Eider females form non-kin brood-rearing coalitions

(1)

Molecular Ecology (2005) 14, 3903–3908 doi: 10.1111/j.1365-294X.2005.02694.x

Blackwell Publishing, Ltd.

Eider females form non-kin brood-rearing coalitions

M A R K U S Ö S T ,* E M M A V I T I K A I N E N ,* P E T E R W A L D E C K ,† L I S E L O T T E S U N D S T R Ö M ,* K A I L I N D S T R Ö M ,* T U U L A H O L L M É N ,‡ J . C H R I S T I A N F R A N S O N§ and M I K A E L K I L P I¶

*Department of Biological and Environmental Sciences, PO Box 65 (Biocentre 3, Viikinkaari 1), FI-00014 University of Helsinki, Finland, †Department of Zoology, Animal Ecology, PO Box 463, SE-40530 Göteborg, Sweden, ‡Alaska SeaLife Center and School of Fisheries and Ocean Sciences, University of Alaska Fairbanks, PO Box 1329, Seward, AK 99664, USA, §US Geological Survey, National Wildlife Health Center, 6006 Schroeder Road, Madison, WI 53711, USA, ¶Aronia Research Centre, Åbo Akademi University

& Sydväst Polytechnic, Raseborgsvägen 9, FI-10600 Ekenäs, Finland

Abstract

Kin selection is a powerful tool for understanding cooperation among individuals, yet its role as the sole explanation of cooperative societies has recently been challenged on empirical grounds. These studies suggest that direct benefits of cooperation are often over- looked, and that partner choice may be a widespread mechanism of cooperation. Female eider ducks (Somateria mollissima) may rear broods alone, or they may pool their broods and share brood-rearing. Females are philopatric, and it has been suggested that colonies may largely consist of related females, which could promote interactions among relatives.

Alternatively, shared brood care could be random with respect to relatedness, either because brood amalgamations are accidental and nonadaptive, or through group augmentation, assuming that the fitness of all group members increases with group size. We tested these alternatives by measuring the relatedness of co-tending eider females in enduring coalitions with microsatellite markers. Females formed enduring brood-rearing coalitions with each other at random with respect to relatedness. However, based on previous data, partner choice is nonrandom and dependent on female body condition. We discuss potential mechanisms underlying eider communal brood-rearing decisions, which may be driven by the specific ecological conditions under which sociality has evolved in this species.

Keywords: body condition, brood amalgamation, direct fitness, kin selection, partner choice, Somateria mollissima

Received 1 December 2004; revision received 28 April 2005; accepted 11 July 2005

Introduction

Cooperation can evolve by shared genes, reciprocity, mutualism or group selection (e.g. Sachs et al. 2004). Ever since Hamilton’s (1964) seminal paper on the conditions under which altruism can spread in a population gained wide recognition in the late 1970s, many studies of social evolution have focused on the role of relatedness in the origin and maintenance of sociality. Facilitated by modern molecular techniques, intragroup relatedness has been measured in a great variety of social systems (Ross 2001).

The majority of cooperating individuals among social insects (Queller & Strassmann 1998) and many cooperatively

breeding birds and mammals (Griffin & West 2003) are indeed related to each other, as expected under kin selection.

The relative importance of direct and indirect fitness benefits in outweighing the costs of caring for nondescendant offspring is currently under debate, since recent empirical findings have challenged the view that kin selection can provide a satisfactory general explanation of cooperative societies (Clutton-Brock 2002; Avilés et al. 2004). Instead, these studies suggest that direct benefits could be sufficient to maintain cooperation in some social systems (Clutton-Brock 2002), and that partner choice may be a widespread but so far underrated evolutionary mechanism for cooperation (Noë 2001; Sachs et al. 2004). Cases where cooperators are unrelated are particularly interesting, because such groups of cooperators should confer direct fitness Correspondence: Markus Öst, Fax: +358-(0)9-191 57694; E-mail:

markus.ost@helsinki.fi

(2)

3904 M . Ö S T E T A L .

benefits on all their members (Bernasconi & Strassmann 1999). These cases also highlight the need to put greater emphasis on the other two parameters of Hamilton’s inequality — the costs and benefits of cooperation — which are a function of the specific ecological and demo- graphic conditions under which sociality evolves (Avilés et al. 2004).

