brains can be observed from IHC slides. For qRT‐PCR, out of all the turbulence, only Igf2 remained up‐regulated. Anax2 showed no altered expression, while Ptov1 and Npc2 measured to be down‐regulated without HP1β, which were not aligning with the microarray results.
One reason for this could be the different genotypes of the mice used for the present and the previous, microarray‐based study. The mice used in the first study were on a mixed background of 129/Sva and C57BL/6, as no attempt had been made to breed the Cbx1 mutation into an inbred strain; in contrast to this, for the present study, the previously generated mice have been mated into B6, which means the off‐springs keep more and more B6 background. Identical genotypes can cause highly different phenotypes depending on strain background, as demonstrated in other mouse models, such as the Min mouse (Dietrich et al., 1993; McCart et al.,2008) and others.
However, although Anax2 was shown by qRT‐PCR to exhibit no real change in expression between wild‐type and mutant brains, its up‐regulation in Cbx1‐/‐ brains was detected by both microarray and IHC. In fact, during processing of the embryonic brains for qRT‐PCR, we noticed that the Cbx1‐/‐ brain tissue from that litter was generally softer and more fragile than Cbx1‐/‐ brains before, which might be a biological variation. The Cbx1‐/‐ embryos from the last litter used for qRT‐PCR analyses, although have the same genotype with other Cbx1‐/‐ mice, can biologically vary in terms of genes’ expression due to different reasons at development stage; one such example is the different sizes and weights of fetuses with the same genotype from one litter.
Therefore, biological variation could be one explanation for no expressional change of Anxa2 found by qRT‐PCR in Cbx1‐/‐ brains from this litter.
On the other hand, considering the limited tests done, experimental error could be big. To reduce the chance of error, microarray should be repeated to select genes consistently showing abnormal expression in Cbx1‐/‐ brain, and more sets of animal should be analyzed by qRT‐PCR on these selected genes.
LOI
As mentioned above, a previous preliminary study carried out in the laboratory showed imprinting of Rasgrf1 in wild‐type placenta and LOI in a litter mate Cbx1‐/‐ placenta. Rasgrf1 was found to be paternal‐specifically expressing in neonatal mouse brain, mouse heart and stomach, but biallelically expressing in other tissues of lung, thymus, testis and ovary (Plass et al., 1996).
Database searching has been done on the information of imprinting of Rasgrf1 in mouse placenta, such as Mouse Genome Informatics (MGI) (http://www.informatics.jax.org/), Medical Research Council (MRC) (http://www.har.mrc.ac.uk/index.html) and National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov/), but no such evidence was recorded, so both of the previous discoveries of imprinting and LOI of Rasgrf1 were very interesting findings. But
unexpectedly, such discoveries could not be verified in this study. It might be due to technical problems. To exclude such an assumption, imprinting of Rasgrf1 should be tested in brain again, since previously, together with the finding of imprinting in placenta, brain was the other organ showed imprinting of Rasgrf1. If imprinting of Rasgrf1 can not be verified in brain, very likely there should be technical problems, but, on the other hand, if imprinting in brain is found again, there is a likelihood imprinting of Rasgrf1 does not exist in placenta. Moreover, imprinting, as an epigenetic modification, can be species‐specific (Szabo and Mann, 1995). Since the mouse strain previously used was generated from MSP and B6 cross matings, different from the mouse strain used for this study, which is derived from CAST×B6 matings, so it could be a reason for different imprinting manners detected of Rasgrf1.
Besides, from the IHC stained slides, except for expression patterns, loss‐of‐HP1β’s effect on Rasgrf1 and Nnat’s expression levels could also be observed. There did not seem to be altered expression between Cbx1+/+ and Cbx1‐/‐ placentas for both Rasgrf1 and Nnat. It might indicate that Cbx1 homozygous mutation does not affect the expression levels of Rasgrf1 and Nnat. But, if needed in the future, a more precise technique, such as qRT‐PCR should be applied to study the genes’ expression levels.
Materials and Methods
Generation of mice
The Cbx1 gene was previously disrupted by inserting the TK‐Neo gene into a unique Smal site in exon 4 of the Cbx1 gene (Aucott et al. 2008), originally in Sv but bred into C57BL/6 (B6), which is derived from Mus musculus mouse laboratory strain. Cbx1+/+ and Cbx1‐/‐ mice were obtained from consistent matings between Cbx1+/‐ mice. For the study on LOI, crossed matings were performed between Cbx1+/‐ mice and CAST/EiJ (CAST), which is the strain derived from the mouse subspecies Mus musculus castaneus. The B6 strain was maintained at the Laboratory of Dr. Prim Singh, Borstel, Germany. The CAST strain was purchased from Jackson Laboratories (Bar Harbor, ME). qRT‐PCR was done with embryonic day 16 (E16) mouse embryos. All the other studies were performed with embryonic day 18 (E18) mouse embryos, because Cbx1‐/‐ mice die at birth or a few hours after (Aucott et al. 2008).