Female eider ducks (Somateria mollissima) may rear broods alone, or they may pool their broods and share brood-rearing duties (Öst et al. 2003a). Females are strongly philopatric (Baillie & Milne 1989; Swennen 1990;

Bustnes & Erikstad 1993), with reduced gene flow among colonies (Tiedemann & Noer 1998; Tiedemann et al. 1999).

Hence, eider colonies might largely consist of related females (Tiedemann & Noer 1998). Thus, the natural history of eiders is consistent with the conditions that would favour kin selection in post-hatch brood amalgamation, but so far this possibility remains untested. Alternatively, the decision of shared brood care could be completely random with respect to relatedness. This scenario could hold true if brood amalgamations are purely accidental and nonadaptive, as has been suggested for ducks (Munro & Bédard 1977; Afton 1993; Savard et al. 1998).

More generally, if the fitness of all group members increases with the size of their group, cooperative behaviour could be maintained by group augmentation alone, regardless of kin composition (Kokko et al. 2001;

Clutton-Brock 2002; Avilés et al. 2004). Here we show by using molecular markers that neither of these opposing views applies to our study population — co-tending eider females are unrelated to each other, yet partner choice is nonrandom (Öst et al. 2003a), and we discuss potential mechanisms underlying communal brood-rearing decisions in this species.

Materials and methods

Field data

This study was carried out at Tvärminne Zoological Station (59°50′N, 23°15′E), on the Baltic Sea in southwestern Finland during 1997–2002. Eider females during late incubation were captured on the nest with hand nets, a blood sample was taken from the jugular or ulnar vein, and females were given 3 × 3-cm flags with a unique colour combination attached to a primary (Kilpi et al. 2001).

Altogether 596 females were marked with flags during 1997–2002 (Öst et al. 2003b), and blood samples were collected from 96 different birds from 18 nesting islands (Fig. 1). Because blood sampling was possible only when a person with the approval of the University of Helsinki Institutional Animal Care Committee was present, we do not have blood samples from all females. However, blood samples were taken on many different occasions in all years, so the risk of targeting a nonrepresentative sub- fraction of the population is low.

We monitored the tagged females for at least 30 days after hatching. All observations of a known female during 1 day constituted one observation. At each sighting of a female we recorded her identity, whether she was attending a brood, and the total number of females and ducklings in the brood. Each focal brood was followed long enough to ensure correct assessment of the brood-rearing status of all females attending the brood (Öst et al. 2003a). This assessment is straightforward, as nontending females are not tolerated within broods and are promptly chased away by the tending female(s) (Öst et al. 2003b). A coalition was defined as enduring if at least two individually known females and their ducklings had consistently associated Fig. 1 Study area. Sampling colonies for eiders are shown in black, and adjacent groups of small islets with a small sample size that were combined in molecular analyses are encircled.

(3)

C O - T E N D I N G E I D E R F E M A L E S A R E U N R E L A T E D 3905

over a period of at least 2 weeks (Öst et al. 2003a). Of our sample of 96 genotyped females, 41 birds formed 24 enduring brood-rearing coalitions with each other, 24 females were lone tenders, and the remaining 31 birds were either transient crèchers, abandoners, or the only known coalition partner in an enduring coalition. Three genotyped females formed enduring coalitions in more than 1 year.

Molecular markers

We genotyped the females at 6–8 microsatellite loci; DNA was extracted from blood samples using the standard phenol–chloroform protocol (Sambrook et al. 1989). Primer sequences for Aalu1, Sfiµ3, Sfiµ4, Sfiµ5 and Sfiµ7 were obtained from Fields & Scribner (1997). For Sfiµ9, Sfiµ10 and Sfiµ11, we designed new primers (Table 1) within the flanking areas of the repeat regions. Sequences for these were obtained from GenBank (www.ncbi.nlm.nih.gov/GenBank/, Accession nos AF180499, AF180500 and AF180501; Libants et al. 2001).

Polymerase chain reaction (PCR) was carried out for Sfiµ3, Sfiµ4 and Sfiµ7 in 10-µL volume containing 1 µL template DNA, 1× PCR-buffer for Dynazyme (Finnzymes), 0.1 U Dynazyme polymerase II (Finnzymes), 0.5 µm R and F primers and 0.2 mm of each dNTP. The PCR products were labelled internally by adding 5 µmol fluorescent [R110]

FdCTP (Applied Biosystems) to each reaction. For Sfiµ5 Sfiµ9, Sfiµ10, Sfiµ11 and Aalu1, we used fluorescence- labelled forward primers (HEX, FAM or NED), and PCRs were carried out in 10-µL volume containing 1 µL template DNA, 1× PCR buffer for Dynazyme (Finnzymes), 0.5 µm of R and F primers, 0.2 mm of each dNTP and 0.25 U Dynazyme polymerase II (Finnzymes). All reactions were carried out in Peltier PTC-100 Thermal Cycler with an initial denaturation step at 95 °C for 4 min, followed by 34 cycles at 94 °C for 45 s, the locus-specific annealing temperature (Table 1) for 45 s, elongation at 72 °C for 1 min, and

a final elongation step at 72 °C for 10 min. The size of the fragments were determined with the MegaBACE 1000 sequencer (Amersham Biosciences) (Sfiµ5, Sfiµ9, Sfiµ10, Sfiµ11 and Aalu1) or ABI PRISM® 377 sequencer (Sfiµ3, Sfiµ4 and Sfiµ7) using an internal genescan® 400HD[ROX]

size standard (PE Applied Biosystems).

Analysis of genetic structure and relatedness

We first tested all loci for deviation from Hardy–Weinberg equilibrium and for linkage disequilibrium between all pairs of loci with genepop 3.4 (Raymond & Rousset 1995).

We then analysed population structuring within the study area by first estimating the inbreeding coefficients (F_IS) and the within-population differentiation coefficients (F_ST) using fstat 2.9.3 (Goudet 2001) (5000 permutations; Fig. 1), and then using baps (Corander et al. 2003) to identify grouping within the entire population independent of the islands.

To assess whether related females preferably form brood-rearing associations together, we estimated the pairwise relatedness between all pairs of females using the pairwise relatedness option in kinship 1.1.2 (Goodnight &

Queller 1999). We compared the average genetic similarity of the 24 pairs of brood-rearing females which had formed enduring coalitions with each other with that of 24 pairs drawn at random from the total pool of 96 females. All pairwise relatedness estimates were calculated against the background allele frequencies of the total population (Goodnight & Queller 1999).

Results

All loci were polymorphic with 3–25 alleles per locus and a gene diversity ranging from 0.33 to 0.95 (Table 1). Tests for linkage disequilibrium showed all loci were unlinked and showed no significant deviance from Hardy–Weinberg equilibrium (χ² = 16, d.f. = 16, P = 0.4501).

Table 1 Microsatellite loci used in the study to assess relatedness among 96 eider females: primer sequence, annealing temperature (T_a), allele size, number of alleles per locus (N_A), observed heterozygosity (H_O), and gene diversity (D) (Nei 1987)