DNA preparation and Genotyping
DNA preparation. Genotyping was done by PCR. Tail cuts of adult mice and limb samples from fetal mice were taken. Each tissue sample was put into 1.5 ml tube, and incubated at 50 °C for 10 hours in 14 μl 20 mg/ml proteinase‐K in 500 μl TNES buffer (containing 2.5 μl of 2 M Tris pH 8, 5 μl of 0.5 M EDTA pH 8, 20 μl of 5 M NaCl, 20 μl of 10% SDS, and 452.5 μl MiliQ water). After protein digestion with proteinase‐K, DNA was extracted from each tissue sample using phenol‐chloroform and precipitated with ethanol (Sambrook et al., 1989), and final concentration was measured by NanoDrop® ND‐1000 spectrophotometer (NanoDrop Technologies, Inc.).
Cbx1 genotyping. Cbx1 genotyping PCR was done in a 20 μl reaction volume, which contained approximately 200 ng DNA template, 0.2 μl DreamTaq Polymerase (Fermentas), 2.5 μl 10×Buffer (Fermentas), 0.5 μl dNTPs, 0.5 μl 10 μM forward primer and 0.5 μl 10 μM reverse primer, and MiliQ water to a final volume of 20 μl. Forward primer sequence was
5’‐GTCAGGCCGAGGGTCACT‐3’, and reverse primer sequence was
5’‐ACAGTCAGAAAAGCCACGAGGC‐3’ (Aucott et al. 2008). The thermal cycles were set as:
denaturation at 95 °C for 5 min, 35 cycles of 94 °C for 30 sec (denaturation), 60 °C for 30 s (annealing), 72 °C for 2 min (extension), final extension at 72 °C for 5 min. The PCR product of Cbx1 wild type allele is of 249 bp, while the disrupted Cbx1 allele is of 1.6 kb (Aucott et al. 2008).
Rasgrf1 genotyping. To determine the genotype of Rasgrf1 (heterozygous or homozygous Rasgrf1CAST and Rasgrf1B6), which lies on chrom 9. at 50 cM, genotyping should be done.
Polymorphic microsatellite sequences were used to differentiate between B6 and CAST alleles.
One polymorphic microsatellite, D9Mit35, which lies on chrom. 9 at 52 cM and for which the B6 derived allele is of 124 bp as compared to the CAST derived allele of 108 bp was picked. The other polymorphic microsatellite used was D9Mit291, lying on chrom. 9 at 49 cM and for which the B6 derived allele is of 111 bp while CAST is of 89 bp. Rasgrf1 lies in between of D9Mit35 and D9Mit291 on chrom. 9. Heterozygosity of both D9Mit35 and D9Mit291 PCR products was considered as heterozygous for Rasgrf1 because the likelihood of double‐recombination within 3 cM, which results in homozygous Rasgrf1, is very small; equally, homozygosity of both D9Mit35 and D9Mit291 was considered as homozygous for Rasgrf1. The mice which showed homozygosity
of either D9Mit35 or D9Mit291 were not taken because the chance of one recombination within 3 cM, which leads to heterozygous Rasgrf1, is still very small. For D9Mit35, the primer pair was:
forward 5’‐CCAGCGCACTGTTCTGATAA‐3’, reverse 5’‐AGGTGCCTTCTGCTTTGAAA‐3’
(http://www.informatics.jax.org/searches/probe.cgi?38747). For D9Mit291, the primer pair was:
forward 5’ CATCCCCTTTTACTCTGAGTGG‐3’, reverse 5’‐CTAGCCTAGCAGACTTGATGAGC‐3’
(http://www.informatics.jax.org/searches/probe.cgi?39685). The 25 μl PCR reaction system contained around 200 ng DNA template, 1.25 μl RedTaq Polymerase (Sigma), 2.5 μl 10×Buffer (Sigma), 0.5 μl dNTPs, 1 μl 10 μM primer pair, and MiliQ water to a final volume of 25 μl. The thermal cycles were set as: denaturation at 94 °C for 5 min, 35 cycles of 94 °C for 30 sec (denaturation), 55 °C for 30 s (annealing), 72 °C for 30 s (extension), final extension at 72 °C for 7 min. The mice, whose both PCR products showed two different bands, were assumed heterozygous for Rasgrf1CAST and Rasgrf1B6 and selected for LOI study.