Locus Primer sequence T_a Allele size N_A H_O D

Sfiµ3 Fields & Scribner 1997 52 123–129 bp 3 0.343 0.327

Sfiµ9 F: TTCCTTCCAACCCAAGACATTC′ 60 128–140 bp 7 0.771 0.680

R: AAACTTCCAACCATTCTTCAAGG′

Sfiµ10 F: TCCAGCTGAAGCTACAAGACATG′ 60 184–230 bp 10 0.809 0.806

R: CCACTTACTACATGCTGCGTGC′

Sfiµ11 F: CTTCTGCAAGCCTCATCACCATG′ 65 203–215 bp 3 0.295 0.307

R: TAAGCCAAAGCTCTAGTCACTTGC′

Aalu1 Fields & Scribner 1997 50 72–86 bp 6 0.556 0.570

(4)

3906 M . Ö S T E T A L .

We found no significant differentiation between nesting islands at the scale studied here (F_ST = 0.004, P = 0.331), and we found no significant inbreeding (F_IS = −0.012, P = 0.11). This also implies that no null alleles were present in any of the loci included in the analysis. Similarly, the analysis with baps detected no differentiation among islands while the highest posterior probability (P = 0.9975) was for a population structure in which all the islands clustered together. However, when each individual was considered separately independent of the island structure, we found 10 subgroups (posterior probability 0.8816), with an average within-group relatedness of 0.143 (95% confidence intervals obtained by bootstrapping over loci: lower 0.066, upper 0.231; fstat 2.9.3).

Females forming enduring brood-rearing associations had on average relatedness of r = −0.058 (SD = 0.240, N = 24). We compared this value to the average relatedness obtained by randomly sampling (without replacement) 24 female pairs 1000 times out of all the possible female combinations. In 857 cases we found a relatedness value as high or higher than the observed one. Therefore the observed pairs were not on average more related than any random pair of females in the population. Since the sample size is limited we tested our power to detect deviations from average relatedness values of r = 0.1, r = 0.125 and r = 0.250.

Because we are testing against an expected value we used a power test based on a one-sample t-test. We estimated the standard deviation (SD = 0.262) from all possible female pairs (N = 4556) and our power to detect the above-mentioned deviations are 0.819, 0.914, and 1.0, respectively. Out of the 24 pairs of females that formed an enduring coalition, only three pairs (12.5%) comprised closely related females (r ≥ 0.250). The relatedness matrix for all 96 females in the population contained 787 pairs (17.3%) with a relatedness above 0.25, which would corre- spond to half-siblings. Given these values, our three pairs of highly related females forming a brood-rearing coalition could have been obtained by chance (χ² = 0.28, d.f. = 1, P = 0.60).

Discussion

Here we have shown that coalitions in female eiders are not formed between relatives. These results add to a growing number of studies indicating that kin-based social interactions are not a fundamental condition for cooperative animal societies. The near-zero relatedness between co-tending females is not due to the absence of relatives to join, as our Bayesian analysis revealed clusters of closely related females in the population. Hence, our data should be sufficient to identify related pairs and detect positive relatedness had this been the case. Interestingly, the clusters detected with baps were uncoupled with nesting islands and post-hatch brood rearing sites.

Our results may seem surprising, considering that the natural history of eiders may be expected to result in nesting aggregations of related females (Tiedemann & Noer 1998), thus promoting interactions among relatives. How- ever, in our study population, the spatial structure of nesting colonies is somewhat different from that of previously studied populations. Based on 15 years of ringing recovery data, breeding philopatry of adult females is extremely high in our population (M. Kilpi & M. Öst, unpublished data), despite the presence of many adjacent small breeding colonies (Öst & Kilpi 2000; Fig. 1). However, unlike breeding philopatry, strict natal philopatry apparently does not hold over the very fine-scaled spatial structure considered here, in contrast to the large, relatively isolated populations studied elsewhere (Baillie & Milne 1989;

Swennen 1990; Bustnes & Erikstad 1993).

Since eider females receive no genetic returns of cooperating, kin selection will be absent, and the formation of brood-rearing coalitions must be controlled by the balance between direct fitness benefits and costs. Brood care in eiders entails costs; in our study population, females tending small ducklings feed on nonpreferred food (Öst & Kilpi 1999), whereas in other populations, feeding areas of adults and young may be spatially separated (Gorman &

Milne 1972). Nonetheless, the costs of caring for nondescendant young in joint broods are probably low, as individual females feed more but are less vigilant when more females are present (Öst et al. 2002). Thus grouping bene- fits may promote shared care among post-incubating ener- getically stressed females, yet mitigate costs of caring for an enlarged brood. However, also the expected benefits of caring for additional young are probably low, as duckling survival in eider broods is independent of brood size (Bustnes & Erikstad 1991). In our study population, the ratio of ducklings to females actually decreases as female group size increases (Öst et al. 2003b). This decelerating group productivity function in itself presents a dilemma.

Stable groups of nonrelatives are predicted not to occur when per capita reproduction declines with increasing group size and entry is group controlled, as is the rule in animals with social dominance relationships (Giraldeau &

Caraco 2000). Coalition formation by eiders is character- ized by frequent aggression, and the presence of female dominance hierarchies (Munro & Bédard 1977; Öst 1999).

However, stable groups can form under these conditions if dominants and subordinates reproduce unevenly (Reeve

& Emlen 2000). Nonetheless, the most prevalent stable group size in eiders is only two females (Öst et al. 2003b), which may be influenced by the lack of relatedness among the participating females.

Although co-tending eider females are unrelated, our previous data show that partner choice is nonrandom:

‘lone tenders’ are on average in better body condition than females forming coalitions (Kilpi et al. 2001), and females

(5)

C O - T E N D I N G E I D E R F E M A L E S A R E U N R E L A T E D 3907

in better condition are found in coalitions with females in poor condition, not with other females in good condition (Öst et al. 2003a). Body condition is thus a criterion for part- ner choice, which might be expected in a capital breeder (Meijer & Drent 1999) subject to severe, environmentally induced weight loss during nesting (e.g. Parker & Holm 1990). Birds are sensitive to their own ability to provide care and they adjust their parental effort accordingly (e.g.

Pettifor et al. 1988), so female body condition may be con- sidered an ‘ecological constraint’ affecting the cost–benefit ratio of cooperation (Öst et al. 2003b). Hence, a female in good condition may be less likely to enter a coalition unless her reproductive share is large enough to equate her reproductive success under lone tending. Conversely, a female in poor condition is more likely to enter a coalition because her odds of successfully rearing a brood on her own are low, and thus she is willing to accept even a low share of reproduction in a coalition (Öst et al. 2003a). As a result, females in relatively good condition join females in poor condition, whereas the females in best condition tend alone.

How could female eiders sense the quality of prospect- ive partners, since it seems unlikely that females would be able to cue in on each others’ body conditions directly?

One possibility is parental investment in vigilance, which can easily be assessed by other females, and positively cor- related with body condition, both within and between coalitions (M. Öst, R. C. Ydenberg & C. W. Clark, unpublished).

Females also frequently change coalition partners soon after ducklings are hatched, before settling in their final group (Öst et al. 2003a). Cooperation can evolve by partner choice even if individuals interact only once (Sachs et al.

2004), in contrast with reciprocal altruism (Trivers 1971).

Our current longitudinal data on individual females are as yet insufficient to distinguish between alternative mechanisms of reciprocation.

Great behavioural flexibility distinguish vertebrate societies, and the selective forces responsible for cooperation may vary even among populations of the same species (e.g. Olendorf et al. 2004). Relatedness plays no role in post-hatch brood amalgamation of eiders in our population, but it may do so in other waterfowl parental care decisions.

For example, host and ‘parasite’ parent are related in goldeneyes (Bucephala clangula) (Andersson & Åhlund 2000). We therefore strongly encourage further studies measuring the relatedness between co-tending females in other eider populations, as well as research into the kin composition of amalgamated broods of waterfowl in general.