cDNA synthesis and qRT‐PCR analyses
Total RNA from Cbx1‐/‐ and Cbx1+/+ E16 mouse sagittal half brains was obtained by treating the brain tissue with Trizol (InvitrogenTM), then extracting RNA with phenol‐chloroform and precipitating with ethanol (Sambrook et al., 1989). Each RNA sample was further DNase‐treated with RQ1 RNase‐free DNase (Promega) and purified using phenol‐chloroform and precipitated with ethanol (Sambrook et al., 1989). RNA quality and quantity was subsequently assessed by NanoDrop® ND‐1000 spectrophotometer (NanoDrop Technologies, Inc.). Reverse transcription was done with 1 μg total RNA from each sample in a 20 μl reaction system including 1 μl M‐MLV reverse transcriptase (Promega), 4 μl M‐MLV reverse transcriptase buffer 5× (Promega), 0.4 μl RNase In. (Promega), 0.4 μl 100 mm DTT, 1 μl 10 mm dNTP, 1 μl random primer (Promega) and the rest of MiliQ water. The cDNA sequence information was obtained from UCSC Genome Bioinformatics (http://genome.ucsc.edu/); the primers for qRT‐PCR were designed by Primer3Plus (http://www.bioinformatics.nl/cgi‐bin/primer3plus/primer3plus.cgi) and synthesized by eurofins (http://www.eurofinsdna.com). Detailed information of these primer pairs are provided in Table 6.
Each PCR reaction was done in a 20 μl volume. The reaction mixture comprised 2 μl cDNA template, 10 μl SYBR (Roche), 2 μl of each primer pair 5 μM and 6 μl water. The real time qRT‐PCR was performed by Rotor‐Gene RG‐3000 qPCR machine (Techtum Lab) with the amplification program as: denaturation step at 95 °C for 5 min, 35 cycles of 95 °C for 15 s (denaturation), 60 °C for 30 s (annealing), 70 °C for 30 s (extension). Data were collected and analyzed by Rotor‐Gene software (Techtum Lab). The 2−DDCT method was used with Actβ as the reference gene (Franch et al. 2006; Erkens et al. 2006), to determine mean fold changes in gene expression between Cbx1‐/‐ and Cbx1+/+ mouse brains.
Gene symbol
Gene name Forward primer sequence (5’‐3’)
Reverse primer sequence (5’‐3’)
Actβ actin, beta TGTTACCAACTGGGACGACA GATCTGGCACCACACCTTCT Igf2 insulin‐like growth
factor 2
ACAGAGGGTGGTCAGCAAAT TGGAACATTGGACAGAAACTC
Ptov1 prostate tumor over expressed gene 1
GTGGCAGGAGAAGCGTAGAC GCTGAGAGTTTCGGAACAGG
Anxa2 annexin A2 CACCAACTTCGATGCTGAGA CAAAATCACCGTCTCCAGGT Npc2 Niemann Pick type
C2
AGGTGAATGTGAGCCCATGT AGGCTCAGGAATAGGGAAGG
Table 6: Primer pairs used for qRT‐PCR.