Acknowledgements

We thank Anette Bäck, Katja Helle, Kim Jaatinen, Patrik Karell, Lili Mantila, Heidi Nyman, Henry Pihlström, Tobias Tamelander

and Mats Westerbom for help in the field. Tvärminne Zoological Station provided working facilities. Financial support was provided by the Academy of Finland (grants no. 51895 and 104582 to MÖ, grant no. 163390 to MK), and Wilhelm and Martina Lundgrens Science fund (PW). We thank Malte Andersson and two anonymous reviewers for valuable comments on the manuscript.

References

Afton AD (1993) Post-hatch brood amalgamation in lesser scaup:

female behavior and return rates, and duckling survival. Prairie Naturalist, 25, 227–235.

Andersson M, Åhlund M (2000) Host–parasite relatedness shown by protein fingerprinting in a brood parasitic bird. Proceedings of the National Academy of Sciences, USA, 97, 13188–13193.

Avilés L, Fletcher JA, Cutter AD (2004) The kin composition of social groups: trading group size for degree of altruism.

American Naturalist, 164, 132–144.

Baillie SR, Milne H (1989) Movements of eiders Somateria mollissima on the east coast of Britain. Ibis, 131, 321–335.

Bernasconi G, Strassmann JE (1999) Cooperation among unrelated individuals: the ant foundress case. Trends in Ecology & Evolution, 14, 477–482.

Bustnes JO, Erikstad KE (1991) Parental care in the common eider (Somateria mollissima): factors affecting abandonment and adop- tion of young. Canadian Journal of Zoology, 69, 1538–1545.

Bustnes JO, Erikstad KE (1993) Site fidelity in breeding common eider Somateria mollissima females. Ornis Fennica, 70, 11–16.

Clutton-Brock TH (2002) Breeding together: kin selection and mutualism in cooperative vertebrates. Science, 296, 69–72.

Corander J, Waldmann P, Sillanpää MJ (2003) Bayesian analysis of genetic differentiation between populations. Genetics, 163, 357–374.

Fields RL, Scribner KT (1997) Isolation and characterization of novel waterfowl microsatellite loci: cross-species comparisons and research applications. Molecular Ecology, 6, 161–164.

Giraldeau L-A, Caraco T (2000) Social Foraging Theory. Princeton University Press, Princeton, New Jersey.

Goodnight KF, Queller DC (1999) Computer software for per- forming likelihood tests of pedigree relationship using genetic markers. Molecular Ecology, 8, 1231–1234.

Gorman ML, Milne H (1972) Crèche behaviour in the common eider Somateria m. mollissima L. Ornis Scandinavica, 3, 21–25.

Goudet J (2001) FSTAT version 2.9.3, a program to estimate and test gene diversities and fixation indices. Available from http://

www.unil.ch/izea/softwares/fstat.html.

Griffin AS, West SA (2003) Kin discrimination and the benefit of helping in cooperatively breeding vertebrates. Science, 302, 634–636.

Hamilton WD (1964) The genetical theory of social behavior, I and II. Journal of Theoretical Biology, 7, 1–52.

Kilpi M, Öst M, Lindström K, Rita H (2001) Female characteristics and parental care mode in the crèching system of eiders, Somateria mollissima. Animal Behaviour, 62, 527–534.

Kokko H, Johnstone RA, Clutton-Brock TH (2001) The evolution of cooperative breeding through group augmentation. Proceed- ings of the Royal Society of London. Series B, Biological Sciences, 268, 187–196.

Libants S, Oswald K, Olle E, Scribner K (2001) Isolation of micro- satellite loci from the spectacled eider, Somateria fischeri. Unpub- lished. Available from http://www.ncbi.nlm.nih.gov/Genbank/.

(6)

3908 M . Ö S T E T A L .

Meijer T, Drent R (1999) Re-examination of the capital and income dichotomy in breeding birds. Ibis, 141, 399–414.

Munro J, Bédard J (1977) Crèche formation in the common eider.

Auk, 94, 759–771.

Nei M (1987) Molecular Evolutionary Genetics. Columbia University Press, New York.

Noë R (2001) Biological markets: partner choice as the driving force behind the evolution of mutualisms. In: Economics in Nature (eds Noë R, Hammerstein P, van Hooff JARAM), pp. 93–118.

Cambridge University Press, Cambridge, UK.

Olendorf R, Getty T, Scribner K (2004) Cooperative nest defence in red-winged blackbirds: reciprocal altruism, kinship or by-product mutualism? Proceedings of the Royal Society of London. Series B, Biological Sciences, 271, 177–182.

Öst M (1999) Within-season and between-year variation in the structure of common eider broods. Condor, 101, 598–606.

Öst M, Kilpi M (1999) Parental care influences the feeding behaviour of female eiders Somateria mollissima. Annales Zoologici Fennici, 36, 195–204.

Öst M, Kilpi M (2000) Eider females and broods from neighboring colonies use segregated local feeding areas. Waterbirds, 23, 24–32.

Öst M, Mantila L, Kilpi M (2002) Shared care provides time- budgeting advantages for female eiders. Animal Behaviour, 64, 223–231.

Öst M, Ydenberg R, Kilpi M, Lindström K (2003a) Condition and coalition formation by brood-rearing common eider females.

Behavioral Ecology, 14, 311–317.

Öst M, Ydenberg R, Lindström K, Kilpi M (2003b) Body condition and the grouping behavior of brood-caring female common eiders (Somateria mollissima). Behavioral Ecology and Sociobiology, 54, 451–457.

Parker H, Holm H (1990) Patterns of nutrient and energy expend- iture in female common eiders nesting in the high arctic. Auk, 107, 660–668.

Pettifor RA, Perrins CM, McCleery RH (1988) Individual optimi- zation of clutch size in great tits. Nature, 336, 160–162.

Queller DC, Strassmann JE (1998) Kin selection and social insects.

Bioscience, 48, 165–175.

Raymond M, Rousset F (1995) genepop (version 1.2): population

genetics software for exact tests and ecumenicism. Journal of Heredity, 86, 248–249.

Reeve HK, Emlen ST (2000) Reproductive skew and group size: an N-person staying incentive model. Behavioral Ecology, 11, 640–647.

Ross KG (2001) Molecular ecology of social behaviour: analyses of breeding systems and genetic structure. Molecular Ecology, 10, 265–284.

Sachs JL, Mueller UG, Wilcox TP, Bull JJ (2004) The evolution of cooperation. Quarterly Review of Biology, 79, 135–160.

Sambrook J, Fritsch EF, Maniatus T (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

Savard J-PL, Reed A, Lesage L (1998) Brood amalgamation in surf scoters Melanitta perspicillata and other Mergini. Wildfowl, 49, 129–138.

Swennen C (1990) Dispersal and migratory movements of eiders Somateria mollissima breeding in the Netherlands.

Ornis Scandinavica, 21, 17–27.

Tiedemann R, Noer H (1998) Geographic partitioning of mito- chondrial DNA patterns in European eider Somateria mollissima.

Hereditas, 128, 159–166.

Tiedemann R, von Kistowski KG, Noer H (1999) On sex-specific dispersal and mating tactics in the common eider Somateria mollissima as inferred from the genetic structure of breeding colonies. Behaviour, 136, 1145–1155.

Trivers RL (1971) The evolution of reciprocal altruism. Quarterly Review of Biology, 46, 35–57.

This joint project involves a diverse array of research profiles.

Markus Öst’s main research interest is parental care cooperation and conflict in waterfowl; an interest shared by Mikael Kilpi, who also studies seabird conservation biology. Emma Vitikainen and Liselotte Sundström, with a shared interest in eusocial insects, provided genetic expertise. Peter Waldeck is currently doing his PhD thesis on conspecific brood parasitism in ducks, Tuula Hollmén and Christian Franson are studying contaminants and disease of seaducks, and Kai Lindström’s prime research interests are sexual selection and parental care in fish.