RT‐PCR/RFLP analyses on Rasgrf1
Total RNA from half placentas of E18 mouse embryos, with Cbx1+/+; Rasgrf1CAST/Rasgrf1B6 and Cbx1‐/‐; Rasgrf1CAST/Rasgrf1B6 genotypes was extracted with AllPrep DNA/RNA Mini Kit (QIAGEN) according to the manufacturer’s instructions. Each RNA sample was further DNase‐treated with RQ1 RNase‐free DNase (Promega) and purified using phenol‐chloroform and precipitated with ethanol (Sambrook et al., 1989). RNA quality and quantity was subsequently assessed by NanoDrop® ND‐1000 spectrophotometer (NanoDrop Technologies, Inc.). cDNA was reverse transcribed by 1 μg total RNA from each sample using M‐MLV reverse transcriptase in the same manner as described above. In order to get Rasgrf1 DNA sequence for RFLP analyses, PCR was done. Forward primer was 5’‐AGAACATCCGCAAAAACCTG‐3’, and reverse primer was 5’‐GATGTCAGGTCCATGCTG‐3’. This primer pair amplifies a 446 bp DNA product. All the information of Rasgrf1 cDNA sequence was obtained from UCSC Genome Bioinformatics (http://genome.ucsc.edu/); the primer pair for PCR were designed by Primer3Plus (http://www.bioinformatics.nl/cgi‐bin/primer3plus/primer3plus.cgi) and commercially synthesized by eurofins (http://www.eurofinsdna.com/). PCR was done with a 50 μl reaction volume using HotStar HiFidelity Polymerase Kit (QIAGEN). Each reaction system contained 3 μl reverse transcripted DNA template, 10 μl 5×Buffer containing dNTPs, 5 μl primer pair, 1 μl HotStar polymerase and 31 μl RNAse free water. The thermal cycles were set as: denaturation at 95 °C for 5 min, 35 cycles of 94 °C for 15 sec (denaturation), 56 °C for 30 s (annealing), 72 °C for 1 min (extension), final extension at 72 °C for 10 min. The PCR products were purified using phenol‐chloroform and precipitated with ethanol (Sambrook et al., 1989). DNA quality and quantity was subsequently assessed by NanoDrop® ND‐1000 spectrophotometer (NanoDrop Technologies, Inc.). Previous found of the SNP (single‐nucleotide polymorphism) within Rasgrf1 cDNA sequence between B6 and CAST mouse species is of a difference as “5’‐GTCCAC‐3’” in B6,
“5’‐GTCCGC‐3’” in CAST. Restriction Endonuclease HYP8I (Fermentas) recognizes and cuts at
“5’‐GTN^NAC‐3’” and “3’‐CAN^NTG‐5’”, which cuts B6 allele, so as to be able to analyze Rasgrf1’s expression pattern. After digestion, the 446 bp Rasgrf1 cDNA product from B6 allele should be cut into a 157 bp fragment and a 289 bp fragment, while the Rasgrf1 cDNA product from CAST allele should remain 446 bp. The digestion was done at 37 °C for 60 min, with a 15 μl reaction system containing 2 μl DNA sample (around 300ng), 1.5 μl Buffer, 1 μl HYP8I and 10.5 μl MiliQ water. The digestion products were verified by electrophoresis in 1.5% agarose gel (InvitrogenTM).
Immunohistochemistry
Sagittal half brains from the E18 mouse embryos and half placentas were fixed in 4%
formaldehyde in 1×PBS at 4 °C over night, and kept in 30% sucrose in 1×PBS at 4 °C over night.
Fixed tissues were embedded in tissue‐tek (SAKURA) blocks on dry ice, and stored in ‐86 °C for further processing. These embedded tissues were cryosectioned at 18 μm and mounted on SuperFrost Plus slides (Thermo Scientific). Tissue slides were kept in Citrate Buffer (10 mM Citric Acid, 0.05% Tween 20, pH 6.0) at 80 °C for 10 min, rinsed briefly with 1×PBS, and incubated in
0.3% H2O2 in 1×PBS for 30 min, then rinsed with 1×PBS again. After the preparation, tissue slides were incubated with antibody diluents(Dako) for 30 min, and then with first antibody (Rabbit polyclonal to Ube2K 1:50, Anax2 1:1000, NTF 3 1:200, Rasgrf1 1:50, Nnat 1:1000, purchased from abcam) in room temperature for 60 min, then washed with 0.1% Triton X‐100 in 1×PBS three times for 30 min each. After that, tissue slides were incubated with swine anti‐rabbit immunoglobulins/biotinylated (1:200, Dako) in room temperature for 60 min, washed with 0.1% Triton X‐100 in 1×PBS three times for 30 min each. Then tissue slides were incubated with the streptavidin‐HRP conjugate (1:100, MicromaxTM) in room temperature for 60 min and washed with 0.1% Triton X‐100 in 1×PBS in the same manner, and then stained with DAB peroxidase substrate kit(Vector Laboratories, INC.) according to the manufacturer’s instructions for 6 to 10 min.
Hematoxylin staining
After IHC, slides were stained by hematoxylin. IHC stained slides were incubated in hematoxylin for 30 s, washed by flowing fresh tap water for 1 min, and then washed by disdilled water briefly.
Image acquisition and manipulation
Images (Fig. 4A‐J and Fig. 6A‐E) were captured at room temperature, by ProgRes C14 camera (Jenoptik). The acquisition software used for all images was C14 acquisition software (Jenoptik).
For Fig. 4E‐H and Fig. 6A‐E, a Leica MZ16 microscope was used, and for Fig. 4A‐D,I,J, a Leica DM2500 microscope was used. The pictures were assembled using Photoshop 7.0 (Adobe Systems, Inc.)
